git.iko.soy/typeable/attoparsec
on master help sign in
swap
287a62d523 ahead, 0 behind
.ghcinew file+1
since splitsnapshots
unifiedsplit
@@ -0,0 +1 @@
1+:set -fobject-code -optP-include -optPdist/build/autogen/cabal_macros.h -itests
.gitignorenew file+6
@@ -0,0 +1,6 @@
1+*.hi
2+*.o
3+/dist/
4+.cabal-sandbox
5+cabal.sandbox.config
6+*.sw[op]
.hgignore+9−2
@@ -1,9 +1,16 @@
1−^(?:cabal-dev|dist)$
2−\.(?:aux|eventlog|h[ip]|log|[oa]|orig|prof|ps|rej|swp)$
1+\.(?:aux|eventlog|h[ip]|hs.html|log|[mt]ix|[oa]|orig|prof|ps|rej|swp)$
3~$
2~$
3+^(?:.+/|)\.cabal-sandbox/
4+^(?:.+/|)dist/
4benchmarks/Arse
5benchmarks/Arse
6+benchmarks/dist
5benchmarks/med.txt
7benchmarks/med.txt
6benchmarks/tiny
8benchmarks/tiny
9+benchmarks/warp-[0-9]*
10+cabal.sandbox.config
11+examples/c-http
12+examples/http_parser.[ch]
13+hpc.*\.html$
7
14
8syntax: glob
15syntax: glob
9.\#*
16.\#*
.hgtags+30
@@ -31,3 +31,33 @@ cbfbab5a33eb7522af4dd16b4306ef848b5b2350 0.8.6.1
3130d71153204a79666638fcb4765115cbfc8d2d93 0.9.1.0
3130d71153204a79666638fcb4765115cbfc8d2d93 0.9.1.0
3261f6daa5cd357349143e57b8530bd9ba7f55fdf6 0.9.1.1
3261f6daa5cd357349143e57b8530bd9ba7f55fdf6 0.9.1.1
33e539c7f6c6ceaa79318177cc3bc149d7b6e7c6c1 0.9.1.2
33e539c7f6c6ceaa79318177cc3bc149d7b6e7c6c1 0.9.1.2
34+3033c0af33fa3b83d002eb9150acf8949e56f19f 0.10.0.0
35+3033c0af33fa3b83d002eb9150acf8949e56f19f 0.10.0.0
36+d39f15e57df591fb785272ba5d3acf0d70fcb0ff 0.10.0.0
37+33c33d8467265f9f2226a351a59b616a5ace9fbb 0.10.0.1
38+066fc7a19fc07c3b7c50e9b591af3dc5591742a1 0.10.0.2
39+80fa1e1f6e122d3de65ce3d6cd9f3aceaa108977 0.10.0.3
40+80fa1e1f6e122d3de65ce3d6cd9f3aceaa108977 0.10.0.3
41+940330f992c8130d8e17b99f93d570d454c0fa4d 0.10.0.3
42+5702ca99c6ac5cfdd8a864c0e4c61a4db1158d7a 0.10.1.0
43+e8bc38ea66812bf5f24599d3f33480411084affb 0.10.1.1
44+f0bc0f79b70b97a856042386aa8856ac1cad88f1 0.10.2.0
45+030191aa39c97afcad17d365ed114a2eedc04ad4 0.10.3.0
46+ec23283e88c00af34c3144a8775ca4358daea3f7 0.10.4.0
47+6f4b317a12acdd05d67fd9ec55d3defaf37a01eb 0.11.1.0
48+48809d7716468fe2bbc47b191b1d64358daaf6d1 0.11.2.1
49+856a772f83a6e382bbcfe53e221a5a92623b107c 0.11.3.0
50+a3c7a521fd58595d6a470ab890cc54a80dd45bd7 0.11.3.1
51+38326ce07aca6c8c3a014b0d454d2a5bfdbd6a52 0.11.3.2
52+694039f4fc157a8ca5dce37959391615b6c3f535 0.11.3.3
53+1fe92d1838fb1b1afcee1ca18d4970cf7e01956e 0.11.3.4
54+68203a4cb847da905fa44b5aa1942b99d5867ab4 0.12.0.0
55+c9c2b05707b2fffcd749d5817e3e0d04e6ad6d0d 0.12.1.0
56+9157c2b4c35aa5f683b4ac51e6ff52c696bc22e2 0.12.1.1
57+682ba515f7ba62500ad79371b37b90932e0c0e3d 0.12.1.2
58+2066a72b79b478f59a9c7f1839c522fc59ba9af7 0.12.1.3
59+ef875ad3bebef2b6fb1bd7063de6a46a06d0d4b4 0.12.1.4
60+dc1fcff28d13a508f677c7b06af6420877842493 0.12.1.5
61+013e04e4526bfd5e9e4a611b42e6f03c413bea91 0.12.1.6
62+0ddbce995b77b8db391b4d6519f13feddf4b5bf3 0.13.0.0
63+46c16463ec20ad46c9cd0bfb1050c4268f34b749 0.13.0.1
.travis.ymlnew file+161
@@ -0,0 +1,161 @@
1+# This Travis job script has been generated by a script via
2+#
3+# haskell-ci '--tests-jobs=>=7.4' '--no-benchmarks' 'attoparsec.cabal'
4+#
5+# For more information, see https://github.com/haskell-CI/haskell-ci
6+#
7+# version: 0.3.20190815
8+#
9+language: c
10+dist: xenial
11+git:
12+ # whether to recursively clone submodules
13+ submodules: false
14+cache:
15+ directories:
16+ - $HOME/.cabal/packages
17+ - $HOME/.cabal/store
18+before_cache:
19+ - rm -fv $CABALHOME/packages/hackage.haskell.org/build-reports.log
20+ # remove files that are regenerated by 'cabal update'
21+ - rm -fv $CABALHOME/packages/hackage.haskell.org/00-index.*
22+ - rm -fv $CABALHOME/packages/hackage.haskell.org/*.json
23+ - rm -fv $CABALHOME/packages/hackage.haskell.org/01-index.cache
24+ - rm -fv $CABALHOME/packages/hackage.haskell.org/01-index.tar
25+ - rm -fv $CABALHOME/packages/hackage.haskell.org/01-index.tar.idx
26+ - rm -rfv $CABALHOME/packages/head.hackage
27+matrix:
28+ include:
29+ - compiler: ghc-8.8.1
30+ addons: {"apt":{"sources":["hvr-ghc"],"packages":["ghc-8.8.1","cabal-install-3.0"]}}
31+ - compiler: ghc-8.6.5
32+ addons: {"apt":{"sources":["hvr-ghc"],"packages":["ghc-8.6.5","cabal-install-2.4"]}}
33+ - compiler: ghc-8.4.4
34+ addons: {"apt":{"sources":["hvr-ghc"],"packages":["ghc-8.4.4","cabal-install-2.4"]}}
35+ - compiler: ghc-8.2.2
36+ addons: {"apt":{"sources":["hvr-ghc"],"packages":["ghc-8.2.2","cabal-install-2.4"]}}
37+ - compiler: ghc-8.0.2
38+ addons: {"apt":{"sources":["hvr-ghc"],"packages":["ghc-8.0.2","cabal-install-2.4"]}}
39+ - compiler: ghc-7.10.3
40+ addons: {"apt":{"sources":["hvr-ghc"],"packages":["ghc-7.10.3","cabal-install-2.4"]}}
41+ - compiler: ghc-7.8.4
42+ addons: {"apt":{"sources":["hvr-ghc"],"packages":["ghc-7.8.4","cabal-install-2.4"]}}
43+ - compiler: ghc-7.6.3
44+ addons: {"apt":{"sources":["hvr-ghc"],"packages":["ghc-7.6.3","cabal-install-2.4"]}}
45+ - compiler: ghc-7.4.2
46+ addons: {"apt":{"sources":["hvr-ghc"],"packages":["ghc-7.4.2","cabal-install-2.4"]}}
47+ - compiler: ghc-7.2.2
48+ addons: {"apt":{"sources":["hvr-ghc"],"packages":["ghc-7.2.2","cabal-install-2.4"]}}
49+ - compiler: ghc-7.0.4
50+ addons: {"apt":{"sources":["hvr-ghc"],"packages":["ghc-7.0.4","cabal-install-2.4"]}}
51+before_install:
52+ - HC=$(echo "/opt/$CC/bin/ghc" | sed 's/-/\//')
53+ - WITHCOMPILER="-w $HC"
54+ - HCPKG="$HC-pkg"
55+ - unset CC
56+ - CABAL=/opt/ghc/bin/cabal
57+ - CABALHOME=$HOME/.cabal
58+ - export PATH="$CABALHOME/bin:$PATH"
59+ - TOP=$(pwd)
60+ - "HCNUMVER=$(${HC} --numeric-version|perl -ne '/^(\\d+)\\.(\\d+)\\.(\\d+)(\\.(\\d+))?$/; print(10000 * $1 + 100 * $2 + ($3 == 0 ? $5 != 1 : $3))')"
61+ - echo $HCNUMVER
62+ - CABAL="$CABAL -vnormal+nowrap+markoutput"
63+ - set -o pipefail
64+ - |
65+ echo 'function blue(s) { printf "\033[0;34m" s "\033[0m " }' >> .colorful.awk
66+ echo 'BEGIN { state = "output"; }' >> .colorful.awk
67+ echo '/^-----BEGIN CABAL OUTPUT-----$/ { state = "cabal" }' >> .colorful.awk
68+ echo '/^-----END CABAL OUTPUT-----$/ { state = "output" }' >> .colorful.awk
69+ echo '!/^(-----BEGIN CABAL OUTPUT-----|-----END CABAL OUTPUT-----)/ {' >> .colorful.awk
70+ echo ' if (state == "cabal") {' >> .colorful.awk
71+ echo ' print blue($0)' >> .colorful.awk
72+ echo ' } else {' >> .colorful.awk
73+ echo ' print $0' >> .colorful.awk
74+ echo ' }' >> .colorful.awk
75+ echo '}' >> .colorful.awk
76+ - cat .colorful.awk
77+ - |
78+ color_cabal_output () {
79+ awk -f $TOP/.colorful.awk
80+ }
81+ - echo text | color_cabal_output
82+install:
83+ - ${CABAL} --version
84+ - echo "$(${HC} --version) [$(${HC} --print-project-git-commit-id 2> /dev/null || echo '?')]"
85+ - TEST=--enable-tests
86+ - if [ $HCNUMVER -lt 70400 ] ; then TEST=--disable-tests ; fi
87+ - BENCH=--enable-benchmarks
88+ - BENCH=--disable-benchmarks
89+ - HEADHACKAGE=false
90+ - rm -f $CABALHOME/config
91+ - |
92+ echo "verbose: normal +nowrap +markoutput" >> $CABALHOME/config
93+ echo "remote-build-reporting: anonymous" >> $CABALHOME/config
94+ echo "write-ghc-environment-files: always" >> $CABALHOME/config
95+ echo "remote-repo-cache: $CABALHOME/packages" >> $CABALHOME/config
96+ echo "logs-dir: $CABALHOME/logs" >> $CABALHOME/config
97+ echo "world-file: $CABALHOME/world" >> $CABALHOME/config
98+ echo "extra-prog-path: $CABALHOME/bin" >> $CABALHOME/config
99+ echo "symlink-bindir: $CABALHOME/bin" >> $CABALHOME/config
100+ echo "installdir: $CABALHOME/bin" >> $CABALHOME/config
101+ echo "build-summary: $CABALHOME/logs/build.log" >> $CABALHOME/config
102+ echo "store-dir: $CABALHOME/store" >> $CABALHOME/config
103+ echo "install-dirs user" >> $CABALHOME/config
104+ echo " prefix: $CABALHOME" >> $CABALHOME/config
105+ echo "repository hackage.haskell.org" >> $CABALHOME/config
106+ echo " url: http://hackage.haskell.org/" >> $CABALHOME/config
107+ - cat $CABALHOME/config
108+ - rm -fv cabal.project cabal.project.local cabal.project.freeze
109+ - travis_retry ${CABAL} v2-update -v
110+ # Generate cabal.project
111+ - rm -rf cabal.project cabal.project.local cabal.project.freeze
112+ - touch cabal.project
113+ - |
114+ echo "packages: ." >> cabal.project
115+ - |
116+ - "for pkg in $($HCPKG list --simple-output); do echo $pkg | sed 's/-[^-]*$//' | (grep -vE -- '^(attoparsec)$' || true) | sed 's/^/constraints: /' | sed 's/$/ installed/' >> cabal.project.local; done"
117+ - cat cabal.project || true
118+ - cat cabal.project.local || true
119+ - if [ -f "./configure.ac" ]; then (cd "." && autoreconf -i); fi
120+ - ${CABAL} v2-freeze $WITHCOMPILER ${TEST} ${BENCH} | color_cabal_output
121+ - "cat cabal.project.freeze | sed -E 's/^(constraints: *| *)//' | sed 's/any.//'"
122+ - rm cabal.project.freeze
123+ - ${CABAL} v2-build $WITHCOMPILER ${TEST} ${BENCH} --dep -j2 all | color_cabal_output
124+ - ${CABAL} v2-build $WITHCOMPILER --disable-tests --disable-benchmarks --dep -j2 all | color_cabal_output
125+script:
126+ - DISTDIR=$(mktemp -d /tmp/dist-test.XXXX)
127+ # Packaging...
128+ - ${CABAL} v2-sdist all | color_cabal_output
129+ # Unpacking...
130+ - mv dist-newstyle/sdist/*.tar.gz ${DISTDIR}/
131+ - cd ${DISTDIR} || false
132+ - find . -maxdepth 1 -type f -name '*.tar.gz' -exec tar -xvf '{}' \;
133+ - find . -maxdepth 1 -type f -name '*.tar.gz' -exec rm '{}' \;
134+ - PKGDIR_attoparsec="$(find . -maxdepth 1 -type d -regex '.*/attoparsec-[0-9.]*')"
135+ # Generate cabal.project
136+ - rm -rf cabal.project cabal.project.local cabal.project.freeze
137+ - touch cabal.project
138+ - |
139+ echo "packages: ${PKGDIR_attoparsec}" >> cabal.project
140+ - |
141+ - "for pkg in $($HCPKG list --simple-output); do echo $pkg | sed 's/-[^-]*$//' | (grep -vE -- '^(attoparsec)$' || true) | sed 's/^/constraints: /' | sed 's/$/ installed/' >> cabal.project.local; done"
142+ - cat cabal.project || true
143+ - cat cabal.project.local || true
144+ # Building...
145+ # this builds all libraries and executables (without tests/benchmarks)
146+ - ${CABAL} v2-build $WITHCOMPILER --disable-tests --disable-benchmarks all | color_cabal_output
147+ # Building with tests and benchmarks...
148+ # build & run tests, build benchmarks
149+ - ${CABAL} v2-build $WITHCOMPILER ${TEST} ${BENCH} all | color_cabal_output
150+ # Testing...
151+ - if [ $HCNUMVER -ge 70400 ] ; then ${CABAL} v2-test $WITHCOMPILER ${TEST} ${BENCH} all | color_cabal_output ; fi
152+ # cabal check...
153+ - (cd ${PKGDIR_attoparsec} && ${CABAL} -vnormal check)
154+ # haddock...
155+ - ${CABAL} v2-haddock $WITHCOMPILER ${TEST} ${BENCH} all | color_cabal_output
156+ # Building without installed constraints for packages in global-db...
157+ - rm -f cabal.project.local
158+ - ${CABAL} v2-build $WITHCOMPILER --disable-tests --disable-benchmarks all | color_cabal_output
159+
160+# REGENDATA ["--tests-jobs=>=7.4","--no-benchmarks","attoparsec.cabal"]
161+# EOF
Data/Attoparsec.hs+9−4
@@ -1,16 +1,21 @@
1-- |
1-- |
2-- Module : Data.Attoparsec
2-- Module : Data.Attoparsec
3−-- Copyright : Bryan O'Sullivan 2007-2011
3+-- Copyright : Bryan O'Sullivan 2007-2015
4-- License : BSD3
4-- License : BSD3
5−--
5+--
6-- Maintainer : bos@serpentine.com
6-- Maintainer : bos@serpentine.com
7-- Stability : experimental
7-- Stability : experimental
8-- Portability : unknown
8-- Portability : unknown
9--
9--
10−-- Simple, efficient combinator parsing for 'ByteString' strings,
10+-- Simple, efficient combinator parsing for
11−-- loosely based on the Parsec library.
11+-- 'Data.ByteString.ByteString' strings, loosely based on the Parsec
12+-- library.
13+--
14+-- This module is deprecated. Use "Data.Attoparsec.ByteString"
15+-- instead.
12
16
13module Data.Attoparsec
17module Data.Attoparsec
18+ {-# DEPRECATED "This module will be removed in the next major release." #-}
14 (
19 (
15 module Data.Attoparsec.ByteString
20 module Data.Attoparsec.ByteString
16 ) where
21 ) where
Data/Attoparsec/ByteString.hs+63−35
@@ -1,8 +1,12 @@
1+{-# LANGUAGE CPP #-}
2+#if __GLASGOW_HASKELL__ >= 702
3+{-# LANGUAGE Trustworthy #-}
4+#endif
1-- |
5-- |
2-- Module : Data.Attoparsec.ByteString
6-- Module : Data.Attoparsec.ByteString
3−-- Copyright : Bryan O'Sullivan 2007-2011
7+-- Copyright : Bryan O'Sullivan 2007-2015
4-- License : BSD3
8-- License : BSD3
5−--
9+--
6-- Maintainer : bos@serpentine.com
10-- Maintainer : bos@serpentine.com
7-- Stability : experimental
11-- Stability : experimental
8-- Portability : unknown
12-- Portability : unknown
@@ -25,6 +29,7 @@ module Data.Attoparsec.ByteString
25 I.Parser
29 I.Parser
26 , Result
30 , Result
27 , T.IResult(..)
31 , T.IResult(..)
32+ , I.compareResults
28
33
29 -- * Running parsers
34 -- * Running parsers
30 , parse
35 , parse
@@ -37,11 +42,6 @@ module Data.Attoparsec.ByteString
37 , maybeResult
42 , maybeResult
38 , eitherResult
43 , eitherResult
39
44
40− -- * Combinators
41− , (I.<?>)
42− , I.try
43− , module Data.Attoparsec.Combinator
44−
45 -- * Parsing individual bytes
45 -- * Parsing individual bytes
46 , I.word8
46 , I.word8
47 , I.anyWord8
47 , I.anyWord8
@@ -50,6 +50,10 @@ module Data.Attoparsec.ByteString
50 , I.satisfyWith
50 , I.satisfyWith
51 , I.skip
51 , I.skip
52
52
53+ -- ** Lookahead
54+ , I.peekWord8
55+ , I.peekWord8'
56+
53 -- ** Byte classes
57 -- ** Byte classes
54 , I.inClass
58 , I.inClass
55 , I.notInClass
59 , I.notInClass
@@ -59,6 +63,7 @@ module Data.Attoparsec.ByteString
59 , I.skipWhile
63 , I.skipWhile
60 , I.take
64 , I.take
61 , I.scan
65 , I.scan
66+ , I.runScanner
62 , I.takeWhile
67 , I.takeWhile
63 , I.takeWhile1
68 , I.takeWhile1
64 , I.takeTill
69 , I.takeTill
@@ -67,62 +72,85 @@ module Data.Attoparsec.ByteString
67 , I.takeByteString
72 , I.takeByteString
68 , I.takeLazyByteString
73 , I.takeLazyByteString
69
74
75+ -- * Combinators
76+ , try
77+ , (<?>)
78+ , choice
79+ , count
80+ , option
81+ , many'
82+ , many1
83+ , many1'
84+ , manyTill
85+ , manyTill'
86+ , sepBy
87+ , sepBy'
88+ , sepBy1
89+ , sepBy1'
90+ , skipMany
91+ , skipMany1
92+ , eitherP
93+ , I.match
70 -- * State observation and manipulation functions
94 -- * State observation and manipulation functions
71 , I.endOfInput
95 , I.endOfInput
72 , I.atEnd
96 , I.atEnd
73 ) where
97 ) where
74
98
75import Data.Attoparsec.Combinator
99import Data.Attoparsec.Combinator
100+import Data.List (intercalate)
76import qualified Data.Attoparsec.ByteString.Internal as I
101import qualified Data.Attoparsec.ByteString.Internal as I
102+import qualified Data.Attoparsec.Internal as I
77import qualified Data.ByteString as B
103import qualified Data.ByteString as B
78import Data.Attoparsec.ByteString.Internal (Result, parse)
104import Data.Attoparsec.ByteString.Internal (Result, parse)
79import qualified Data.Attoparsec.Internal.Types as T
105import qualified Data.Attoparsec.Internal.Types as T
80
106
81-- $parsec
107-- $parsec
82--
108--
83−-- Compared to Parsec 3, Attoparsec makes several tradeoffs. It is
109+-- Compared to Parsec 3, attoparsec makes several tradeoffs. It is
84-- not intended for, or ideal for, all possible uses.
110-- not intended for, or ideal for, all possible uses.
85--
111--
86−-- * While Attoparsec can consume input incrementally, Parsec cannot.
112+-- * While attoparsec can consume input incrementally, Parsec cannot.
87-- Incremental input is a huge deal for efficient and secure network
113-- Incremental input is a huge deal for efficient and secure network
88-- and system programming, since it gives much more control to users
114-- and system programming, since it gives much more control to users
89-- of the library over matters such as resource usage and the I/O
115-- of the library over matters such as resource usage and the I/O
90-- model to use.
116-- model to use.
91--
117--
92−-- * Much of the performance advantage of Attoparsec is gained via
118+-- * Much of the performance advantage of attoparsec is gained via
93-- high-performance parsers such as 'I.takeWhile' and 'I.string'.
119-- high-performance parsers such as 'I.takeWhile' and 'I.string'.
94-- If you use complicated combinators that return lists of bytes or
120-- If you use complicated combinators that return lists of bytes or
95-- characters, there is less performance difference between the two
121-- characters, there is less performance difference between the two
96-- libraries.
122-- libraries.
97--
123--
98−-- * Unlike Parsec 3, Attoparsec does not support being used as a
124+-- * Unlike Parsec 3, attoparsec does not support being used as a
99-- monad transformer.
125-- monad transformer.
100--
126--
101−-- * Attoparsec is specialised to deal only with strict 'B.ByteString'
127+-- * attoparsec is specialised to deal only with strict 'B.ByteString'
102-- input. Efficiency concerns rule out both lists and lazy
128-- input. Efficiency concerns rule out both lists and lazy
103-- bytestrings. The usual use for lazy bytestrings would be to
129-- bytestrings. The usual use for lazy bytestrings would be to
104-- allow consumption of very large input without a large footprint.
130-- allow consumption of very large input without a large footprint.
105−-- For this need, Attoparsec's incremental input provides an
131+-- For this need, attoparsec's incremental input provides an
106-- excellent substitute, with much more control over when input
132-- excellent substitute, with much more control over when input
107−-- takes place. If you must use lazy bytestrings, see the 'Lazy'
133+-- takes place. If you must use lazy bytestrings, see the
134+-- "Data.Attoparsec.ByteString.Lazy" module, which feeds lazy chunks
108−-- module, which feeds lazy chunks to a regular parser.
135+-- to a regular parser.
109--
136--
110-- * Parsec parsers can produce more helpful error messages than
137-- * Parsec parsers can produce more helpful error messages than
111−-- Attoparsec parsers. This is a matter of focus: Attoparsec avoids
138+-- attoparsec parsers. This is a matter of focus: attoparsec avoids
112-- the extra book-keeping in favour of higher performance.
139-- the extra book-keeping in favour of higher performance.
113
140
114-- $incremental
141-- $incremental
115--
142--
116−-- Attoparsec supports incremental input, meaning that you can feed it
143+-- attoparsec supports incremental input, meaning that you can feed it
117-- a bytestring that represents only part of the expected total amount
144-- a bytestring that represents only part of the expected total amount
118-- of data to parse. If your parser reaches the end of a fragment of
145-- of data to parse. If your parser reaches the end of a fragment of
119-- input and could consume more input, it will suspend parsing and
146-- input and could consume more input, it will suspend parsing and
120-- return a 'T.Partial' continuation.
147-- return a 'T.Partial' continuation.
121--
148--
122−-- Supplying the 'T.Partial' continuation with another bytestring will
149+-- Supplying the 'T.Partial' continuation with a bytestring will
123−-- resume parsing at the point where it was suspended. You must be
150+-- resume parsing at the point where it was suspended, with the
151+-- bytestring you supplied used as new input at the end of the
124−-- prepared for the result of the resumed parse to be another
152+-- existing input. You must be prepared for the result of the resumed
125−-- 'T.Partial' continuation.
153+-- parse to be another 'T.Partial' continuation.
126--
154--
127-- To indicate that you have no more input, supply the 'T.Partial'
155-- To indicate that you have no more input, supply the 'T.Partial'
128-- continuation with an empty bytestring.
156-- continuation with an empty bytestring.
@@ -134,12 +162,19 @@ import qualified Data.Attoparsec.Internal.Types as T
134-- If you do not need support for incremental input, consider using
162-- If you do not need support for incremental input, consider using
135-- the 'I.parseOnly' function to run your parser. It will never
163-- the 'I.parseOnly' function to run your parser. It will never
136-- prompt for more input.
164-- prompt for more input.
165+--
166+-- /Note/: incremental input does /not/ imply that attoparsec will
167+-- release portions of its internal state for garbage collection as it
168+-- proceeds. Its internal representation is equivalent to a single
169+-- 'ByteString': if you feed incremental input to a parser, it will
170+-- require memory proportional to the amount of input you supply.
171+-- (This is necessary to support arbitrary backtracking.)
137
172
138-- $performance
173-- $performance
139--
174--
140−-- If you write an Attoparsec-based parser carefully, it can be
175+-- If you write an attoparsec-based parser carefully, it can be
141−-- realistic to expect it to perform within a factor of 2 of a
176+-- realistic to expect it to perform similarly to a hand-rolled C
142−-- hand-rolled C parser (measuring megabytes parsed per second).
177+-- parser (measuring megabytes parsed per second).
143--
178--
144-- To actually achieve high performance, there are a few guidelines
179-- To actually achieve high performance, there are a few guidelines
145-- that it is useful to follow.
180-- that it is useful to follow.
@@ -160,14 +195,6 @@ import qualified Data.Attoparsec.Internal.Types as T
160-- Make active use of benchmarking and profiling tools to measure,
195-- Make active use of benchmarking and profiling tools to measure,
161-- find the problems with, and improve the performance of your parser.
196-- find the problems with, and improve the performance of your parser.
162
197
163−-- | If a parser has returned a 'T.Partial' result, supply it with more
164−-- input.
165−feed :: Result r -> B.ByteString -> Result r
166−feed f@(T.Fail _ _ _) _ = f
167−feed (T.Partial k) d = k d
168−feed (T.Done bs r) d = T.Done (B.append bs d) r
169−{-# INLINE feed #-}
170−
171-- | Run a parser and print its result to standard output.
198-- | Run a parser and print its result to standard output.
172parseTest :: (Show a) => I.Parser a -> B.ByteString -> IO ()
199parseTest :: (Show a) => I.Parser a -> B.ByteString -> IO ()
173parseTest p s = print (parse p s)
200parseTest p s = print (parse p s)
@@ -197,6 +224,7 @@ maybeResult _ = Nothing
197-- | Convert a 'Result' value to an 'Either' value. A 'T.Partial'
224-- | Convert a 'Result' value to an 'Either' value. A 'T.Partial'
198-- result is treated as failure.
225-- result is treated as failure.
199eitherResult :: Result r -> Either String r
226eitherResult :: Result r -> Either String r
200−eitherResult (T.Done _ r) = Right r
227+eitherResult (T.Done _ r) = Right r
201−eitherResult (T.Fail _ _ msg) = Left msg
228+eitherResult (T.Fail _ [] msg) = Left msg
229+eitherResult (T.Fail _ ctxs msg) = Left (intercalate " > " ctxs ++ ": " ++ msg)
202−eitherResult _ = Left "Result: incomplete input"
230+eitherResult _ = Left "Result: incomplete input"
Data/Attoparsec/ByteString/Buffer.hsnew file+156
@@ -0,0 +1,156 @@
1+{-# LANGUAGE BangPatterns #-}
2+-- |
3+-- Module : Data.Attoparsec.ByteString.Buffer
4+-- Copyright : Bryan O'Sullivan 2007-2015
5+-- License : BSD3
6+--
7+-- Maintainer : bos@serpentine.com
8+-- Stability : experimental
9+-- Portability : GHC
10+--
11+-- An "immutable" buffer that supports cheap appends.
12+--
13+-- A Buffer is divided into an immutable read-only zone, followed by a
14+-- mutable area that we've preallocated, but not yet written to.
15+--
16+-- We overallocate at the end of a Buffer so that we can cheaply
17+-- append. Since a user of an existing Buffer cannot see past the end
18+-- of its immutable zone into the data that will change during an
19+-- append, this is safe.
20+--
21+-- Once we run out of space at the end of a Buffer, we do the usual
22+-- doubling of the buffer size.
23+--
24+-- The fact of having a mutable buffer really helps with performance,
25+-- but it does have a consequence: if someone misuses the Partial API
26+-- that attoparsec uses by calling the same continuation repeatedly
27+-- (which never makes sense in practice), they could overwrite data.
28+--
29+-- Since the API *looks* pure, it should *act* pure, too, so we use
30+-- two generation counters (one mutable, one immutable) to track the
31+-- number of appends to a mutable buffer. If the counters ever get out
32+-- of sync, someone is appending twice to a mutable buffer, so we
33+-- duplicate the entire buffer in order to preserve the immutability
34+-- of its older self.
35+--
36+-- While we could go a step further and gain protection against API
37+-- abuse on a multicore system, by use of an atomic increment
38+-- instruction to bump the mutable generation counter, that would be
39+-- very expensive, and feels like it would also be in the realm of the
40+-- ridiculous. Clients should never call a continuation more than
41+-- once; we lack a linear type system that could enforce this; and
42+-- there's only so far we should go to accommodate broken uses.
43+
44+module Data.Attoparsec.ByteString.Buffer
45+ (
46+ Buffer
47+ , buffer
48+ , unbuffer
49+ , pappend
50+ , length
51+ , unsafeIndex
52+ , substring
53+ , unsafeDrop
54+ ) where
55+
56+import Control.Exception (assert)
57+import Data.ByteString.Internal (ByteString(..), memcpy, nullForeignPtr)
58+import Data.Attoparsec.Internal.Fhthagn (inlinePerformIO)
59+import Data.List (foldl1')
60+import Data.Monoid as Mon (Monoid(..))
61+import Data.Semigroup (Semigroup(..))
62+import Data.Word (Word8)
63+import Foreign.ForeignPtr (ForeignPtr, withForeignPtr)
64+import Foreign.Ptr (castPtr, plusPtr)
65+import Foreign.Storable (peek, peekByteOff, poke, sizeOf)
66+import GHC.ForeignPtr (mallocPlainForeignPtrBytes)
67+import Prelude hiding (length)
68+
69+-- If _cap is zero, this buffer is empty.
70+data Buffer = Buf {
71+ _fp :: {-# UNPACK #-} !(ForeignPtr Word8)
72+ , _off :: {-# UNPACK #-} !Int
73+ , _len :: {-# UNPACK #-} !Int
74+ , _cap :: {-# UNPACK #-} !Int
75+ , _gen :: {-# UNPACK #-} !Int
76+ }
77+
78+instance Show Buffer where
79+ showsPrec p = showsPrec p . unbuffer
80+
81+-- | The initial 'Buffer' has no mutable zone, so we can avoid all
82+-- copies in the (hopefully) common case of no further input being fed
83+-- to us.
84+buffer :: ByteString -> Buffer
85+buffer (PS fp off len) = Buf fp off len len 0
86+
87+unbuffer :: Buffer -> ByteString
88+unbuffer (Buf fp off len _ _) = PS fp off len
89+
90+instance Semigroup Buffer where
91+ (Buf _ _ _ 0 _) <> b = b
92+ a <> (Buf _ _ _ 0 _) = a
93+ buf <> (Buf fp off len _ _) = append buf fp off len
94+
95+instance Monoid Buffer where
96+ mempty = Buf nullForeignPtr 0 0 0 0
97+
98+ mappend = (<>)
99+
100+ mconcat [] = Mon.mempty
101+ mconcat xs = foldl1' mappend xs
102+
103+pappend :: Buffer -> ByteString -> Buffer
104+pappend (Buf _ _ _ 0 _) bs = buffer bs
105+pappend buf (PS fp off len) = append buf fp off len
106+
107+append :: Buffer -> ForeignPtr a -> Int -> Int -> Buffer
108+append (Buf fp0 off0 len0 cap0 gen0) !fp1 !off1 !len1 =
109+ inlinePerformIO . withForeignPtr fp0 $ \ptr0 ->
110+ withForeignPtr fp1 $ \ptr1 -> do
111+ let genSize = sizeOf (0::Int)
112+ newlen = len0 + len1
113+ gen <- if gen0 == 0
114+ then return 0
115+ else peek (castPtr ptr0)
116+ if gen == gen0 && newlen <= cap0
117+ then do
118+ let newgen = gen + 1
119+ poke (castPtr ptr0) newgen
120+ memcpy (ptr0 `plusPtr` (off0+len0))
121+ (ptr1 `plusPtr` off1)
122+ (fromIntegral len1)
123+ return (Buf fp0 off0 newlen cap0 newgen)
124+ else do
125+ let newcap = newlen * 2
126+ fp <- mallocPlainForeignPtrBytes (newcap + genSize)
127+ withForeignPtr fp $ \ptr_ -> do
128+ let ptr = ptr_ `plusPtr` genSize
129+ newgen = 1
130+ poke (castPtr ptr_) newgen
131+ memcpy ptr (ptr0 `plusPtr` off0) (fromIntegral len0)
132+ memcpy (ptr `plusPtr` len0) (ptr1 `plusPtr` off1)
133+ (fromIntegral len1)
134+ return (Buf fp genSize newlen newcap newgen)
135+
136+length :: Buffer -> Int
137+length (Buf _ _ len _ _) = len
138+{-# INLINE length #-}
139+
140+unsafeIndex :: Buffer -> Int -> Word8
141+unsafeIndex (Buf fp off len _ _) i = assert (i >= 0 && i < len) .
142+ inlinePerformIO . withForeignPtr fp $ flip peekByteOff (off+i)
143+{-# INLINE unsafeIndex #-}
144+
145+substring :: Int -> Int -> Buffer -> ByteString
146+substring s l (Buf fp off len _ _) =
147+ assert (s >= 0 && s <= len) .
148+ assert (l >= 0 && l <= len-s) $
149+ PS fp (off+s) l
150+{-# INLINE substring #-}
151+
152+unsafeDrop :: Int -> Buffer -> ByteString
153+unsafeDrop s (Buf fp off len _ _) =
154+ assert (s >= 0 && s <= len) $
155+ PS fp (off+s) (len-s)
156+{-# INLINE unsafeDrop #-}
Data/Attoparsec/ByteString/Char8.hs+174−104
@@ -1,11 +1,15 @@
1−{-# LANGUAGE BangPatterns, FlexibleInstances, TypeSynonymInstances #-}
1+{-# LANGUAGE BangPatterns, CPP, FlexibleInstances, TypeFamilies,
2+ TypeSynonymInstances, GADTs #-}
3+#if __GLASGOW_HASKELL__ >= 702
4+{-# LANGUAGE Trustworthy #-} -- Imports internal modules
5+#endif
2−{-# OPTIONS_GHC -fno-warn-orphans #-}
6+{-# OPTIONS_GHC -fno-warn-orphans -fno-warn-warnings-deprecations #-}
3
7
4-- |
8-- |
5-- Module : Data.Attoparsec.ByteString.Char8
9-- Module : Data.Attoparsec.ByteString.Char8
6−-- Copyright : Bryan O'Sullivan 2007-2011
10+-- Copyright : Bryan O'Sullivan 2007-2015
7-- License : BSD3
11-- License : BSD3
8−--
12+--
9-- Maintainer : bos@serpentine.com
13-- Maintainer : bos@serpentine.com
10-- Stability : experimental
14-- Stability : experimental
11-- Portability : unknown
15-- Portability : unknown
@@ -21,23 +25,20 @@ module Data.Attoparsec.ByteString.Char8
21 -- * Parser types
25 -- * Parser types
22 Parser
26 Parser
23 , A.Result
27 , A.Result
28+ , A.IResult(..)
29+ , I.compareResults
24
30
25 -- * Running parsers
31 -- * Running parsers
26 , A.parse
32 , A.parse
27 , A.feed
33 , A.feed
28 , A.parseOnly
34 , A.parseOnly
29− , A.parseTest
30 , A.parseWith
35 , A.parseWith
36+ , A.parseTest
31
37
32 -- ** Result conversion
38 -- ** Result conversion
33 , A.maybeResult
39 , A.maybeResult
34 , A.eitherResult
40 , A.eitherResult
35
41
36− -- * Combinators
37− , (I.<?>)
38− , I.try
39− , module Data.Attoparsec.Combinator
40−
41 -- * Parsing individual characters
42 -- * Parsing individual characters
42 , char
43 , char
43 , char8
44 , char8
@@ -45,6 +46,10 @@ module Data.Attoparsec.ByteString.Char8
45 , notChar
46 , notChar
46 , satisfy
47 , satisfy
47
48
49+ -- ** Lookahead
50+ , peekChar
51+ , peekChar'
52+
48 -- ** Special character parsers
53 -- ** Special character parsers
49 , digit
54 , digit
50 , letter_iso8859_15
55 , letter_iso8859_15
@@ -65,7 +70,7 @@ module Data.Attoparsec.ByteString.Char8
65
70
66 -- * Efficient string handling
71 -- * Efficient string handling
67 , I.string
72 , I.string
68− , stringCI
73+ , I.stringCI
69 , skipSpace
74 , skipSpace
70 , skipWhile
75 , skipWhile
71 , I.take
76 , I.take
@@ -74,6 +79,11 @@ module Data.Attoparsec.ByteString.Char8
74 , takeWhile1
79 , takeWhile1
75 , takeTill
80 , takeTill
76
81
82+ -- ** String combinators
83+ -- $specalt
84+ , (.*>)
85+ , (<*.)
86+
77 -- ** Consume all remaining input
87 -- ** Consume all remaining input
78 , I.takeByteString
88 , I.takeByteString
79 , I.takeLazyByteString
89 , I.takeLazyByteString
@@ -91,30 +101,57 @@ module Data.Attoparsec.ByteString.Char8
91 , Number(..)
101 , Number(..)
92 , number
102 , number
93 , rational
103 , rational
104+ , scientific
94
105
106+ -- * Combinators
107+ , try
108+ , (<?>)
109+ , choice
110+ , count
111+ , option
112+ , many'
113+ , many1
114+ , many1'
115+ , manyTill
116+ , manyTill'
117+ , sepBy
118+ , sepBy'
119+ , sepBy1
120+ , sepBy1'
121+ , skipMany
122+ , skipMany1
123+ , eitherP
124+ , I.match
95 -- * State observation and manipulation functions
125 -- * State observation and manipulation functions
96 , I.endOfInput
126 , I.endOfInput
97 , I.atEnd
127 , I.atEnd
98 ) where
128 ) where
99
129
130+#if !MIN_VERSION_base(4,8,0)
100−import Control.Applicative ((*>), (<$>), (<|>))
131+import Control.Applicative (pure, (*>), (<*), (<$>))
132+import Data.Word (Word)
133+#endif
134+import Control.Applicative ((<|>))
135+import Control.Monad (void, when)
101import Data.Attoparsec.ByteString.FastSet (charClass, memberChar)
136import Data.Attoparsec.ByteString.FastSet (charClass, memberChar)
102−import Data.Attoparsec.ByteString.Internal (Parser, (<?>))
137+import Data.Attoparsec.ByteString.Internal (Parser)
103import Data.Attoparsec.Combinator
138import Data.Attoparsec.Combinator
104import Data.Attoparsec.Number (Number(..))
139import Data.Attoparsec.Number (Number(..))
105import Data.Bits (Bits, (.|.), shiftL)
140import Data.Bits (Bits, (.|.), shiftL)
106import Data.ByteString.Internal (c2w, w2c)
141import Data.ByteString.Internal (c2w, w2c)
107import Data.Int (Int8, Int16, Int32, Int64)
142import Data.Int (Int8, Int16, Int32, Int64)
108−import Data.Ratio ((%))
109import Data.String (IsString(..))
143import Data.String (IsString(..))
144+import Data.Scientific (Scientific)
145+import qualified Data.Scientific as Sci
110−import Data.Word (Word8, Word16, Word32, Word64, Word)
146+import Data.Word (Word8, Word16, Word32, Word64)
111import Prelude hiding (takeWhile)
147import Prelude hiding (takeWhile)
112import qualified Data.Attoparsec.ByteString as A
148import qualified Data.Attoparsec.ByteString as A
113import qualified Data.Attoparsec.ByteString.Internal as I
149import qualified Data.Attoparsec.ByteString.Internal as I
150+import qualified Data.Attoparsec.Internal as I
114import qualified Data.ByteString as B8
151import qualified Data.ByteString as B8
115import qualified Data.ByteString.Char8 as B
152import qualified Data.ByteString.Char8 as B
116
153
117−instance IsString (Parser B.ByteString) where
154+instance (a ~ B.ByteString) => IsString (Parser a) where
118 fromString = I.string . B.pack
155 fromString = I.string . B.pack
119
156
120-- $encodings
157-- $encodings
@@ -132,16 +169,6 @@ instance IsString (Parser B.ByteString) where
132-- currency sign in ISO-8859-1). Haskell 'Char' values above U+00FF
169-- currency sign in ISO-8859-1). Haskell 'Char' values above U+00FF
133-- are truncated, so e.g. U+1D6B7 is truncated to the byte @0xB7@.
170-- are truncated, so e.g. U+1D6B7 is truncated to the byte @0xB7@.
134
171
135−-- ASCII-specific but fast, oh yes.
136−toLower :: Word8 -> Word8
137−toLower w | w >= 65 && w <= 90 = w + 32
138− | otherwise = w
139−
140−-- | Satisfy a literal string, ignoring case.
141−stringCI :: B.ByteString -> Parser B.ByteString
142−stringCI = I.stringTransform (B8.map toLower)
143−{-# INLINE stringCI #-}
144−
145-- | Consume input as long as the predicate returns 'True', and return
172-- | Consume input as long as the predicate returns 'True', and return
146-- the consumed input.
173-- the consumed input.
147--
174--
@@ -205,7 +232,7 @@ isDigit c = c >= '0' && c <= '9'
205
232
206-- | A fast digit predicate.
233-- | A fast digit predicate.
207isDigit_w8 :: Word8 -> Bool
234isDigit_w8 :: Word8 -> Bool
208−isDigit_w8 w = w >= 48 && w <= 57
235+isDigit_w8 w = w - 48 <= 9
209{-# INLINE isDigit_w8 #-}
236{-# INLINE isDigit_w8 #-}
210
237
211-- | Match any character.
238-- | Match any character.
@@ -213,6 +240,22 @@ anyChar :: Parser Char
213anyChar = satisfy $ const True
240anyChar = satisfy $ const True
214{-# INLINE anyChar #-}
241{-# INLINE anyChar #-}
215
242
243+-- | Match any character, to perform lookahead. Returns 'Nothing' if
244+-- end of input has been reached. Does not consume any input.
245+--
246+-- /Note/: Because this parser does not fail, do not use it with
247+-- combinators such as 'many', because such parsers loop until a
248+-- failure occurs. Careless use will thus result in an infinite loop.
249+peekChar :: Parser (Maybe Char)
250+peekChar = (fmap w2c) `fmap` I.peekWord8
251+{-# INLINE peekChar #-}
252+
253+-- | Match any character, to perform lookahead. Does not consume any
254+-- input, but will fail if end of input has been reached.
255+peekChar' :: Parser Char
256+peekChar' = w2c `fmap` I.peekWord8'
257+{-# INLINE peekChar' #-}
258+
216-- | Fast predicate for matching ASCII space characters.
259-- | Fast predicate for matching ASCII space characters.
217--
260--
218-- /Note/: This predicate only gives correct answers for the ASCII
261-- /Note/: This predicate only gives correct answers for the ASCII
@@ -226,7 +269,7 @@ isSpace c = (c == ' ') || ('\t' <= c && c <= '\r')
226
269
227-- | Fast 'Word8' predicate for matching ASCII space characters.
270-- | Fast 'Word8' predicate for matching ASCII space characters.
228isSpace_w8 :: Word8 -> Bool
271isSpace_w8 :: Word8 -> Bool
229−isSpace_w8 w = (w == 32) || (9 <= w && w <= 13)
272+isSpace_w8 w = w == 32 || w - 9 <= 4
230{-# INLINE isSpace_w8 #-}
273{-# INLINE isSpace_w8 #-}
231
274
232
275
@@ -326,6 +369,42 @@ skipSpace :: Parser ()
326skipSpace = I.skipWhile isSpace_w8
369skipSpace = I.skipWhile isSpace_w8
327{-# INLINE skipSpace #-}
370{-# INLINE skipSpace #-}
328
371
372+-- $specalt
373+--
374+-- If you enable the @OverloadedStrings@ language extension, you can
375+-- use the '*>' and '<*' combinators to simplify the common task of
376+-- matching a statically known string, then immediately parsing
377+-- something else.
378+--
379+-- Instead of writing something like this:
380+--
381+-- @
382+--'I.string' \"foo\" '*>' wibble
383+-- @
384+--
385+-- Using @OverloadedStrings@, you can omit the explicit use of
386+-- 'I.string', and write a more compact version:
387+--
388+-- @
389+-- \"foo\" '*>' wibble
390+-- @
391+--
392+-- (Note: the '.*>' and '<*.' combinators that were originally
393+-- provided for this purpose are obsolete and unnecessary, and will be
394+-- removed in the next major version.)
395+
396+-- | /Obsolete/. A type-specialized version of '*>' for
397+-- 'B.ByteString'. Use '*>' instead.
398+(.*>) :: B.ByteString -> Parser a -> Parser a
399+s .*> f = I.string s *> f
400+{-# DEPRECATED (.*>) "This is no longer necessary, and will be removed. Use '*>' instead." #-}
401+
402+-- | /Obsolete/. A type-specialized version of '<*' for
403+-- 'B.ByteString'. Use '<*' instead.
404+(<*.) :: Parser a -> B.ByteString -> Parser a
405+f <*. s = f <* I.string s
406+{-# DEPRECATED (<*.) "This is no longer necessary, and will be removed. Use '<*' instead." #-}
407+
329-- | A predicate that matches either a carriage return @\'\\r\'@ or
408-- | A predicate that matches either a carriage return @\'\\r\'@ or
330-- newline @\'\\n\'@ character.
409-- newline @\'\\n\'@ character.
331isEndOfLine :: Word8 -> Bool
410isEndOfLine :: Word8 -> Bool
@@ -347,7 +426,7 @@ hexadecimal = B8.foldl' step 0 `fmap` I.takeWhile1 isHexDigit
347 where
426 where
348 isHexDigit w = (w >= 48 && w <= 57) ||
427 isHexDigit w = (w >= 48 && w <= 57) ||
349 (w >= 97 && w <= 102) ||
428 (w >= 97 && w <= 102) ||
350− (w >= 65 && w <= 90)
429+ (w >= 65 && w <= 70)
351 step a w | w >= 48 && w <= 57 = (a `shiftL` 4) .|. fromIntegral (w - 48)
430 step a w | w >= 48 && w <= 57 = (a `shiftL` 4) .|. fromIntegral (w - 48)
352 | w >= 97 = (a `shiftL` 4) .|. fromIntegral (w - 87)
431 | w >= 97 = (a `shiftL` 4) .|. fromIntegral (w - 87)
353 | otherwise = (a `shiftL` 4) .|. fromIntegral (w - 55)
432 | otherwise = (a `shiftL` 4) .|. fromIntegral (w - 55)
@@ -365,9 +444,8 @@ hexadecimal = B8.foldl' step 0 `fmap` I.takeWhile1 isHexDigit
365
444
366-- | Parse and decode an unsigned decimal number.
445-- | Parse and decode an unsigned decimal number.
367decimal :: Integral a => Parser a
446decimal :: Integral a => Parser a
368−decimal = B8.foldl' step 0 `fmap` I.takeWhile1 isDig
447+decimal = B8.foldl' step 0 `fmap` I.takeWhile1 isDigit_w8
369− where isDig w = w >= 48 && w <= 57
370− step a w = a * 10 + fromIntegral (w - 48)
448+ where step a w = a * 10 + fromIntegral (w - 48)
371{-# SPECIALISE decimal :: Parser Int #-}
449{-# SPECIALISE decimal :: Parser Int #-}
372{-# SPECIALISE decimal :: Parser Int8 #-}
450{-# SPECIALISE decimal :: Parser Int8 #-}
373{-# SPECIALISE decimal :: Parser Int16 #-}
451{-# SPECIALISE decimal :: Parser Int16 #-}
@@ -393,6 +471,24 @@ signed p = (negate <$> (char8 '-' *> p))
393 <|> (char8 '+' *> p)
471 <|> (char8 '+' *> p)
394 <|> p
472 <|> p
395
473
474+-- | Parse a rational number.
475+--
476+-- The syntax accepted by this parser is the same as for 'double'.
477+--
478+-- /Note/: this parser is not safe for use with inputs from untrusted
479+-- sources. An input with a suitably large exponent such as
480+-- @"1e1000000000"@ will cause a huge 'Integer' to be allocated,
481+-- resulting in what is effectively a denial-of-service attack.
482+--
483+-- In most cases, it is better to use 'double' or 'scientific'
484+-- instead.
485+rational :: Fractional a => Parser a
486+{-# SPECIALIZE rational :: Parser Double #-}
487+{-# SPECIALIZE rational :: Parser Float #-}
488+{-# SPECIALIZE rational :: Parser Rational #-}
489+{-# SPECIALIZE rational :: Parser Scientific #-}
490+rational = scientifically realToFrac
491+
396-- | Parse a rational number.
492-- | Parse a rational number.
397--
493--
398-- This parser accepts an optional leading sign character, followed by
494-- This parser accepts an optional leading sign character, followed by
@@ -407,7 +503,7 @@ signed p = (negate <$> (char8 '-' *> p))
407-- >rational "3.1" == Done 3.1 ""
503-- >rational "3.1" == Done 3.1 ""
408-- >rational "3e4" == Done 30000.0 ""
504-- >rational "3e4" == Done 30000.0 ""
409-- >rational "3.1e4" == Done 31000.0, ""
505-- >rational "3.1e4" == Done 31000.0, ""
410−
506+--
411-- Examples with behaviour identical to 'read':
507-- Examples with behaviour identical to 'read':
412--
508--
413-- >rational ".3" == Fail "input does not start with a digit"
509-- >rational ".3" == Fail "input does not start with a digit"
@@ -420,83 +516,57 @@ signed p = (negate <$> (char8 '-' *> p))
420--
516--
421-- This function does not accept string representations of \"NaN\" or
517-- This function does not accept string representations of \"NaN\" or
422-- \"Infinity\".
518-- \"Infinity\".
423−rational :: Fractional a => Parser a
424−{-# SPECIALIZE rational :: Parser Double #-}
425−{-# SPECIALIZE rational :: Parser Float #-}
426−{-# SPECIALIZE rational :: Parser Rational #-}
427−rational = floaty $ \real frac fracDenom -> fromRational $
428− real % 1 + frac % fracDenom
429−
430−-- | Parse a rational number.
431−--
432−-- The syntax accepted by this parser is the same as for 'rational'.
433−--
434−-- /Note/: This function is almost ten times faster than 'rational',
435−-- but is slightly less accurate.
436−--
437−-- The 'Double' type supports about 16 decimal places of accuracy.
438−-- For 94.2% of numbers, this function and 'rational' give identical
439−-- results, but for the remaining 5.8%, this function loses precision
440−-- around the 15th decimal place. For 0.001% of numbers, this
441−-- function will lose precision at the 13th or 14th decimal place.
442−--
443−-- This function does not accept string representations of \"NaN\" or
444−-- \"Infinity\".
445double :: Parser Double
519double :: Parser Double
446−double = floaty asDouble
520+double = scientifically Sci.toRealFloat
447−
448−asDouble :: Integer -> Integer -> Integer -> Double
449−asDouble real frac fracDenom =
450− fromIntegral real + fromIntegral frac / fromIntegral fracDenom
451−{-# INLINE asDouble #-}
452
521
453-- | Parse a number, attempting to preserve both speed and precision.
522-- | Parse a number, attempting to preserve both speed and precision.
454--
523--
455−-- The syntax accepted by this parser is the same as for 'rational'.
524+-- The syntax accepted by this parser is the same as for 'double'.
456−--
457−-- /Note/: This function is almost ten times faster than 'rational'.
458−-- On integral inputs, it gives perfectly accurate answers, and on
459−-- floating point inputs, it is slightly less accurate than
460−-- 'rational'.
461−--
462−-- This function does not accept string representations of \"NaN\" or
463−-- \"Infinity\".
464number :: Parser Number
525number :: Parser Number
465−number = floaty $ \real frac fracDenom ->
526+number = scientifically $ \s ->
466− if frac == 0 && fracDenom == 0
527+ let e = Sci.base10Exponent s
528+ c = Sci.coefficient s
529+ in if e >= 0
467− then I real
530+ then I (c * 10 ^ e)
468− else D (asDouble real frac fracDenom)
531+ else D (Sci.toRealFloat s)
469−{-# INLINE number #-}
532+{-# DEPRECATED number "Use 'scientific' instead." #-}
470−
533+
534+-- | Parse a scientific number.
535+--
536+-- The syntax accepted by this parser is the same as for 'double'.
537+scientific :: Parser Scientific
538+scientific = scientifically id
539+
540+-- A strict pair
471−data T = T !Integer !Int
541+data SP = SP !Integer {-# UNPACK #-}!Int
472−
542+
473−floaty :: Fractional a => (Integer -> Integer -> Integer -> a) -> Parser a
543+{-# INLINE scientifically #-}
474−{-# INLINE floaty #-}
544+scientifically :: (Scientific -> a) -> Parser a
475−floaty f = do
545+scientifically h = do
476 let minus = 45
546 let minus = 45
477 plus = 43
547 plus = 43
478− !positive <- ((== plus) <$> I.satisfy (\c -> c == minus || c == plus)) <|>
548+ sign <- I.peekWord8'
479− return True
549+ let !positive = sign == plus || sign /= minus
480− real <- decimal
550+ when (sign == plus || sign == minus) $
481− let tryFraction = do
551+ void $ I.anyWord8
482− let dot = 46
552+
483− _ <- I.satisfy (==dot)
553+ n <- decimal
554+
555+ let f fracDigits = SP (B8.foldl' step n fracDigits)
556+ (negate $ B8.length fracDigits)
557+ step a w = a * 10 + fromIntegral (w - 48)
558+
559+ dotty <- I.peekWord8
560+ -- '.' -> ascii 46
561+ SP c e <- case dotty of
484− ds <- I.takeWhile isDigit_w8
562+ Just 46 -> I.anyWord8 *> (f <$> I.takeWhile isDigit_w8)
485− case I.parseOnly decimal ds of
563+ _ -> pure (SP n 0)
486− Right n -> return $ T n (B.length ds)
564+
487− _ -> fail "no digits after decimal"
565+ let !signedCoeff | positive = c
488− T fraction fracDigits <- tryFraction <|> return (T 0 0)
566+ | otherwise = -c
567+
489 let littleE = 101
568 let littleE = 101
490 bigE = 69
569 bigE = 69
491− e w = w == littleE || w == bigE
570+ (I.satisfy (\ex -> ex == littleE || ex == bigE) *>
492− power <- (I.satisfy e *> signed decimal) <|> return (0::Int)
571+ fmap (h . Sci.scientific signedCoeff . (e +)) (signed decimal)) <|>
493− let n = if fracDigits == 0
572+ return (h $ Sci.scientific signedCoeff e)
494− then if power == 0
495− then fromIntegral real
496− else fromIntegral real * (10 ^^ power)
497− else if power == 0
498− then f real fraction (10 ^ fracDigits)
499− else f real fraction (10 ^ fracDigits) * (10 ^^ power)
500− return $ if positive
501− then n
502− else -n
Data/Attoparsec/ByteString/FastSet.hs+4−4
@@ -3,9 +3,9 @@
3-----------------------------------------------------------------------------
3-----------------------------------------------------------------------------
4-- |
4-- |
5-- Module : Data.Attoparsec.ByteString.FastSet
5-- Module : Data.Attoparsec.ByteString.FastSet
6−-- Copyright : Bryan O'Sullivan 2008
6+-- Copyright : Bryan O'Sullivan 2007-2015
7-- License : BSD3
7-- License : BSD3
8−--
8+--
9-- Maintainer : bos@serpentine.com
9-- Maintainer : bos@serpentine.com
10-- Stability : experimental
10-- Stability : experimental
11-- Portability : unknown
11-- Portability : unknown
@@ -14,7 +14,7 @@
14-- set representation is unboxed for efficiency. For small sets, we
14-- set representation is unboxed for efficiency. For small sets, we
15-- test for membership using a binary search. For larger sets, we use
15-- test for membership using a binary search. For larger sets, we use
16-- a lookup table.
16-- a lookup table.
17−--
17+--
18-----------------------------------------------------------------------------
18-----------------------------------------------------------------------------
19module Data.Attoparsec.ByteString.FastSet
19module Data.Attoparsec.ByteString.FastSet
20 (
20 (
@@ -83,7 +83,7 @@ memberWord8 w (Sorted s) = search 0 (B.length s - 1)
83 where search lo hi
83 where search lo hi
84 | hi < lo = False
84 | hi < lo = False
85 | otherwise =
85 | otherwise =
86− let mid = (lo + hi) `div` 2
86+ let mid = (lo + hi) `quot` 2
87 in case compare w (U.unsafeIndex s mid) of
87 in case compare w (U.unsafeIndex s mid) of
88 GT -> search (mid + 1) hi
88 GT -> search (mid + 1) hi
89 LT -> search lo (mid - 1)
89 LT -> search lo (mid - 1)
Data/Attoparsec/ByteString/Internal.hs+288−211
@@ -1,14 +1,15 @@
1−{-# LANGUAGE BangPatterns, Rank2Types, OverloadedStrings, RecordWildCards #-}
1+{-# LANGUAGE BangPatterns, CPP, GADTs, OverloadedStrings, RankNTypes,
2+ RecordWildCards #-}
2-- |
3-- |
3-- Module : Data.Attoparsec.ByteString.Internal
4-- Module : Data.Attoparsec.ByteString.Internal
4−-- Copyright : Bryan O'Sullivan 2007-2011
5+-- Copyright : Bryan O'Sullivan 2007-2015
5-- License : BSD3
6-- License : BSD3
6--
7--
7-- Maintainer : bos@serpentine.com
8-- Maintainer : bos@serpentine.com
8-- Stability : experimental
9-- Stability : experimental
9-- Portability : unknown
10-- Portability : unknown
10--
11--
11−-- Simple, efficient parser combinators for 'B.ByteString' strings,
12+-- Simple, efficient parser combinators for 'ByteString' strings,
12-- loosely based on the Parsec library.
13-- loosely based on the Parsec library.
13
14
14module Data.Attoparsec.ByteString.Internal
15module Data.Attoparsec.ByteString.Internal
@@ -22,8 +23,6 @@ module Data.Attoparsec.ByteString.Internal
22 , parseOnly
23 , parseOnly
23
24
24 -- * Combinators
25 -- * Combinators
25− , (<?>)
26− , try
27 , module Data.Attoparsec.Combinator
26 , module Data.Attoparsec.Combinator
28
27
29 -- * Parsing individual bytes
28 -- * Parsing individual bytes
@@ -34,6 +33,10 @@ module Data.Attoparsec.ByteString.Internal
34 , word8
33 , word8
35 , notWord8
34 , notWord8
36
35
36+ -- ** Lookahead
37+ , peekWord8
38+ , peekWord8'
39+
37 -- ** Byte classes
40 -- ** Byte classes
38 , inClass
41 , inClass
39 , notInClass
42 , notInClass
@@ -44,9 +47,10 @@ module Data.Attoparsec.ByteString.Internal
44 -- * Efficient string handling
47 -- * Efficient string handling
45 , skipWhile
48 , skipWhile
46 , string
49 , string
47− , stringTransform
50+ , stringCI
48 , take
51 , take
49 , scan
52 , scan
53+ , runScanner
50 , takeWhile
54 , takeWhile
51 , takeWhile1
55 , takeWhile1
52 , takeTill
56 , takeTill
@@ -55,27 +59,32 @@ module Data.Attoparsec.ByteString.Internal
55 , takeByteString
59 , takeByteString
56 , takeLazyByteString
60 , takeLazyByteString
57
61
58− -- * State observation and manipulation functions
59− , endOfInput
60− , atEnd
61− , ensure
62−
63 -- * Utilities
62 -- * Utilities
64 , endOfLine
63 , endOfLine
64+ , endOfInput
65+ , match
66+ , atEnd
65 ) where
67 ) where
66
68
69+#if !MIN_VERSION_base(4,8,0)
67−import Control.Applicative ((<|>), (<$>))
70+import Control.Applicative ((<$>))
71+#endif
72+import Control.Applicative ((<|>))
68import Control.Monad (when)
73import Control.Monad (when)
74+import Data.Attoparsec.ByteString.Buffer (Buffer, buffer)
69import Data.Attoparsec.ByteString.FastSet (charClass, memberWord8)
75import Data.Attoparsec.ByteString.FastSet (charClass, memberWord8)
70−import Data.Attoparsec.Combinator
76+import Data.Attoparsec.Combinator ((<?>))
77+import Data.Attoparsec.Internal
78+import Data.Attoparsec.Internal.Fhthagn (inlinePerformIO)
71−import Data.Attoparsec.Internal.Types
79+import Data.Attoparsec.Internal.Types hiding (Parser, Failure, Success)
72− hiding (Parser, Input, Added, Failure, Success)
80+import Data.ByteString (ByteString)
81+import Data.List (intercalate)
73import Data.Word (Word8)
82import Data.Word (Word8)
74import Foreign.ForeignPtr (withForeignPtr)
83import Foreign.ForeignPtr (withForeignPtr)
75import Foreign.Ptr (castPtr, minusPtr, plusPtr)
84import Foreign.Ptr (castPtr, minusPtr, plusPtr)
76import Foreign.Storable (Storable(peek, sizeOf))
85import Foreign.Storable (Storable(peek, sizeOf))
77−import Prelude hiding (getChar, take, takeWhile)
86+import Prelude hiding (getChar, succ, take, takeWhile)
78−import System.IO.Unsafe (unsafePerformIO)
87+import qualified Data.Attoparsec.ByteString.Buffer as Buf
79import qualified Data.Attoparsec.Internal.Types as T
88import qualified Data.Attoparsec.Internal.Types as T
80import qualified Data.ByteString as B8
89import qualified Data.ByteString as B8
81import qualified Data.ByteString.Char8 as B
90import qualified Data.ByteString.Char8 as B
@@ -83,68 +92,10 @@ import qualified Data.ByteString.Internal as B
83import qualified Data.ByteString.Lazy as L
92import qualified Data.ByteString.Lazy as L
84import qualified Data.ByteString.Unsafe as B
93import qualified Data.ByteString.Unsafe as B
85
94
86−type Parser a = T.Parser B.ByteString a
95+type Parser = T.Parser ByteString
87−type Result a = IResult B.ByteString a
96+type Result = IResult ByteString
88−type Input = T.Input B.ByteString
89−type Added = T.Added B.ByteString
90−type Failure r = T.Failure B.ByteString r
97+type Failure r = T.Failure ByteString Buffer r
91−type Success a r = T.Success B.ByteString a r
98+type Success a r = T.Success ByteString Buffer a r
92−
93−-- | If at least @n@ bytes of input are available, return the current
94−-- input, otherwise fail.
95−ensure :: Int -> Parser B.ByteString
96−ensure !n = T.Parser $ \i0 a0 m0 kf ks ->
97− if B.length (unI i0) >= n
98− then ks i0 a0 m0 (unI i0)
99− else T.runParser (demandInput >> ensure n) i0 a0 m0 kf ks
100−
101−-- | Ask for input. If we receive any, pass it to a success
102−-- continuation, otherwise to a failure continuation.
103−prompt :: Input -> Added -> More
104− -> (Input -> Added -> More -> Result r)
105− -> (Input -> Added -> More -> Result r)
106− -> Result r
107−prompt i0 a0 _m0 kf ks = Partial $ \s ->
108− if B.null s
109− then kf i0 a0 Complete
110− else ks (I (unI i0 <> s)) (A (unA a0 <> s)) Incomplete
111−
112−-- | Immediately demand more input via a 'Partial' continuation
113−-- result.
114−demandInput :: Parser ()
115−demandInput = T.Parser $ \i0 a0 m0 kf ks ->
116− if m0 == Complete
117− then kf i0 a0 m0 ["demandInput"] "not enough bytes"
118− else let kf' i a m = kf i a m ["demandInput"] "not enough bytes"
119− ks' i a m = ks i a m ()
120− in prompt i0 a0 m0 kf' ks'
121−
122−-- | This parser always succeeds. It returns 'True' if any input is
123−-- available either immediately or on demand, and 'False' if the end
124−-- of all input has been reached.
125−wantInput :: Parser Bool
126−wantInput = T.Parser $ \i0 a0 m0 _kf ks ->
127− case () of
128− _ | not (B.null (unI i0)) -> ks i0 a0 m0 True
129− | m0 == Complete -> ks i0 a0 m0 False
130− | otherwise -> let kf' i a m = ks i a m False
131− ks' i a m = ks i a m True
132− in prompt i0 a0 m0 kf' ks'
133−
134−get :: Parser B.ByteString
135−get = T.Parser $ \i0 a0 m0 _kf ks -> ks i0 a0 m0 (unI i0)
136−
137−put :: B.ByteString -> Parser ()
138−put s = T.Parser $ \_i0 a0 m0 _kf ks -> ks (I s) a0 m0 ()
139−
140−-- | Attempt a parse, and if it fails, rewind the input so that no
141−-- input appears to have been consumed.
142−--
143−-- This combinator is provided for compatibility with Parsec.
144−-- Attoparsec parsers always backtrack on failure.
145−try :: Parser a -> Parser a
146−try p = p
147−{-# INLINE try #-}
148
99
149-- | The parser @satisfy p@ succeeds for any byte for which the
100-- | The parser @satisfy p@ succeeds for any byte for which the
150-- predicate @p@ returns 'True'. Returns the byte that is actually
101-- predicate @p@ returns 'True'. Returns the byte that is actually
@@ -154,11 +105,11 @@ try p = p
154-- > where isDigit w = w >= 48 && w <= 57
105-- > where isDigit w = w >= 48 && w <= 57
155satisfy :: (Word8 -> Bool) -> Parser Word8
106satisfy :: (Word8 -> Bool) -> Parser Word8
156satisfy p = do
107satisfy p = do
157− s <- ensure 1
108+ h <- peekWord8'
158− let w = B.unsafeHead s
159− if p w
109+ if p h
160− then put (B.unsafeTail s) >> return w
110+ then advance 1 >> return h
161 else fail "satisfy"
111 else fail "satisfy"
112+{-# INLINE satisfy #-}
162
113
163-- | The parser @skip p@ succeeds for any byte for which the predicate
114-- | The parser @skip p@ succeeds for any byte for which the predicate
164-- @p@ returns 'True'.
115-- @p@ returns 'True'.
@@ -167,9 +118,9 @@ satisfy p = do
167-- > where isDigit w = w >= 48 && w <= 57
118-- > where isDigit w = w >= 48 && w <= 57
168skip :: (Word8 -> Bool) -> Parser ()
119skip :: (Word8 -> Bool) -> Parser ()
169skip p = do
120skip p = do
170− s <- ensure 1
121+ h <- peekWord8'
171− if p (B.unsafeHead s)
122+ if p h
172− then put (B.unsafeTail s)
123+ then advance 1
173 else fail "skip"
124 else fail "skip"
174
125
175-- | The parser @satisfyWith f p@ transforms a byte, and succeeds if
126-- | The parser @satisfyWith f p@ transforms a byte, and succeeds if
@@ -177,11 +128,12 @@ skip p = do
177-- parser returns the transformed byte that was parsed.
128-- parser returns the transformed byte that was parsed.
178satisfyWith :: (Word8 -> a) -> (a -> Bool) -> Parser a
129satisfyWith :: (Word8 -> a) -> (a -> Bool) -> Parser a
179satisfyWith f p = do
130satisfyWith f p = do
180− s <- ensure 1
131+ h <- peekWord8'
181− let c = f (B.unsafeHead s)
132+ let c = f h
182 if p c
133 if p c
183− then put (B.unsafeTail s) >> return c
134+ then advance 1 >> return c
184 else fail "satisfyWith"
135 else fail "satisfyWith"
136+{-# INLINE satisfyWith #-}
185
137
186storable :: Storable a => Parser a
138storable :: Storable a => Parser a
187storable = hack undefined
139storable = hack undefined
@@ -189,23 +141,15 @@ storable = hack undefined
189 hack :: Storable b => b -> Parser b
141 hack :: Storable b => b -> Parser b
190 hack dummy = do
142 hack dummy = do
191 (fp,o,_) <- B.toForeignPtr `fmap` take (sizeOf dummy)
143 (fp,o,_) <- B.toForeignPtr `fmap` take (sizeOf dummy)
192− return . B.inlinePerformIO . withForeignPtr fp $ \p ->
144+ return . inlinePerformIO . withForeignPtr fp $ \p ->
193 peek (castPtr $ p `plusPtr` o)
145 peek (castPtr $ p `plusPtr` o)
194
146
195−-- | Consume @n@ bytes of input, but succeed only if the predicate
196−-- returns 'True'.
197−takeWith :: Int -> (B.ByteString -> Bool) -> Parser B.ByteString
198−takeWith n p = do
199− s <- ensure n
200− let h = B.unsafeTake n s
201− t = B.unsafeDrop n s
202− if p h
203− then put t >> return h
204− else fail "takeWith"
205−
206-- | Consume exactly @n@ bytes of input.
147-- | Consume exactly @n@ bytes of input.
207−take :: Int -> Parser B.ByteString
148+take :: Int -> Parser ByteString
208−take n = takeWith n (const True)
149+take n0 = do
150+ let n = max n0 0
151+ s <- ensure n
152+ advance n >> return s
209{-# INLINE take #-}
153{-# INLINE take #-}
210
154
211-- | @string s@ parses a sequence of bytes that identically match
155-- | @string s@ parses a sequence of bytes that identically match
@@ -215,33 +159,77 @@ take n = takeWith n (const True)
215-- /Note/: The behaviour of this parser is different to that of the
159-- /Note/: The behaviour of this parser is different to that of the
216-- similarly-named parser in Parsec, as this one is all-or-nothing.
160-- similarly-named parser in Parsec, as this one is all-or-nothing.
217-- To illustrate the difference, the following parser will fail under
161-- To illustrate the difference, the following parser will fail under
218−-- Parsec given an input of @"for"@:
162+-- Parsec given an input of @\"for\"@:
219--
163--
220-- >string "foo" <|> string "for"
164-- >string "foo" <|> string "for"
221--
165--
222−-- The reason for its failure is that that the first branch is a
166+-- The reason for its failure is that the first branch is a
223-- partial match, and will consume the letters @\'f\'@ and @\'o\'@
167-- partial match, and will consume the letters @\'f\'@ and @\'o\'@
224−-- before failing. In Attoparsec, the above parser will /succeed/ on
168+-- before failing. In attoparsec, the above parser will /succeed/ on
225-- that input, because the failed first branch will consume nothing.
169-- that input, because the failed first branch will consume nothing.
226−string :: B.ByteString -> Parser B.ByteString
170+string :: ByteString -> Parser ByteString
227−string s = takeWith (B.length s) (==s)
171+string s = string_ (stringSuspended id) id s
228{-# INLINE string #-}
172{-# INLINE string #-}
229
173
230−stringTransform :: (B.ByteString -> B.ByteString) -> B.ByteString
174+-- ASCII-specific but fast, oh yes.
231− -> Parser B.ByteString
175+toLower :: Word8 -> Word8
232−stringTransform f s = takeWith (B.length s) ((==f s) . f)
176+toLower w | w >= 65 && w <= 90 = w + 32
233−{-# INLINE stringTransform #-}
177+ | otherwise = w
178+
179+-- | Satisfy a literal string, ignoring case.
180+stringCI :: ByteString -> Parser ByteString
181+stringCI s = string_ (stringSuspended lower) lower s
182+ where lower = B8.map toLower
183+{-# INLINE stringCI #-}
184+
185+string_ :: (forall r. ByteString -> ByteString -> Buffer -> Pos -> More
186+ -> Failure r -> Success ByteString r -> Result r)
187+ -> (ByteString -> ByteString)
188+ -> ByteString -> Parser ByteString
189+string_ suspended f s0 = T.Parser $ \t pos more lose succ ->
190+ let n = B.length s
191+ s = f s0
192+ in if lengthAtLeast pos n t
193+ then let t' = substring pos (Pos n) t
194+ in if s == f t'
195+ then succ t (pos + Pos n) more t'
196+ else lose t pos more [] "string"
197+ else let t' = Buf.unsafeDrop (fromPos pos) t
198+ in if f t' `B.isPrefixOf` s
199+ then suspended s (B.drop (B.length t') s) t pos more lose succ
200+ else lose t pos more [] "string"
201+{-# INLINE string_ #-}
202+
203+stringSuspended :: (ByteString -> ByteString)
204+ -> ByteString -> ByteString -> Buffer -> Pos -> More
205+ -> Failure r
206+ -> Success ByteString r
207+ -> Result r
208+stringSuspended f s0 s t pos more lose succ =
209+ runParser (demandInput_ >>= go) t pos more lose succ
210+ where go s'0 = T.Parser $ \t' pos' more' lose' succ' ->
211+ let m = B.length s
212+ s' = f s'0
213+ n = B.length s'
214+ in if n >= m
215+ then if B.unsafeTake m s' == s
216+ then let o = Pos (B.length s0)
217+ in succ' t' (pos' + o) more'
218+ (substring pos' o t')
219+ else lose' t' pos' more' [] "string"
220+ else if s' == B.unsafeTake n s
221+ then stringSuspended f s0 (B.unsafeDrop n s)
222+ t' pos' more' lose' succ'
223+ else lose' t' pos' more' [] "string"
234
224
235-- | Skip past input for as long as the predicate returns 'True'.
225-- | Skip past input for as long as the predicate returns 'True'.
236skipWhile :: (Word8 -> Bool) -> Parser ()
226skipWhile :: (Word8 -> Bool) -> Parser ()
237skipWhile p = go
227skipWhile p = go
238 where
228 where
239 go = do
229 go = do
240− t <- B8.dropWhile p <$> get
230+ t <- B8.takeWhile p <$> get
241− put t
231+ continue <- inputSpansChunks (B.length t)
242− when (B.null t) $ do
243− input <- wantInput
244− when input go
232+ when continue go
245{-# INLINE skipWhile #-}
233{-# INLINE skipWhile #-}
246
234
247-- | Consume input as long as the predicate returns 'False'
235-- | Consume input as long as the predicate returns 'False'
@@ -251,9 +239,10 @@ skipWhile p = go
251-- predicate returns 'True' on the first byte of input.
239-- predicate returns 'True' on the first byte of input.
252--
240--
253-- /Note/: Because this parser does not fail, do not use it with
241-- /Note/: Because this parser does not fail, do not use it with
254−-- combinators such as 'many', because such parsers loop until a
242+-- combinators such as 'Control.Applicative.many', because such
255−-- failure occurs. Careless use will thus result in an infinite loop.
243+-- parsers loop until a failure occurs. Careless use will thus result
244+-- in an infinite loop.
256−takeTill :: (Word8 -> Bool) -> Parser B.ByteString
245+takeTill :: (Word8 -> Bool) -> Parser ByteString
257takeTill p = takeWhile (not . p)
246takeTill p = takeWhile (not . p)
258{-# INLINE takeTill #-}
247{-# INLINE takeTill #-}
259
248
@@ -264,23 +253,30 @@ takeTill p = takeWhile (not . p)
264-- predicate returns 'False' on the first byte of input.
253-- predicate returns 'False' on the first byte of input.
265--
254--
266-- /Note/: Because this parser does not fail, do not use it with
255-- /Note/: Because this parser does not fail, do not use it with
267−-- combinators such as 'many', because such parsers loop until a
256+-- combinators such as 'Control.Applicative.many', because such
268−-- failure occurs. Careless use will thus result in an infinite loop.
257+-- parsers loop until a failure occurs. Careless use will thus result
258+-- in an infinite loop.
269−takeWhile :: (Word8 -> Bool) -> Parser B.ByteString
259+takeWhile :: (Word8 -> Bool) -> Parser ByteString
270−takeWhile p = (B.concat . reverse) `fmap` go []
260+takeWhile p = do
261+ s <- B8.takeWhile p <$> get
262+ continue <- inputSpansChunks (B.length s)
263+ if continue
264+ then takeWhileAcc p [s]
265+ else return s
266+{-# INLINE takeWhile #-}
267+
268+takeWhileAcc :: (Word8 -> Bool) -> [ByteString] -> Parser ByteString
269+takeWhileAcc p = go
271 where
270 where
272 go acc = do
271 go acc = do
273− (h,t) <- B8.span p <$> get
272+ s <- B8.takeWhile p <$> get
274− put t
273+ continue <- inputSpansChunks (B.length s)
275− if B.null t
274+ if continue
276− then do
277− input <- wantInput
278− if input
279− then go (h:acc)
275+ then go (s:acc)
280− else return (h:acc)
276+ else return $ concatReverse (s:acc)
281− else return (h:acc)
277+{-# INLINE takeWhileAcc #-}
282−
278+
283−takeRest :: Parser [B.ByteString]
279+takeRest :: Parser [ByteString]
284takeRest = go []
280takeRest = go []
285 where
281 where
286 go acc = do
282 go acc = do
@@ -288,12 +284,12 @@ takeRest = go []
288 if input
284 if input
289 then do
285 then do
290 s <- get
286 s <- get
291− put B.empty
287+ advance (B.length s)
292 go (s:acc)
288 go (s:acc)
293 else return (reverse acc)
289 else return (reverse acc)
294
290
295-- | Consume all remaining input and return it as a single string.
291-- | Consume all remaining input and return it as a single string.
296−takeByteString :: Parser B.ByteString
292+takeByteString :: Parser ByteString
297takeByteString = B.concat `fmap` takeRest
293takeByteString = B.concat `fmap` takeRest
298
294
299-- | Consume all remaining input and return it as a single string.
295-- | Consume all remaining input and return it as a single string.
@@ -302,23 +298,9 @@ takeLazyByteString = L.fromChunks `fmap` takeRest
302
298
303data T s = T {-# UNPACK #-} !Int s
299data T s = T {-# UNPACK #-} !Int s
304
300
305−-- | A stateful scanner. The predicate consumes and transforms a
301+scan_ :: (s -> [ByteString] -> Parser r) -> s -> (s -> Word8 -> Maybe s)
306−-- state argument, and each transformed state is passed to successive
302+ -> Parser r
307−-- invocations of the predicate on each byte of the input until one
303+scan_ f s0 p = go [] s0
308−-- returns 'Nothing' or the input ends.
309−--
310−-- This parser does not fail. It will return an empty string if the
311−-- predicate returns 'Nothing' on the first byte of input.
312−--
313−-- /Note/: Because this parser does not fail, do not use it with
314−-- combinators such as 'many', because such parsers loop until a
315−-- failure occurs. Careless use will thus result in an infinite loop.
316−scan :: s -> (s -> Word8 -> Maybe s) -> Parser B.ByteString
317−scan s0 p = do
318− chunks <- go [] s0
319− case chunks of
320− [x] -> return x
321− xs -> return . B.concat . reverse $ xs
322 where
304 where
323 go acc s1 = do
305 go acc s1 = do
324 let scanner (B.PS fp off len) =
306 let scanner (B.PS fp off len) =
@@ -335,34 +317,56 @@ scan s0 p = do
335 done !i !s = return (T i s)
317 done !i !s = return (T i s)
336 inner start s1
318 inner start s1
337 bs <- get
319 bs <- get
338− let T i s' = unsafePerformIO $ scanner bs
320+ let T i s' = inlinePerformIO $ scanner bs
339− h = B.unsafeTake i bs
321+ !h = B.unsafeTake i bs
340− t = B.unsafeDrop i bs
322+ continue <- inputSpansChunks i
341− put t
323+ if continue
342− if B.null t
343− then do
344− input <- wantInput
345− if input
346− then go (h:acc) s'
324+ then go (h:acc) s'
347− else return (h:acc)
325+ else f s' (h:acc)
348− else return (h:acc)
326+{-# INLINE scan_ #-}
327+
328+-- | A stateful scanner. The predicate consumes and transforms a
329+-- state argument, and each transformed state is passed to successive
330+-- invocations of the predicate on each byte of the input until one
331+-- returns 'Nothing' or the input ends.
332+--
333+-- This parser does not fail. It will return an empty string if the
334+-- predicate returns 'Nothing' on the first byte of input.
335+--
336+-- /Note/: Because this parser does not fail, do not use it with
337+-- combinators such as 'Control.Applicative.many', because such
338+-- parsers loop until a failure occurs. Careless use will thus result
339+-- in an infinite loop.
340+scan :: s -> (s -> Word8 -> Maybe s) -> Parser ByteString
341+scan = scan_ $ \_ chunks -> return $! concatReverse chunks
349{-# INLINE scan #-}
342{-# INLINE scan #-}
350
343
344+-- | Like 'scan', but generalized to return the final state of the
345+-- scanner.
346+runScanner :: s -> (s -> Word8 -> Maybe s) -> Parser (ByteString, s)
347+runScanner = scan_ $ \s xs -> let !sx = concatReverse xs in return (sx, s)
348+{-# INLINE runScanner #-}
349+
351-- | Consume input as long as the predicate returns 'True', and return
350-- | Consume input as long as the predicate returns 'True', and return
352-- the consumed input.
351-- the consumed input.
353--
352--
354-- This parser requires the predicate to succeed on at least one byte
353-- This parser requires the predicate to succeed on at least one byte
355-- of input: it will fail if the predicate never returns 'True' or if
354-- of input: it will fail if the predicate never returns 'True' or if
356-- there is no input left.
355-- there is no input left.
357−takeWhile1 :: (Word8 -> Bool) -> Parser B.ByteString
356+takeWhile1 :: (Word8 -> Bool) -> Parser ByteString
358takeWhile1 p = do
357takeWhile1 p = do
359− (`when` demandInput) =<< B.null <$> get
358+ (`when` demandInput) =<< endOfChunk
360− (h,t) <- B8.span p <$> get
361− when (B.null h) $ fail "takeWhile1"
362− put t
363− if B.null t
364− then (h<>) `fmap` takeWhile p
359+ s <- B8.takeWhile p <$> get
360+ let len = B.length s
361+ if len == 0
362+ then fail "takeWhile1"
363+ else do
364+ advance len
365+ eoc <- endOfChunk
366+ if eoc
367+ then takeWhileAcc p [s]
365− else return h
368+ else return s
369+{-# INLINE takeWhile1 #-}
366
370
367-- | Match any byte in a set.
371-- | Match any byte in a set.
368--
372--
@@ -400,60 +404,133 @@ notWord8 :: Word8 -> Parser Word8
400notWord8 c = satisfy (/= c) <?> "not " ++ show c
404notWord8 c = satisfy (/= c) <?> "not " ++ show c
401{-# INLINE notWord8 #-}
405{-# INLINE notWord8 #-}
402
406
403−-- | Match only if all input has been consumed.
407+-- | Match any byte, to perform lookahead. Returns 'Nothing' if end of
404−endOfInput :: Parser ()
408+-- input has been reached. Does not consume any input.
405−endOfInput = T.Parser $ \i0 a0 m0 kf ks ->
409+--
406− if B.null (unI i0)
410+-- /Note/: Because this parser does not fail, do not use it with
407− then if m0 == Complete
411+-- combinators such as 'Control.Applicative.many', because such
408− then ks i0 a0 m0 ()
412+-- parsers loop until a failure occurs. Careless use will thus result
409− else let kf' i1 a1 m1 _ _ = addS i0 a0 m0 i1 a1 m1 $
413+-- in an infinite loop.
410− \ i2 a2 m2 -> ks i2 a2 m2 ()
414+peekWord8 :: Parser (Maybe Word8)
411− ks' i1 a1 m1 _ = addS i0 a0 m0 i1 a1 m1 $
415+peekWord8 = T.Parser $ \t pos@(Pos pos_) more _lose succ ->
412− \ i2 a2 m2 -> kf i2 a2 m2 []
416+ case () of
413− "endOfInput"
417+ _| pos_ < Buf.length t ->
414− in T.runParser demandInput i0 a0 m0 kf' ks'
418+ let !w = Buf.unsafeIndex t pos_
415− else kf i0 a0 m0 [] "endOfInput"
419+ in succ t pos more (Just w)
416−
420+ | more == Complete ->
417−-- | Return an indication of whether the end of input has been
421+ succ t pos more Nothing
418−-- reached.
422+ | otherwise ->
419−atEnd :: Parser Bool
423+ let succ' t' pos' more' = let !w = Buf.unsafeIndex t' pos_
420−atEnd = not <$> wantInput
424+ in succ t' pos' more' (Just w)
425+ lose' t' pos' more' = succ t' pos' more' Nothing
426+ in prompt t pos more lose' succ'
427+{-# INLINE peekWord8 #-}
428+
429+-- | Match any byte, to perform lookahead. Does not consume any
430+-- input, but will fail if end of input has been reached.
431+peekWord8' :: Parser Word8
432+peekWord8' = T.Parser $ \t pos more lose succ ->
433+ if lengthAtLeast pos 1 t
434+ then succ t pos more (Buf.unsafeIndex t (fromPos pos))
435+ else let succ' t' pos' more' bs' = succ t' pos' more' $! B.unsafeHead bs'
436+ in ensureSuspended 1 t pos more lose succ'
421−{-# INLINE atEnd #-}
437+{-# INLINE peekWord8' #-}
422
438
423-- | Match either a single newline character @\'\\n\'@, or a carriage
439-- | Match either a single newline character @\'\\n\'@, or a carriage
424-- return followed by a newline character @\"\\r\\n\"@.
440-- return followed by a newline character @\"\\r\\n\"@.
425endOfLine :: Parser ()
441endOfLine :: Parser ()
426endOfLine = (word8 10 >> return ()) <|> (string "\r\n" >> return ())
442endOfLine = (word8 10 >> return ()) <|> (string "\r\n" >> return ())
427
443
428−--- | Name the parser, in case failure occurs.
429−(<?>) :: Parser a
430− -> String -- ^ the name to use if parsing fails
431− -> Parser a
432−p <?> msg0 = T.Parser $ \i0 a0 m0 kf ks ->
433− let kf' i a m strs msg = kf i a m (msg0:strs) msg
434− in T.runParser p i0 a0 m0 kf' ks
435−{-# INLINE (<?>) #-}
436−infix 0 <?>
437−
438-- | Terminal failure continuation.
444-- | Terminal failure continuation.
439failK :: Failure a
445failK :: Failure a
440−failK i0 _a0 _m0 stack msg = Fail (unI i0) stack msg
446+failK t (Pos pos) _more stack msg = Fail (Buf.unsafeDrop pos t) stack msg
441{-# INLINE failK #-}
447{-# INLINE failK #-}
442
448
443-- | Terminal success continuation.
449-- | Terminal success continuation.
444successK :: Success a a
450successK :: Success a a
445−successK i0 _a0 _m0 a = Done (unI i0) a
451+successK t (Pos pos) _more a = Done (Buf.unsafeDrop pos t) a
446{-# INLINE successK #-}
452{-# INLINE successK #-}
447
453
448-- | Run a parser.
454-- | Run a parser.
449−parse :: Parser a -> B.ByteString -> Result a
455+parse :: Parser a -> ByteString -> Result a
450−parse m s = T.runParser m (I s) (A B.empty) Incomplete failK successK
456+parse m s = T.runParser m (buffer s) (Pos 0) Incomplete failK successK
451{-# INLINE parse #-}
457{-# INLINE parse #-}
452
458
453-- | Run a parser that cannot be resupplied via a 'Partial' result.
459-- | Run a parser that cannot be resupplied via a 'Partial' result.
460+--
461+-- This function does not force a parser to consume all of its input.
462+-- Instead, any residual input will be discarded. To force a parser
463+-- to consume all of its input, use something like this:
464+--
465+-- @
466+--'parseOnly' (myParser 'Control.Applicative.<*' 'endOfInput')
467+-- @
454−parseOnly :: Parser a -> B.ByteString -> Either String a
468+parseOnly :: Parser a -> ByteString -> Either String a
455−parseOnly m s = case T.runParser m (I s) (A B.empty) Complete failK successK of
469+parseOnly m s = case T.runParser m (buffer s) (Pos 0) Complete failK successK of
470+ Fail _ [] err -> Left err
456− Fail _ _ err -> Left err
471+ Fail _ ctxs err -> Left (intercalate " > " ctxs ++ ": " ++ err)
457− Done _ a -> Right a
472+ Done _ a -> Right a
458− _ -> error "parseOnly: impossible error!"
473+ _ -> error "parseOnly: impossible error!"
459{-# INLINE parseOnly #-}
474{-# INLINE parseOnly #-}
475+
476+get :: Parser ByteString
477+get = T.Parser $ \t pos more _lose succ ->
478+ succ t pos more (Buf.unsafeDrop (fromPos pos) t)
479+{-# INLINE get #-}
480+
481+endOfChunk :: Parser Bool
482+endOfChunk = T.Parser $ \t pos more _lose succ ->
483+ succ t pos more (fromPos pos == Buf.length t)
484+{-# INLINE endOfChunk #-}
485+
486+inputSpansChunks :: Int -> Parser Bool
487+inputSpansChunks i = T.Parser $ \t pos_ more _lose succ ->
488+ let pos = pos_ + Pos i
489+ in if fromPos pos < Buf.length t || more == Complete
490+ then succ t pos more False
491+ else let lose' t' pos' more' = succ t' pos' more' False
492+ succ' t' pos' more' = succ t' pos' more' True
493+ in prompt t pos more lose' succ'
494+{-# INLINE inputSpansChunks #-}
495+
496+advance :: Int -> Parser ()
497+advance n = T.Parser $ \t pos more _lose succ ->
498+ succ t (pos + Pos n) more ()
499+{-# INLINE advance #-}
500+
501+ensureSuspended :: Int -> Buffer -> Pos -> More
502+ -> Failure r
503+ -> Success ByteString r
504+ -> Result r
505+ensureSuspended n t pos more lose succ =
506+ runParser (demandInput >> go) t pos more lose succ
507+ where go = T.Parser $ \t' pos' more' lose' succ' ->
508+ if lengthAtLeast pos' n t'
509+ then succ' t' pos' more' (substring pos (Pos n) t')
510+ else runParser (demandInput >> go) t' pos' more' lose' succ'
511+
512+-- | If at least @n@ elements of input are available, return the
513+-- current input, otherwise fail.
514+ensure :: Int -> Parser ByteString
515+ensure n = T.Parser $ \t pos more lose succ ->
516+ if lengthAtLeast pos n t
517+ then succ t pos more (substring pos (Pos n) t)
518+ -- The uncommon case is kept out-of-line to reduce code size:
519+ else ensureSuspended n t pos more lose succ
520+{-# INLINE ensure #-}
521+
522+-- | Return both the result of a parse and the portion of the input
523+-- that was consumed while it was being parsed.
524+match :: Parser a -> Parser (ByteString, a)
525+match p = T.Parser $ \t pos more lose succ ->
526+ let succ' t' pos' more' a =
527+ succ t' pos' more' (substring pos (pos'-pos) t', a)
528+ in runParser p t pos more lose succ'
529+
530+lengthAtLeast :: Pos -> Int -> Buffer -> Bool
531+lengthAtLeast (Pos pos) n bs = Buf.length bs >= pos + n
532+{-# INLINE lengthAtLeast #-}
533+
534+substring :: Pos -> Pos -> Buffer -> ByteString
535+substring (Pos pos) (Pos n) = Buf.substring pos n
536+{-# INLINE substring #-}
Data/Attoparsec/ByteString/Lazy.hs+29−10
@@ -1,14 +1,19 @@
1+{-# LANGUAGE CPP #-}
2+#if __GLASGOW_HASKELL__ >= 702
3+{-# LANGUAGE Trustworthy #-} -- Imports internal modules
4+#endif
5+
1-- |
6-- |
2-- Module : Data.Attoparsec.ByteString.Lazy
7-- Module : Data.Attoparsec.ByteString.Lazy
3−-- Copyright : Bryan O'Sullivan 2010, 2011
8+-- Copyright : Bryan O'Sullivan 2007-2015
4-- License : BSD3
9-- License : BSD3
5−--
10+--
6-- Maintainer : bos@serpentine.com
11-- Maintainer : bos@serpentine.com
7-- Stability : experimental
12-- Stability : experimental
8-- Portability : unknown
13-- Portability : unknown
9--
14--
10−-- Simple, efficient combinator parsing for lazy 'ByteString'
15+-- Simple, efficient combinator parsing that can consume lazy
11−-- strings, loosely based on the Parsec library.
16+-- 'ByteString' strings, loosely based on the Parsec library.
12--
17--
13-- This is essentially the same code as in the 'Data.Attoparsec'
18-- This is essentially the same code as in the 'Data.Attoparsec'
14-- module, only with a 'parse' function that can consume a lazy
19-- module, only with a 'parse' function that can consume a lazy
@@ -16,10 +21,11 @@
16-- more input to be fed in. Think of this as suitable for use with a
21-- more input to be fed in. Think of this as suitable for use with a
17-- lazily read file, e.g. via 'L.readFile' or 'L.hGetContents'.
22-- lazily read file, e.g. via 'L.readFile' or 'L.hGetContents'.
18--
23--
24+-- /Note:/ The various parser functions and combinators such as
25+-- 'string' still expect /strict/ 'B.ByteString' parameters, and
26+-- return strict 'B.ByteString' results. Behind the scenes, strict
19−-- Behind the scenes, strict 'B.ByteString' values are still used
27+-- 'B.ByteString' values are still used internally to store parser
20−-- internally to store parser input and manipulate it efficiently.
28+-- input and manipulate it efficiently.
21−-- High-performance parsers such as 'string' still expect strict
22−-- 'B.ByteString' parameters.
23
29
24module Data.Attoparsec.ByteString.Lazy
30module Data.Attoparsec.ByteString.Lazy
25 (
31 (
@@ -33,7 +39,9 @@ module Data.Attoparsec.ByteString.Lazy
33 , eitherResult
39 , eitherResult
34 ) where
40 ) where
35
41
42+import Control.DeepSeq (NFData(rnf))
36import Data.ByteString.Lazy.Internal (ByteString(..), chunk)
43import Data.ByteString.Lazy.Internal (ByteString(..), chunk)
44+import Data.List (intercalate)
37import qualified Data.ByteString as B
45import qualified Data.ByteString as B
38import qualified Data.Attoparsec.ByteString as A
46import qualified Data.Attoparsec.ByteString as A
39import qualified Data.Attoparsec.Internal.Types as T
47import qualified Data.Attoparsec.Internal.Types as T
@@ -53,6 +61,16 @@ data Result r = Fail ByteString [String] String
53 -- input that had not yet been consumed (if any) when
61 -- input that had not yet been consumed (if any) when
54 -- the parse succeeded.
62 -- the parse succeeded.
55
63
64+instance NFData r => NFData (Result r) where
65+ rnf (Fail bs ctxs msg) = rnfBS bs `seq` rnf ctxs `seq` rnf msg
66+ rnf (Done bs r) = rnfBS bs `seq` rnf r
67+ {-# INLINE rnf #-}
68+
69+rnfBS :: ByteString -> ()
70+rnfBS (Chunk _ xs) = rnfBS xs
71+rnfBS Empty = ()
72+{-# INLINE rnfBS #-}
73+
56instance Show r => Show (Result r) where
74instance Show r => Show (Result r) where
57 show (Fail bs stk msg) =
75 show (Fail bs stk msg) =
58 "Fail " ++ show bs ++ " " ++ show stk ++ " " ++ show msg
76 "Fail " ++ show bs ++ " " ++ show stk ++ " " ++ show msg
@@ -87,5 +105,6 @@ maybeResult _ = Nothing
87
105
88-- | Convert a 'Result' value to an 'Either' value.
106-- | Convert a 'Result' value to an 'Either' value.
89eitherResult :: Result r -> Either String r
107eitherResult :: Result r -> Either String r
90−eitherResult (Done _ r) = Right r
108+eitherResult (Done _ r) = Right r
91−eitherResult (Fail _ _ msg) = Left msg
109+eitherResult (Fail _ [] msg) = Left msg
110+eitherResult (Fail _ ctxs msg) = Left (intercalate " > " ctxs ++ ": " ++ msg)
Data/Attoparsec/Char8.hs+8−3
@@ -1,16 +1,21 @@
1-- |
1-- |
2-- Module : Data.Attoparsec.Char8
2-- Module : Data.Attoparsec.Char8
3−-- Copyright : Bryan O'Sullivan 2007-2011
3+-- Copyright : Bryan O'Sullivan 2007-2015
4-- License : BSD3
4-- License : BSD3
5−--
5+--
6-- Maintainer : bos@serpentine.com
6-- Maintainer : bos@serpentine.com
7-- Stability : experimental
7-- Stability : experimental
8-- Portability : unknown
8-- Portability : unknown
9--
9--
10-- Simple, efficient, character-oriented combinator parsing for
10-- Simple, efficient, character-oriented combinator parsing for
11−-- 'ByteString' strings, loosely based on the Parsec library.
11+-- 'Data.ByteString.ByteString' strings, loosely based on the Parsec
12+-- library.
13+--
14+-- This module is deprecated. Use "Data.Attoparsec.ByteString.Char8"
15+-- instead.
12
16
13module Data.Attoparsec.Char8
17module Data.Attoparsec.Char8
18+ {-# DEPRECATED "This module will be removed in the next major release." #-}
14 (
19 (
15 module Data.Attoparsec.ByteString.Char8
20 module Data.Attoparsec.ByteString.Char8
16 ) where
21 ) where
Data/Attoparsec/Combinator.hs+145−29
@@ -1,9 +1,12 @@
1{-# LANGUAGE BangPatterns, CPP #-}
1{-# LANGUAGE BangPatterns, CPP #-}
2+#if __GLASGOW_HASKELL__ >= 702
3+{-# LANGUAGE Trustworthy #-} -- Imports internal modules
4+#endif
2-- |
5-- |
3-- Module : Data.Attoparsec.Combinator
6-- Module : Data.Attoparsec.Combinator
4−-- Copyright : Daan Leijen 1999-2001, Bryan O'Sullivan 2009-2010
7+-- Copyright : Daan Leijen 1999-2001, Bryan O'Sullivan 2007-2015
5-- License : BSD3
8-- License : BSD3
6−--
9+--
7-- Maintainer : bos@serpentine.com
10-- Maintainer : bos@serpentine.com
8-- Stability : experimental
11-- Stability : experimental
9-- Portability : portable
12-- Portability : portable
@@ -11,37 +14,72 @@
11-- Useful parser combinators, similar to those provided by Parsec.
14-- Useful parser combinators, similar to those provided by Parsec.
12module Data.Attoparsec.Combinator
15module Data.Attoparsec.Combinator
13 (
16 (
17+ -- * Combinators
18+ try
19+ , (<?>)
14− choice
20+ , choice
15 , count
21 , count
16 , option
22 , option
23+ , many'
17 , many1
24 , many1
25+ , many1'
18 , manyTill
26 , manyTill
27+ , manyTill'
19 , sepBy
28 , sepBy
29+ , sepBy'
20 , sepBy1
30 , sepBy1
31+ , sepBy1'
21 , skipMany
32 , skipMany
22 , skipMany1
33 , skipMany1
23 , eitherP
34 , eitherP
35+ , feed
36+ , satisfyElem
37+ , endOfInput
38+ , atEnd
39+ , lookAhead
24 ) where
40 ) where
25
41
42+#if !MIN_VERSION_base(4,8,0)
43+import Control.Applicative (Applicative(..), (<$>))
44+import Data.Monoid (Monoid(mappend))
45+#endif
26−import Control.Applicative (Alternative(..), Applicative(..), empty, liftA2,
46+import Control.Applicative (Alternative(..), empty, liftA2, many, (<|>))
27− (<|>), (*>), (<$>))
47+import Control.Monad (MonadPlus(..))
28−#if __GLASGOW_HASKELL__ >= 700
29−import Data.Attoparsec.Internal.Types (Parser)
48+import Data.Attoparsec.Internal.Types (Parser(..), IResult(..))
30−import qualified Data.Attoparsec.Zepto as Z
49+import Data.Attoparsec.Internal (endOfInput, atEnd, satisfyElem)
31import Data.ByteString (ByteString)
50import Data.ByteString (ByteString)
32import Data.Text (Text)
51import Data.Text (Text)
33−#endif
52+import qualified Data.Attoparsec.Zepto as Z
53+import Prelude hiding (succ)
54+
55+-- | Attempt a parse, and if it fails, rewind the input so that no
56+-- input appears to have been consumed.
57+--
58+-- This combinator is provided for compatibility with Parsec.
59+-- attoparsec parsers always backtrack on failure.
60+try :: Parser i a -> Parser i a
61+try p = p
62+{-# INLINE try #-}
63+
64+-- | Name the parser, in case failure occurs.
65+(<?>) :: Parser i a
66+ -> String -- ^ the name to use if parsing fails
67+ -> Parser i a
68+p <?> msg0 = Parser $ \t pos more lose succ ->
69+ let lose' t' pos' more' strs msg = lose t' pos' more' (msg0:strs) msg
70+ in runParser p t pos more lose' succ
71+{-# INLINE (<?>) #-}
72+infix 0 <?>
34
73
35-- | @choice ps@ tries to apply the actions in the list @ps@ in order,
74-- | @choice ps@ tries to apply the actions in the list @ps@ in order,
36-- until one of them succeeds. Returns the value of the succeeding
75-- until one of them succeeds. Returns the value of the succeeding
37-- action.
76-- action.
38choice :: Alternative f => [f a] -> f a
77choice :: Alternative f => [f a] -> f a
39choice = foldr (<|>) empty
78choice = foldr (<|>) empty
40−#if __GLASGOW_HASKELL__ >= 700
41−{-# SPECIALIZE choice :: [Parser ByteString a] -> Parser ByteString a #-}
79+{-# SPECIALIZE choice :: [Parser ByteString a]
80+ -> Parser ByteString a #-}
42{-# SPECIALIZE choice :: [Parser Text a] -> Parser Text a #-}
81{-# SPECIALIZE choice :: [Parser Text a] -> Parser Text a #-}
43{-# SPECIALIZE choice :: [Z.Parser a] -> Z.Parser a #-}
82{-# SPECIALIZE choice :: [Z.Parser a] -> Z.Parser a #-}
44−#endif
45
83
46-- | @option x p@ tries to apply action @p@. If @p@ fails without
84-- | @option x p@ tries to apply action @p@. If @p@ fails without
47-- consuming input, it returns the value @x@, otherwise the value
85-- consuming input, it returns the value @x@, otherwise the value
@@ -50,11 +88,29 @@ choice = foldr (<|>) empty
50-- > priority = option 0 (digitToInt <$> digit)
88-- > priority = option 0 (digitToInt <$> digit)
51option :: Alternative f => a -> f a -> f a
89option :: Alternative f => a -> f a -> f a
52option x p = p <|> pure x
90option x p = p <|> pure x
53−#if __GLASGOW_HASKELL__ >= 700
54{-# SPECIALIZE option :: a -> Parser ByteString a -> Parser ByteString a #-}
91{-# SPECIALIZE option :: a -> Parser ByteString a -> Parser ByteString a #-}
55{-# SPECIALIZE option :: a -> Parser Text a -> Parser Text a #-}
92{-# SPECIALIZE option :: a -> Parser Text a -> Parser Text a #-}
56{-# SPECIALIZE option :: a -> Z.Parser a -> Z.Parser a #-}
93{-# SPECIALIZE option :: a -> Z.Parser a -> Z.Parser a #-}
57−#endif
94+
95+-- | A version of 'liftM2' that is strict in the result of its first
96+-- action.
97+liftM2' :: (Monad m) => (a -> b -> c) -> m a -> m b -> m c
98+liftM2' f a b = do
99+ !x <- a
100+ y <- b
101+ return (f x y)
102+{-# INLINE liftM2' #-}
103+
104+-- | @many' p@ applies the action @p@ /zero/ or more times. Returns a
105+-- list of the returned values of @p@. The value returned by @p@ is
106+-- forced to WHNF.
107+--
108+-- > word = many' letter
109+many' :: (MonadPlus m) => m a -> m [a]
110+many' p = many_p
111+ where many_p = some_p `mplus` return []
112+ some_p = liftM2' (:) p many_p
113+{-# INLINE many' #-}
58
114
59-- | @many1 p@ applies the action @p@ /one/ or more times. Returns a
115-- | @many1 p@ applies the action @p@ /one/ or more times. Returns a
60-- list of the returned values of @p@.
116-- list of the returned values of @p@.
@@ -64,69 +120,114 @@ many1 :: Alternative f => f a -> f [a]
64many1 p = liftA2 (:) p (many p)
120many1 p = liftA2 (:) p (many p)
65{-# INLINE many1 #-}
121{-# INLINE many1 #-}
66
122
123+-- | @many1' p@ applies the action @p@ /one/ or more times. Returns a
124+-- list of the returned values of @p@. The value returned by @p@ is
125+-- forced to WHNF.
126+--
127+-- > word = many1' letter
128+many1' :: (MonadPlus m) => m a -> m [a]
129+many1' p = liftM2' (:) p (many' p)
130+{-# INLINE many1' #-}
131+
67-- | @sepBy p sep@ applies /zero/ or more occurrences of @p@, separated
132-- | @sepBy p sep@ applies /zero/ or more occurrences of @p@, separated
68-- by @sep@. Returns a list of the values returned by @p@.
133-- by @sep@. Returns a list of the values returned by @p@.
69--
134--
70−-- > commaSep p = p `sepBy` (symbol ",")
135+-- > commaSep p = p `sepBy` (char ',')
71sepBy :: Alternative f => f a -> f s -> f [a]
136sepBy :: Alternative f => f a -> f s -> f [a]
72sepBy p s = liftA2 (:) p ((s *> sepBy1 p s) <|> pure []) <|> pure []
137sepBy p s = liftA2 (:) p ((s *> sepBy1 p s) <|> pure []) <|> pure []
73−#if __GLASGOW_HASKELL__ >= 700
74{-# SPECIALIZE sepBy :: Parser ByteString a -> Parser ByteString s
138{-# SPECIALIZE sepBy :: Parser ByteString a -> Parser ByteString s
75 -> Parser ByteString [a] #-}
139 -> Parser ByteString [a] #-}
76{-# SPECIALIZE sepBy :: Parser Text a -> Parser Text s -> Parser Text [a] #-}
140{-# SPECIALIZE sepBy :: Parser Text a -> Parser Text s -> Parser Text [a] #-}
77{-# SPECIALIZE sepBy :: Z.Parser a -> Z.Parser s -> Z.Parser [a] #-}
141{-# SPECIALIZE sepBy :: Z.Parser a -> Z.Parser s -> Z.Parser [a] #-}
78−#endif
142+
143+-- | @sepBy' p sep@ applies /zero/ or more occurrences of @p@, separated
144+-- by @sep@. Returns a list of the values returned by @p@. The value
145+-- returned by @p@ is forced to WHNF.
146+--
147+-- > commaSep p = p `sepBy'` (char ',')
148+sepBy' :: (MonadPlus m) => m a -> m s -> m [a]
149+sepBy' p s = scan `mplus` return []
150+ where scan = liftM2' (:) p ((s >> sepBy1' p s) `mplus` return [])
151+{-# SPECIALIZE sepBy' :: Parser ByteString a -> Parser ByteString s
152+ -> Parser ByteString [a] #-}
153+{-# SPECIALIZE sepBy' :: Parser Text a -> Parser Text s -> Parser Text [a] #-}
154+{-# SPECIALIZE sepBy' :: Z.Parser a -> Z.Parser s -> Z.Parser [a] #-}
79
155
80-- | @sepBy1 p sep@ applies /one/ or more occurrences of @p@, separated
156-- | @sepBy1 p sep@ applies /one/ or more occurrences of @p@, separated
81-- by @sep@. Returns a list of the values returned by @p@.
157-- by @sep@. Returns a list of the values returned by @p@.
82--
158--
83−-- > commaSep p = p `sepBy` (symbol ",")
159+-- > commaSep p = p `sepBy1` (char ',')
84sepBy1 :: Alternative f => f a -> f s -> f [a]
160sepBy1 :: Alternative f => f a -> f s -> f [a]
85sepBy1 p s = scan
161sepBy1 p s = scan
86 where scan = liftA2 (:) p ((s *> scan) <|> pure [])
162 where scan = liftA2 (:) p ((s *> scan) <|> pure [])
87−#if __GLASGOW_HASKELL__ >= 700
88{-# SPECIALIZE sepBy1 :: Parser ByteString a -> Parser ByteString s
163{-# SPECIALIZE sepBy1 :: Parser ByteString a -> Parser ByteString s
89 -> Parser ByteString [a] #-}
164 -> Parser ByteString [a] #-}
90{-# SPECIALIZE sepBy1 :: Parser Text a -> Parser Text s -> Parser Text [a] #-}
165{-# SPECIALIZE sepBy1 :: Parser Text a -> Parser Text s -> Parser Text [a] #-}
91{-# SPECIALIZE sepBy1 :: Z.Parser a -> Z.Parser s -> Z.Parser [a] #-}
166{-# SPECIALIZE sepBy1 :: Z.Parser a -> Z.Parser s -> Z.Parser [a] #-}
92−#endif
167+
168+-- | @sepBy1' p sep@ applies /one/ or more occurrences of @p@, separated
169+-- by @sep@. Returns a list of the values returned by @p@. The value
170+-- returned by @p@ is forced to WHNF.
171+--
172+-- > commaSep p = p `sepBy1'` (char ',')
173+sepBy1' :: (MonadPlus m) => m a -> m s -> m [a]
174+sepBy1' p s = scan
175+ where scan = liftM2' (:) p ((s >> scan) `mplus` return [])
176+{-# SPECIALIZE sepBy1' :: Parser ByteString a -> Parser ByteString s
177+ -> Parser ByteString [a] #-}
178+{-# SPECIALIZE sepBy1' :: Parser Text a -> Parser Text s -> Parser Text [a] #-}
179+{-# SPECIALIZE sepBy1' :: Z.Parser a -> Z.Parser s -> Z.Parser [a] #-}
93
180
94-- | @manyTill p end@ applies action @p@ /zero/ or more times until
181-- | @manyTill p end@ applies action @p@ /zero/ or more times until
95-- action @end@ succeeds, and returns the list of values returned by
182-- action @end@ succeeds, and returns the list of values returned by
96-- @p@. This can be used to scan comments:
183-- @p@. This can be used to scan comments:
97--
184--
98−-- > simpleComment = string "<!--" *> manyTill anyChar (try (string "-->"))
185+-- > simpleComment = string "<!--" *> manyTill anyChar (string "-->")
99--
186--
100−-- Note the overlapping parsers @anyChar@ and @string \"<!--\"@, and
187+-- (Note the overlapping parsers @anyChar@ and @string \"-->\"@.
101−-- therefore the use of the 'try' combinator.
188+-- While this will work, it is not very efficient, as it will cause a
189+-- lot of backtracking.)
102manyTill :: Alternative f => f a -> f b -> f [a]
190manyTill :: Alternative f => f a -> f b -> f [a]
103manyTill p end = scan
191manyTill p end = scan
104 where scan = (end *> pure []) <|> liftA2 (:) p scan
192 where scan = (end *> pure []) <|> liftA2 (:) p scan
105−#if __GLASGOW_HASKELL__ >= 700
106{-# SPECIALIZE manyTill :: Parser ByteString a -> Parser ByteString b
193{-# SPECIALIZE manyTill :: Parser ByteString a -> Parser ByteString b
107 -> Parser ByteString [a] #-}
194 -> Parser ByteString [a] #-}
108{-# SPECIALIZE manyTill :: Parser Text a -> Parser Text b -> Parser Text [a] #-}
195{-# SPECIALIZE manyTill :: Parser Text a -> Parser Text b -> Parser Text [a] #-}
109{-# SPECIALIZE manyTill :: Z.Parser a -> Z.Parser b -> Z.Parser [a] #-}
196{-# SPECIALIZE manyTill :: Z.Parser a -> Z.Parser b -> Z.Parser [a] #-}
110−#endif
197+
198+-- | @manyTill' p end@ applies action @p@ /zero/ or more times until
199+-- action @end@ succeeds, and returns the list of values returned by
200+-- @p@. This can be used to scan comments:
201+--
202+-- > simpleComment = string "<!--" *> manyTill' anyChar (string "-->")
203+--
204+-- (Note the overlapping parsers @anyChar@ and @string \"-->\"@.
205+-- While this will work, it is not very efficient, as it will cause a
206+-- lot of backtracking.)
207+--
208+-- The value returned by @p@ is forced to WHNF.
209+manyTill' :: (MonadPlus m) => m a -> m b -> m [a]
210+manyTill' p end = scan
211+ where scan = (end >> return []) `mplus` liftM2' (:) p scan
212+{-# SPECIALIZE manyTill' :: Parser ByteString a -> Parser ByteString b
213+ -> Parser ByteString [a] #-}
214+{-# SPECIALIZE manyTill' :: Parser Text a -> Parser Text b -> Parser Text [a] #-}
215+{-# SPECIALIZE manyTill' :: Z.Parser a -> Z.Parser b -> Z.Parser [a] #-}
111
216
112-- | Skip zero or more instances of an action.
217-- | Skip zero or more instances of an action.
113skipMany :: Alternative f => f a -> f ()
218skipMany :: Alternative f => f a -> f ()
114skipMany p = scan
219skipMany p = scan
115 where scan = (p *> scan) <|> pure ()
220 where scan = (p *> scan) <|> pure ()
116−#if __GLASGOW_HASKELL__ >= 700
117{-# SPECIALIZE skipMany :: Parser ByteString a -> Parser ByteString () #-}
221{-# SPECIALIZE skipMany :: Parser ByteString a -> Parser ByteString () #-}
118{-# SPECIALIZE skipMany :: Parser Text a -> Parser Text () #-}
222{-# SPECIALIZE skipMany :: Parser Text a -> Parser Text () #-}
119{-# SPECIALIZE skipMany :: Z.Parser a -> Z.Parser () #-}
223{-# SPECIALIZE skipMany :: Z.Parser a -> Z.Parser () #-}
120−#endif
121
224
122-- | Skip one or more instances of an action.
225-- | Skip one or more instances of an action.
123skipMany1 :: Alternative f => f a -> f ()
226skipMany1 :: Alternative f => f a -> f ()
124skipMany1 p = p *> skipMany p
227skipMany1 p = p *> skipMany p
125−#if __GLASGOW_HASKELL__ >= 700
126{-# SPECIALIZE skipMany1 :: Parser ByteString a -> Parser ByteString () #-}
228{-# SPECIALIZE skipMany1 :: Parser ByteString a -> Parser ByteString () #-}
127{-# SPECIALIZE skipMany1 :: Parser Text a -> Parser Text () #-}
229{-# SPECIALIZE skipMany1 :: Parser Text a -> Parser Text () #-}
128{-# SPECIALIZE skipMany1 :: Z.Parser a -> Z.Parser () #-}
230{-# SPECIALIZE skipMany1 :: Z.Parser a -> Z.Parser () #-}
129−#endif
130
231
131-- | Apply the given action repeatedly, returning every result.
232-- | Apply the given action repeatedly, returning every result.
132count :: Monad m => Int -> m a -> m [a]
233count :: Monad m => Int -> m a -> m [a]
@@ -137,3 +238,18 @@ count n p = sequence (replicate n p)
137eitherP :: (Alternative f) => f a -> f b -> f (Either a b)
238eitherP :: (Alternative f) => f a -> f b -> f (Either a b)
138eitherP a b = (Left <$> a) <|> (Right <$> b)
239eitherP a b = (Left <$> a) <|> (Right <$> b)
139{-# INLINE eitherP #-}
240{-# INLINE eitherP #-}
241+
242+-- | If a parser has returned a 'T.Partial' result, supply it with more
243+-- input.
244+feed :: Monoid i => IResult i r -> i -> IResult i r
245+feed (Fail t ctxs msg) d = Fail (mappend t d) ctxs msg
246+feed (Partial k) d = k d
247+feed (Done t r) d = Done (mappend t d) r
248+{-# INLINE feed #-}
249+
250+-- | Apply a parser without consuming any input.
251+lookAhead :: Parser i a -> Parser i a
252+lookAhead p = Parser $ \t pos more lose succ ->
253+ let succ' t' _pos' more' = succ t' pos more'
254+ in runParser p t pos more lose succ'
255+{-# INLINE lookAhead #-}
Data/Attoparsec/Internal.hsnew file+171
@@ -0,0 +1,171 @@
1+{-# LANGUAGE BangPatterns, CPP, ScopedTypeVariables #-}
2+-- |
3+-- Module : Data.Attoparsec.Internal
4+-- Copyright : Bryan O'Sullivan 2007-2015
5+-- License : BSD3
6+--
7+-- Maintainer : bos@serpentine.com
8+-- Stability : experimental
9+-- Portability : unknown
10+--
11+-- Simple, efficient parser combinators, loosely based on the Parsec
12+-- library.
13+
14+module Data.Attoparsec.Internal
15+ ( compareResults
16+ , prompt
17+ , demandInput
18+ , demandInput_
19+ , wantInput
20+ , endOfInput
21+ , atEnd
22+ , satisfyElem
23+ , concatReverse
24+ ) where
25+
26+#if !MIN_VERSION_base(4,8,0)
27+import Control.Applicative ((<$>))
28+import Data.Monoid (Monoid, mconcat)
29+#endif
30+import Data.Attoparsec.Internal.Types
31+import Data.ByteString (ByteString)
32+import Data.Text (Text)
33+import Prelude hiding (succ)
34+
35+-- | Compare two 'IResult' values for equality.
36+--
37+-- If both 'IResult's are 'Partial', the result will be 'Nothing', as
38+-- they are incomplete and hence their equality cannot be known.
39+-- (This is why there is no 'Eq' instance for 'IResult'.)
40+compareResults :: (Eq i, Eq r) => IResult i r -> IResult i r -> Maybe Bool
41+compareResults (Fail t0 ctxs0 msg0) (Fail t1 ctxs1 msg1) =
42+ Just (t0 == t1 && ctxs0 == ctxs1 && msg0 == msg1)
43+compareResults (Done t0 r0) (Done t1 r1) =
44+ Just (t0 == t1 && r0 == r1)
45+compareResults (Partial _) (Partial _) = Nothing
46+compareResults _ _ = Just False
47+
48+-- | Ask for input. If we receive any, pass the augmented input to a
49+-- success continuation, otherwise to a failure continuation.
50+prompt :: Chunk t
51+ => State t -> Pos -> More
52+ -> (State t -> Pos -> More -> IResult t r)
53+ -> (State t -> Pos -> More -> IResult t r)
54+ -> IResult t r
55+prompt t pos _more lose succ = Partial $ \s ->
56+ if nullChunk s
57+ then lose t pos Complete
58+ else succ (pappendChunk t s) pos Incomplete
59+{-# SPECIALIZE prompt :: State ByteString -> Pos -> More
60+ -> (State ByteString -> Pos -> More
61+ -> IResult ByteString r)
62+ -> (State ByteString -> Pos -> More
63+ -> IResult ByteString r)
64+ -> IResult ByteString r #-}
65+{-# SPECIALIZE prompt :: State Text -> Pos -> More
66+ -> (State Text -> Pos -> More -> IResult Text r)
67+ -> (State Text -> Pos -> More -> IResult Text r)
68+ -> IResult Text r #-}
69+
70+-- | Immediately demand more input via a 'Partial' continuation
71+-- result.
72+demandInput :: Chunk t => Parser t ()
73+demandInput = Parser $ \t pos more lose succ ->
74+ case more of
75+ Complete -> lose t pos more [] "not enough input"
76+ _ -> let lose' _ pos' more' = lose t pos' more' [] "not enough input"
77+ succ' t' pos' more' = succ t' pos' more' ()
78+ in prompt t pos more lose' succ'
79+{-# SPECIALIZE demandInput :: Parser ByteString () #-}
80+{-# SPECIALIZE demandInput :: Parser Text () #-}
81+
82+-- | Immediately demand more input via a 'Partial' continuation
83+-- result. Return the new input.
84+demandInput_ :: Chunk t => Parser t t
85+demandInput_ = Parser $ \t pos more lose succ ->
86+ case more of
87+ Complete -> lose t pos more [] "not enough input"
88+ _ -> Partial $ \s ->
89+ if nullChunk s
90+ then lose t pos Complete [] "not enough input"
91+ else succ (pappendChunk t s) pos more s
92+{-# SPECIALIZE demandInput_ :: Parser ByteString ByteString #-}
93+{-# SPECIALIZE demandInput_ :: Parser Text Text #-}
94+
95+-- | This parser always succeeds. It returns 'True' if any input is
96+-- available either immediately or on demand, and 'False' if the end
97+-- of all input has been reached.
98+wantInput :: forall t . Chunk t => Parser t Bool
99+wantInput = Parser $ \t pos more _lose succ ->
100+ case () of
101+ _ | pos < atBufferEnd (undefined :: t) t -> succ t pos more True
102+ | more == Complete -> succ t pos more False
103+ | otherwise -> let lose' t' pos' more' = succ t' pos' more' False
104+ succ' t' pos' more' = succ t' pos' more' True
105+ in prompt t pos more lose' succ'
106+{-# INLINE wantInput #-}
107+
108+-- | Match only if all input has been consumed.
109+endOfInput :: forall t . Chunk t => Parser t ()
110+endOfInput = Parser $ \t pos more lose succ ->
111+ case () of
112+ _| pos < atBufferEnd (undefined :: t) t -> lose t pos more [] "endOfInput"
113+ | more == Complete -> succ t pos more ()
114+ | otherwise ->
115+ let lose' t' pos' more' _ctx _msg = succ t' pos' more' ()
116+ succ' t' pos' more' _a = lose t' pos' more' [] "endOfInput"
117+ in runParser demandInput t pos more lose' succ'
118+{-# SPECIALIZE endOfInput :: Parser ByteString () #-}
119+{-# SPECIALIZE endOfInput :: Parser Text () #-}
120+
121+-- | Return an indication of whether the end of input has been
122+-- reached.
123+atEnd :: Chunk t => Parser t Bool
124+atEnd = not <$> wantInput
125+{-# INLINE atEnd #-}
126+
127+satisfySuspended :: forall t r . Chunk t
128+ => (ChunkElem t -> Bool)
129+ -> State t -> Pos -> More
130+ -> Failure t (State t) r
131+ -> Success t (State t) (ChunkElem t) r
132+ -> IResult t r
133+satisfySuspended p t pos more lose succ =
134+ runParser (demandInput >> go) t pos more lose succ
135+ where go = Parser $ \t' pos' more' lose' succ' ->
136+ case bufferElemAt (undefined :: t) pos' t' of
137+ Just (e, l) | p e -> succ' t' (pos' + Pos l) more' e
138+ | otherwise -> lose' t' pos' more' [] "satisfyElem"
139+ Nothing -> runParser (demandInput >> go) t' pos' more' lose' succ'
140+{-# SPECIALIZE satisfySuspended :: (ChunkElem ByteString -> Bool)
141+ -> State ByteString -> Pos -> More
142+ -> Failure ByteString (State ByteString) r
143+ -> Success ByteString (State ByteString)
144+ (ChunkElem ByteString) r
145+ -> IResult ByteString r #-}
146+{-# SPECIALIZE satisfySuspended :: (ChunkElem Text -> Bool)
147+ -> State Text -> Pos -> More
148+ -> Failure Text (State Text) r
149+ -> Success Text (State Text)
150+ (ChunkElem Text) r
151+ -> IResult Text r #-}
152+
153+-- | The parser @satisfyElem p@ succeeds for any chunk element for which the
154+-- predicate @p@ returns 'True'. Returns the element that is
155+-- actually parsed.
156+satisfyElem :: forall t . Chunk t
157+ => (ChunkElem t -> Bool) -> Parser t (ChunkElem t)
158+satisfyElem p = Parser $ \t pos more lose succ ->
159+ case bufferElemAt (undefined :: t) pos t of
160+ Just (e, l) | p e -> succ t (pos + Pos l) more e
161+ | otherwise -> lose t pos more [] "satisfyElem"
162+ Nothing -> satisfySuspended p t pos more lose succ
163+{-# INLINE satisfyElem #-}
164+
165+-- | Concatenate a monoid after reversing its elements. Used to
166+-- glue together a series of textual chunks that have been accumulated
167+-- \"backwards\".
168+concatReverse :: Monoid m => [m] -> m
169+concatReverse [x] = x
170+concatReverse xs = mconcat (reverse xs)
171+{-# INLINE concatReverse #-}
Data/Attoparsec/Internal/Fhthagn.hsnew file+18
@@ -0,0 +1,18 @@
1+{-# LANGUAGE BangPatterns, Rank2Types, OverloadedStrings,
2+ RecordWildCards, MagicHash, UnboxedTuples #-}
3+
4+module Data.Attoparsec.Internal.Fhthagn
5+ (
6+ inlinePerformIO
7+ ) where
8+
9+import GHC.Base (realWorld#)
10+import GHC.IO (IO(IO))
11+
12+-- | Just like unsafePerformIO, but we inline it. Big performance gains as
13+-- it exposes lots of things to further inlining. /Very unsafe/. In
14+-- particular, you should do no memory allocation inside an
15+-- 'inlinePerformIO' block. On Hugs this is just @unsafePerformIO@.
16+inlinePerformIO :: IO a -> a
17+inlinePerformIO (IO m) = case m realWorld# of (# _, r #) -> r
18+{-# INLINE inlinePerformIO #-}
Data/Attoparsec/Internal/Types.hs+175−132
@@ -1,7 +1,8 @@
1−{-# LANGUAGE BangPatterns, Rank2Types, OverloadedStrings, RecordWildCards #-}
1+{-# LANGUAGE CPP, BangPatterns, GeneralizedNewtypeDeriving, OverloadedStrings,
2+ Rank2Types, RecordWildCards, TypeFamilies #-}
2-- |
3-- |
3-- Module : Data.Attoparsec.Internal.Types
4-- Module : Data.Attoparsec.Internal.Types
4−-- Copyright : Bryan O'Sullivan 2007-2011
5+-- Copyright : Bryan O'Sullivan 2007-2015
5-- License : BSD3
6-- License : BSD3
6--
7--
7-- Maintainer : bos@serpentine.com
8-- Maintainer : bos@serpentine.com
@@ -14,70 +15,82 @@
14module Data.Attoparsec.Internal.Types
15module Data.Attoparsec.Internal.Types
15 (
16 (
16 Parser(..)
17 Parser(..)
18+ , State
17 , Failure
19 , Failure
18 , Success
20 , Success
21+ , Pos(..)
19 , IResult(..)
22 , IResult(..)
20− , Input(..)
21− , Added(..)
22 , More(..)
23 , More(..)
23− , addS
24− , noAdds
25 , (<>)
24 , (<>)
25+ , Chunk(..)
26 ) where
26 ) where
27
27
28−import Control.Applicative (Alternative(..), Applicative(..), (<$>))
28+import Control.Applicative as App (Applicative(..), (<$>))
29+import Control.Applicative (Alternative(..))
29import Control.DeepSeq (NFData(rnf))
30import Control.DeepSeq (NFData(rnf))
30import Control.Monad (MonadPlus(..))
31import Control.Monad (MonadPlus(..))
32+import qualified Control.Monad.Fail as Fail (MonadFail(..))
31−import Data.Monoid (Monoid(..))
33+import Data.Monoid as Mon (Monoid(..))
34+import Data.Semigroup (Semigroup(..))
35+import Data.Word (Word8)
36+import Data.ByteString (ByteString)
37+import qualified Data.ByteString as BS
38+import Data.ByteString.Internal (w2c)
39+import Data.Text (Text)
40+import qualified Data.Text as Text
41+import Data.Text.Unsafe (Iter(..))
32−import Prelude hiding (getChar, take, takeWhile)
42+import Prelude hiding (succ)
43+import qualified Data.Attoparsec.ByteString.Buffer as B
44+import qualified Data.Attoparsec.Text.Buffer as T
33
45
46+newtype Pos = Pos { fromPos :: Int }
47+ deriving (Eq, Ord, Show, Num)
48+
34−-- | The result of a parse. This is parameterised over the type @t@
49+-- | The result of a parse. This is parameterised over the type @i@
35-- of string that was processed.
50-- of string that was processed.
36--
51--
37-- This type is an instance of 'Functor', where 'fmap' transforms the
52-- This type is an instance of 'Functor', where 'fmap' transforms the
38-- value in a 'Done' result.
53-- value in a 'Done' result.
54+data IResult i r =
39−data IResult t r = Fail t [String] String
55+ Fail i [String] String
40− -- ^ The parse failed. The 't' parameter is the
56+ -- ^ The parse failed. The @i@ parameter is the input that had
41− -- input that had not yet been consumed when the
57+ -- not yet been consumed when the failure occurred. The
42− -- failure occurred. The @[@'String'@]@ is a list of
43− -- contexts in which the error occurred. The
58+ -- @[@'String'@]@ is a list of contexts in which the error
44− -- 'String' is the message describing the error, if
59+ -- occurred. The 'String' is the message describing the error, if
45− -- any.
60+ -- any.
46− | Partial (t -> IResult t r)
61+ | Partial (i -> IResult i r)
47− -- ^ Supply this continuation with more input so that
62+ -- ^ Supply this continuation with more input so that the parser
48− -- the parser can resume. To indicate that no more
63+ -- can resume. To indicate that no more input is available, pass
49− -- input is available, use an empty string.
64+ -- an empty string to the continuation.
65+ --
66+ -- __Note__: if you get a 'Partial' result, do not call its
67+ -- continuation more than once.
50− | Done t r
68+ | Done i r
51− -- ^ The parse succeeded. The 't' parameter is the
69+ -- ^ The parse succeeded. The @i@ parameter is the input that had
52− -- input that had not yet been consumed (if any) when
70+ -- not yet been consumed (if any) when the parse succeeded.
53− -- the parse succeeded.
71+
54−
55−instance (Show t, Show r) => Show (IResult t r) where
72+instance (Show i, Show r) => Show (IResult i r) where
56− show (Fail t stk msg) =
73+ showsPrec d ir = showParen (d > 10) $
57− "Fail " ++ show t ++ " " ++ show stk ++ " " ++ show msg
74+ case ir of
75+ (Fail t stk msg) -> showString "Fail" . f t . f stk . f msg
58− show (Partial _) = "Partial _"
76+ (Partial _) -> showString "Partial _"
59− show (Done t r) = "Done " ++ show t ++ " " ++ show r
77+ (Done t r) -> showString "Done" . f t . f r
60−
78+ where f :: Show a => a -> ShowS
79+ f x = showChar ' ' . showsPrec 11 x
80+
61−instance (NFData t, NFData r) => NFData (IResult t r) where
81+instance (NFData i, NFData r) => NFData (IResult i r) where
62 rnf (Fail t stk msg) = rnf t `seq` rnf stk `seq` rnf msg
82 rnf (Fail t stk msg) = rnf t `seq` rnf stk `seq` rnf msg
63 rnf (Partial _) = ()
83 rnf (Partial _) = ()
64 rnf (Done t r) = rnf t `seq` rnf r
84 rnf (Done t r) = rnf t `seq` rnf r
65 {-# INLINE rnf #-}
85 {-# INLINE rnf #-}
66
86
67−fmapR :: (a -> b) -> IResult t a -> IResult t b
87+instance Functor (IResult i) where
68−fmapR _ (Fail t stk msg) = Fail t stk msg
88+ fmap _ (Fail t stk msg) = Fail t stk msg
69−fmapR f (Partial k) = Partial (fmapR f . k)
89+ fmap f (Partial k) = Partial (fmap f . k)
70−fmapR f (Done t r) = Done t (f r)
90+ fmap f (Done t r) = Done t (f r)
71
91
72−instance Functor (IResult t) where
73− fmap = fmapR
74− {-# INLINE fmap #-}
75−
76−newtype Input t = I {unI :: t}
77−newtype Added t = A {unA :: t}
78−
79−-- | The core parser type. This is parameterised over the type @t@ of
92+-- | The core parser type. This is parameterised over the type @i@
80−-- string being processed.
93+-- of string being processed.
81--
94--
82-- This type is an instance of the following classes:
95-- This type is an instance of the following classes:
83--
96--
@@ -90,121 +103,115 @@ newtype Added t = A {unA :: t}
90-- 'mplus' executes the right-hand parser if the left-hand one
103-- 'mplus' executes the right-hand parser if the left-hand one
91-- fails. When the parser on the right executes, the input is reset
104-- fails. When the parser on the right executes, the input is reset
92-- to the same state as the parser on the left started with. (In
105-- to the same state as the parser on the left started with. (In
93−-- other words, Attoparsec is a backtracking parser that supports
106+-- other words, attoparsec is a backtracking parser that supports
94-- arbitrary lookahead.)
107-- arbitrary lookahead.)
95--
108--
96-- * 'Alternative', which follows 'MonadPlus'.
109-- * 'Alternative', which follows 'MonadPlus'.
97−newtype Parser t a = Parser {
110+newtype Parser i a = Parser {
98− runParser :: forall r. Input t -> Added t -> More
111+ runParser :: forall r.
112+ State i -> Pos -> More
99− -> Failure t r
113+ -> Failure i (State i) r
100− -> Success t a r
114+ -> Success i (State i) a r
101− -> IResult t r
115+ -> IResult i r
102 }
116 }
103
117
118+type family State i
119+type instance State ByteString = B.Buffer
120+type instance State Text = T.Buffer
121+
104−type Failure t r = Input t -> Added t -> More -> [String] -> String
122+type Failure i t r = t -> Pos -> More -> [String] -> String
105− -> IResult t r
123+ -> IResult i r
106−type Success t a r = Input t -> Added t -> More -> a -> IResult t r
124+type Success i t a r = t -> Pos -> More -> a -> IResult i r
107
125
108-- | Have we read all available input?
126-- | Have we read all available input?
109data More = Complete | Incomplete
127data More = Complete | Incomplete
110 deriving (Eq, Show)
128 deriving (Eq, Show)
111
129
112−addS :: (Monoid t) =>
130+instance Semigroup More where
113− Input t -> Added t -> More
131+ c@Complete <> _ = c
114− -> Input t -> Added t -> More
132+ _ <> m = m
115− -> (Input t -> Added t -> More -> r) -> r
133+
116−addS i0 a0 m0 _i1 a1 m1 f =
134+instance Mon.Monoid More where
117− let !i = I (unI i0 <> unA a1)
135+ mappend = (<>)
118− a = A (unA a0 <> unA a1)
119− !m = m0 <?> m1
120− in f i a m
121− where
122− Complete <?> _ = Complete
123− _ <?> Complete = Complete
124− _ <?> _ = Incomplete
136+ mempty = Incomplete
125−{-# INLINE addS #-}
137+
126−
127−bindP :: Parser t a -> (a -> Parser t b) -> Parser t b
128−bindP m g =
129− Parser $ \i0 a0 m0 kf ks -> runParser m i0 a0 m0 kf $
130− \i1 a1 m1 a -> runParser (g a) i1 a1 m1 kf ks
131−{-# INLINE bindP #-}
132−
133−returnP :: a -> Parser t a
134−returnP a = Parser (\i0 a0 m0 _kf ks -> ks i0 a0 m0 a)
135−{-# INLINE returnP #-}
136−
137−instance Monad (Parser t) where
138+instance Monad (Parser i) where
138− return = returnP
139+#if !(MIN_VERSION_base(4,13,0))
139− (>>=) = bindP
140+ fail = Fail.fail
140− fail = failDesc
141+ {-# INLINE fail #-}
141−
142+#endif
142−noAdds :: (Monoid t) =>
143+
143− Input t -> Added t -> More
144+ return = App.pure
144− -> (Input t -> Added t -> More -> r) -> r
145+ {-# INLINE return #-}
145−noAdds i0 _a0 m0 f = f i0 (A mempty) m0
146+
147+ m >>= k = Parser $ \t !pos more lose succ ->
148+ let succ' t' !pos' more' a = runParser (k a) t' pos' more' lose succ
149+ in runParser m t pos more lose succ'
150+ {-# INLINE (>>=) #-}
151+
152+ (>>) = (*>)
146−{-# INLINE noAdds #-}
153+ {-# INLINE (>>) #-}
147−
154+
148−plus :: (Monoid t) => Parser t a -> Parser t a -> Parser t a
155+
149−plus a b = Parser $ \i0 a0 m0 kf ks ->
156+instance Fail.MonadFail (Parser i) where
150− let kf' i1 a1 m1 _ _ = addS i0 a0 m0 i1 a1 m1 $
157+ fail err = Parser $ \t pos more lose _succ -> lose t pos more [] msg
151− \ i2 a2 m2 -> runParser b i2 a2 m2 kf ks
158+ where msg = "Failed reading: " ++ err
152− in noAdds i0 a0 m0 $ \i2 a2 m2 -> runParser a i2 a2 m2 kf' ks
159+ {-# INLINE fail #-}
153−{-# INLINE plus #-}
160+
154−
161+plus :: Parser i a -> Parser i a -> Parser i a
162+plus f g = Parser $ \t pos more lose succ ->
163+ let lose' t' _pos' more' _ctx _msg = runParser g t' pos more' lose succ
164+ in runParser f t pos more lose' succ
165+
155−instance (Monoid t) => MonadPlus (Parser t) where
166+instance MonadPlus (Parser i) where
156− mzero = failDesc "mzero"
167+ mzero = fail "mzero"
157 {-# INLINE mzero #-}
168 {-# INLINE mzero #-}
158 mplus = plus
169 mplus = plus
159
170
160−fmapP :: (a -> b) -> Parser t a -> Parser t b
161−fmapP p m = Parser $ \i0 a0 m0 f k ->
162− runParser m i0 a0 m0 f $ \i1 a1 s1 a -> k i1 a1 s1 (p a)
163−{-# INLINE fmapP #-}
164−
165−instance Functor (Parser t) where
171+instance Functor (Parser i) where
166− fmap = fmapP
172+ fmap f p = Parser $ \t pos more lose succ ->
173+ let succ' t' pos' more' a = succ t' pos' more' (f a)
174+ in runParser p t pos more lose succ'
167 {-# INLINE fmap #-}
175 {-# INLINE fmap #-}
168
176
169−apP :: Parser t (a -> b) -> Parser t a -> Parser t b
177+apP :: Parser i (a -> b) -> Parser i a -> Parser i b
170apP d e = do
178apP d e = do
171 b <- d
179 b <- d
172 a <- e
180 a <- e
173 return (b a)
181 return (b a)
174{-# INLINE apP #-}
182{-# INLINE apP #-}
175
183
176−instance Applicative (Parser t) where
184+instance Applicative (Parser i) where
177− pure = returnP
185+ pure v = Parser $ \t !pos more _lose succ -> succ t pos more v
178 {-# INLINE pure #-}
186 {-# INLINE pure #-}
179 (<*>) = apP
187 (<*>) = apP
180 {-# INLINE (<*>) #-}
188 {-# INLINE (<*>) #-}
181−
189+ m *> k = m >>= \_ -> k
182−#if MIN_VERSION_base(4,2,0)
183− -- These definitions are equal to the defaults, but this
184− -- way the optimizer doesn't have to work so hard to figure
185− -- that out.
186− (*>) = (>>)
187 {-# INLINE (*>) #-}
190 {-# INLINE (*>) #-}
188− x <* y = x >>= \a -> y >> return a
191+ x <* y = x >>= \a -> y >> pure a
189 {-# INLINE (<*) #-}
192 {-# INLINE (<*) #-}
190−#endif
191
193
194+instance Semigroup (Parser i a) where
195+ (<>) = plus
196+ {-# INLINE (<>) #-}
197+
192−instance (Monoid t) => Monoid (Parser t a) where
198+instance Monoid (Parser i a) where
193− mempty = failDesc "mempty"
199+ mempty = fail "mempty"
194 {-# INLINE mempty #-}
200 {-# INLINE mempty #-}
195− mappend = plus
201+ mappend = (<>)
196 {-# INLINE mappend #-}
202 {-# INLINE mappend #-}
197
203
198−instance (Monoid t) => Alternative (Parser t) where
204+instance Alternative (Parser i) where
199− empty = failDesc "empty"
205+ empty = fail "empty"
200 {-# INLINE empty #-}
206 {-# INLINE empty #-}
201
207
202 (<|>) = plus
208 (<|>) = plus
203 {-# INLINE (<|>) #-}
209 {-# INLINE (<|>) #-}
204
210
205 many v = many_v
211 many v = many_v
212+ where
206− where many_v = some_v <|> pure []
213+ many_v = some_v <|> pure []
207− some_v = (:) <$> v <*> many_v
214+ some_v = (:) <$> v <*> many_v
208 {-# INLINE many #-}
215 {-# INLINE many #-}
209
216
210 some v = some_v
217 some v = some_v
@@ -213,11 +220,47 @@ instance (Monoid t) => Alternative (Parser t) where
213 some_v = (:) <$> v <*> many_v
220 some_v = (:) <$> v <*> many_v
214 {-# INLINE some #-}
221 {-# INLINE some #-}
215
222
216−failDesc :: String -> Parser t a
223+-- | A common interface for input chunks.
217−failDesc err = Parser (\i0 a0 m0 kf _ks -> kf i0 a0 m0 [] msg)
224+class Monoid c => Chunk c where
218− where msg = "Failed reading: " ++ err
225+ type ChunkElem c
219−{-# INLINE failDesc #-}
226+ -- | Test if the chunk is empty.
227+ nullChunk :: c -> Bool
228+ -- | Append chunk to a buffer.
229+ pappendChunk :: State c -> c -> State c
230+ -- | Position at the end of a buffer. The first argument is ignored.
231+ atBufferEnd :: c -> State c -> Pos
232+ -- | Return the buffer element at the given position along with its length.
233+ bufferElemAt :: c -> Pos -> State c -> Maybe (ChunkElem c, Int)
234+ -- | Map an element to the corresponding character.
235+ -- The first argument is ignored.
236+ chunkElemToChar :: c -> ChunkElem c -> Char
237+
238+instance Chunk ByteString where
239+ type ChunkElem ByteString = Word8
240+ nullChunk = BS.null
241+ {-# INLINE nullChunk #-}
242+ pappendChunk = B.pappend
243+ {-# INLINE pappendChunk #-}
244+ atBufferEnd _ = Pos . B.length
245+ {-# INLINE atBufferEnd #-}
246+ bufferElemAt _ (Pos i) buf
247+ | i < B.length buf = Just (B.unsafeIndex buf i, 1)
248+ | otherwise = Nothing
249+ {-# INLINE bufferElemAt #-}
250+ chunkElemToChar _ = w2c
251+ {-# INLINE chunkElemToChar #-}
220
252
221−(<>) :: (Monoid m) => m -> m -> m
253+instance Chunk Text where
222−(<>) = mappend
254+ type ChunkElem Text = Char
255+ nullChunk = Text.null
256+ {-# INLINE nullChunk #-}
257+ pappendChunk = T.pappend
258+ {-# INLINE pappendChunk #-}
259+ atBufferEnd _ = Pos . T.length
260+ {-# INLINE atBufferEnd #-}
261+ bufferElemAt _ (Pos i) buf
262+ | i < T.length buf = let Iter c l = T.iter buf i in Just (c, l)
263+ | otherwise = Nothing
264+ {-# INLINE bufferElemAt #-}
265+ chunkElemToChar _ = id
223−{-# INLINE (<>) #-}
266+ {-# INLINE chunkElemToChar #-}
Data/Attoparsec/Lazy.hs+2−2
@@ -1,8 +1,8 @@
1-- |
1-- |
2-- Module : Data.Attoparsec.Lazy
2-- Module : Data.Attoparsec.Lazy
3−-- Copyright : Bryan O'Sullivan 2010
3+-- Copyright : Bryan O'Sullivan 2007-2015
4-- License : BSD3
4-- License : BSD3
5−--
5+--
6-- Maintainer : bos@serpentine.com
6-- Maintainer : bos@serpentine.com
7-- Stability : experimental
7-- Stability : experimental
8-- Portability : unknown
8-- Portability : unknown
Data/Attoparsec/Number.hs+11−1
@@ -1,16 +1,22 @@
1{-# LANGUAGE DeriveDataTypeable #-}
1{-# LANGUAGE DeriveDataTypeable #-}
2-- |
2-- |
3-- Module : Data.Attoparsec.Number
3-- Module : Data.Attoparsec.Number
4−-- Copyright : Bryan O'Sullivan 2011
4+-- Copyright : Bryan O'Sullivan 2007-2015
5-- License : BSD3
5-- License : BSD3
6--
6--
7-- Maintainer : bos@serpentine.com
7-- Maintainer : bos@serpentine.com
8-- Stability : experimental
8-- Stability : experimental
9-- Portability : unknown
9-- Portability : unknown
10--
10--
11+-- This module is deprecated, and both the module and 'Number' type
12+-- will be removed in the next major release. Use the
13+-- <http://hackage.haskell.org/package/scientific scientific> package
14+-- and the 'Data.Scientific.Scientific' type instead.
15+--
11-- A simple number type, useful for parsing both exact and inexact
16-- A simple number type, useful for parsing both exact and inexact
12-- quantities without losing much precision.
17-- quantities without losing much precision.
13module Data.Attoparsec.Number
18module Data.Attoparsec.Number
19+ {-# DEPRECATED "This module will be removed in the next major release." #-}
14 (
20 (
15 Number(..)
21 Number(..)
16 ) where
22 ) where
@@ -22,9 +28,13 @@ import Data.Typeable (Typeable)
22
28
23-- | A numeric type that can represent integers accurately, and
29-- | A numeric type that can represent integers accurately, and
24-- floating point numbers to the precision of a 'Double'.
30-- floating point numbers to the precision of a 'Double'.
31+--
32+-- /Note/: this type is deprecated, and will be removed in the next
33+-- major release. Use the 'Data.Scientific.Scientific' type instead.
25data Number = I !Integer
34data Number = I !Integer
26 | D {-# UNPACK #-} !Double
35 | D {-# UNPACK #-} !Double
27 deriving (Typeable, Data)
36 deriving (Typeable, Data)
37+{-# DEPRECATED Number "Use Scientific instead." #-}
28
38
29instance Show Number where
39instance Show Number where
30 show (I a) = show a
40 show (I a) = show a
Data/Attoparsec/Text.hs+200−105
@@ -1,9 +1,14 @@
1−{-# LANGUAGE BangPatterns #-}
1+{-# LANGUAGE BangPatterns, CPP, FlexibleInstances, TypeSynonymInstances #-}
2+#if __GLASGOW_HASKELL__ >= 702
3+{-# LANGUAGE Trustworthy #-} -- Imports internal modules
4+#endif
5+{-# OPTIONS_GHC -fno-warn-warnings-deprecations #-}
6+
2-- |
7-- |
3-- Module : Data.Attoparsec.Text
8-- Module : Data.Attoparsec.Text
4−-- Copyright : Bryan O'Sullivan 2011
9+-- Copyright : Bryan O'Sullivan 2007-2015
5-- License : BSD3
10-- License : BSD3
6−--
11+--
7-- Maintainer : bos@serpentine.com
12-- Maintainer : bos@serpentine.com
8-- Stability : experimental
13-- Stability : experimental
9-- Portability : unknown
14-- Portability : unknown
@@ -26,6 +31,7 @@ module Data.Attoparsec.Text
26 Parser
31 Parser
27 , Result
32 , Result
28 , T.IResult(..)
33 , T.IResult(..)
34+ , I.compareResults
29
35
30 -- * Running parsers
36 -- * Running parsers
31 , parse
37 , parse
@@ -38,11 +44,6 @@ module Data.Attoparsec.Text
38 , maybeResult
44 , maybeResult
39 , eitherResult
45 , eitherResult
40
46
41− -- * Combinators
42− , (I.<?>)
43− , I.try
44− , module Data.Attoparsec.Combinator
45−
46 -- * Parsing individual characters
47 -- * Parsing individual characters
47 , I.char
48 , I.char
48 , I.anyChar
49 , I.anyChar
@@ -51,18 +52,37 @@ module Data.Attoparsec.Text
51 , I.satisfyWith
52 , I.satisfyWith
52 , I.skip
53 , I.skip
53
54
55+ -- ** Lookahead
56+ , I.peekChar
57+ , I.peekChar'
58+
59+ -- ** Special character parsers
60+ , digit
61+ , letter
62+ , space
63+
54 -- ** Character classes
64 -- ** Character classes
55 , I.inClass
65 , I.inClass
56 , I.notInClass
66 , I.notInClass
57
67
58 -- * Efficient string handling
68 -- * Efficient string handling
59 , I.string
69 , I.string
70+ , I.stringCI
71+ , I.asciiCI
72+ , skipSpace
60 , I.skipWhile
73 , I.skipWhile
74+ , I.scan
75+ , I.runScanner
61 , I.take
76 , I.take
62 , I.takeWhile
77 , I.takeWhile
63 , I.takeWhile1
78 , I.takeWhile1
64 , I.takeTill
79 , I.takeTill
65
80
81+ -- ** String combinators
82+ -- $specalt
83+ , (.*>)
84+ , (<*.)
85+
66 -- ** Consume all remaining input
86 -- ** Consume all remaining input
67 , I.takeText
87 , I.takeText
68 , I.takeLazyText
88 , I.takeLazyText
@@ -80,71 +100,99 @@ module Data.Attoparsec.Text
80 , Number(..)
100 , Number(..)
81 , number
101 , number
82 , rational
102 , rational
103+ , scientific
83
104
105+ -- * Combinators
106+ , try
107+ , (<?>)
108+ , choice
109+ , count
110+ , option
111+ , many'
112+ , many1
113+ , many1'
114+ , manyTill
115+ , manyTill'
116+ , sepBy
117+ , sepBy'
118+ , sepBy1
119+ , sepBy1'
120+ , skipMany
121+ , skipMany1
122+ , eitherP
123+ , I.match
84 -- * State observation and manipulation functions
124 -- * State observation and manipulation functions
85 , I.endOfInput
125 , I.endOfInput
86 , I.atEnd
126 , I.atEnd
87 ) where
127 ) where
88
128
129+#if !MIN_VERSION_base(4,8,0)
89−import Control.Applicative ((<$>), (*>), (<|>))
130+import Control.Applicative (pure, (*>), (<*), (<$>))
131+import Data.Word (Word)
132+#endif
133+import Control.Applicative ((<|>))
90import Data.Attoparsec.Combinator
134import Data.Attoparsec.Combinator
91import Data.Attoparsec.Number (Number(..))
135import Data.Attoparsec.Number (Number(..))
136+import Data.Scientific (Scientific)
137+import qualified Data.Scientific as Sci
92import Data.Attoparsec.Text.Internal (Parser, Result, parse, takeWhile1)
138import Data.Attoparsec.Text.Internal (Parser, Result, parse, takeWhile1)
93import Data.Bits (Bits, (.|.), shiftL)
139import Data.Bits (Bits, (.|.), shiftL)
94−import Data.Char (ord)
140+import Data.Char (isAlpha, isDigit, isSpace, ord)
95import Data.Int (Int8, Int16, Int32, Int64)
141import Data.Int (Int8, Int16, Int32, Int64)
96−import Data.Ratio ((%))
142+import Data.List (intercalate)
97import Data.Text (Text)
143import Data.Text (Text)
98−import Data.Word (Word8, Word16, Word32, Word64, Word)
144+import Data.Word (Word8, Word16, Word32, Word64)
145+import qualified Data.Attoparsec.Internal as I
99import qualified Data.Attoparsec.Internal.Types as T
146import qualified Data.Attoparsec.Internal.Types as T
100import qualified Data.Attoparsec.Text.Internal as I
147import qualified Data.Attoparsec.Text.Internal as I
101import qualified Data.Text as T
148import qualified Data.Text as T
102
149
103-- $parsec
150-- $parsec
104--
151--
105−-- Compared to Parsec 3, Attoparsec makes several tradeoffs. It is
152+-- Compared to Parsec 3, attoparsec makes several tradeoffs. It is
106-- not intended for, or ideal for, all possible uses.
153-- not intended for, or ideal for, all possible uses.
107--
154--
108−-- * While Attoparsec can consume input incrementally, Parsec cannot.
155+-- * While attoparsec can consume input incrementally, Parsec cannot.
109-- Incremental input is a huge deal for efficient and secure network
156-- Incremental input is a huge deal for efficient and secure network
110-- and system programming, since it gives much more control to users
157-- and system programming, since it gives much more control to users
111-- of the library over matters such as resource usage and the I/O
158-- of the library over matters such as resource usage and the I/O
112-- model to use.
159-- model to use.
113--
160--
114−-- * Much of the performance advantage of Attoparsec is gained via
161+-- * Much of the performance advantage of attoparsec is gained via
115-- high-performance parsers such as 'I.takeWhile' and 'I.string'.
162-- high-performance parsers such as 'I.takeWhile' and 'I.string'.
116-- If you use complicated combinators that return lists of
163-- If you use complicated combinators that return lists of
117-- characters, there is less performance difference between the two
164-- characters, there is less performance difference between the two
118-- libraries.
165-- libraries.
119--
166--
120−-- * Unlike Parsec 3, Attoparsec does not support being used as a
167+-- * Unlike Parsec 3, attoparsec does not support being used as a
121-- monad transformer.
168-- monad transformer.
122--
169--
123−-- * Attoparsec is specialised to deal only with strict 'Text'
170+-- * attoparsec is specialised to deal only with strict 'Text'
124-- input. Efficiency concerns rule out both lists and lazy text.
171-- input. Efficiency concerns rule out both lists and lazy text.
125-- The usual use for lazy text would be to allow consumption of very
172-- The usual use for lazy text would be to allow consumption of very
126-- large input without a large footprint. For this need,
173-- large input without a large footprint. For this need,
127−-- Attoparsec's incremental input provides an excellent substitute,
174+-- attoparsec's incremental input provides an excellent substitute,
128-- with much more control over when input takes place. If you must
175-- with much more control over when input takes place. If you must
129-- use lazy text, see the 'Lazy' module, which feeds lazy chunks to
176-- use lazy text, see the 'Lazy' module, which feeds lazy chunks to
130-- a regular parser.
177-- a regular parser.
131--
178--
132-- * Parsec parsers can produce more helpful error messages than
179-- * Parsec parsers can produce more helpful error messages than
133−-- Attoparsec parsers. This is a matter of focus: Attoparsec avoids
180+-- attoparsec parsers. This is a matter of focus: attoparsec avoids
134-- the extra book-keeping in favour of higher performance.
181-- the extra book-keeping in favour of higher performance.
135
182
136-- $incremental
183-- $incremental
137--
184--
138−-- Attoparsec supports incremental input, meaning that you can feed it
185+-- attoparsec supports incremental input, meaning that you can feed it
139-- a 'Text' that represents only part of the expected total amount
186-- a 'Text' that represents only part of the expected total amount
140-- of data to parse. If your parser reaches the end of a fragment of
187-- of data to parse. If your parser reaches the end of a fragment of
141-- input and could consume more input, it will suspend parsing and
188-- input and could consume more input, it will suspend parsing and
142-- return a 'T.Partial' continuation.
189-- return a 'T.Partial' continuation.
143--
190--
144-- Supplying the 'T.Partial' continuation with another string will
191-- Supplying the 'T.Partial' continuation with another string will
145−-- resume parsing at the point where it was suspended. You must be
192+-- resume parsing at the point where it was suspended, with the string
193+-- you supplied used as new input at the end of the existing
146−-- prepared for the result of the resumed parse to be another
194+-- input. You must be prepared for the result of the resumed parse to
147−-- 'Partial' continuation.
195+-- be another 'Partial' continuation.
148--
196--
149-- To indicate that you have no more input, supply the 'Partial'
197-- To indicate that you have no more input, supply the 'Partial'
150-- continuation with an 'T.empty' 'Text'.
198-- continuation with an 'T.empty' 'Text'.
@@ -156,12 +204,19 @@ import qualified Data.Text as T
156-- If you do not need support for incremental input, consider using
204-- If you do not need support for incremental input, consider using
157-- the 'I.parseOnly' function to run your parser. It will never
205-- the 'I.parseOnly' function to run your parser. It will never
158-- prompt for more input.
206-- prompt for more input.
207+--
208+-- /Note/: incremental input does /not/ imply that attoparsec will
209+-- release portions of its internal state for garbage collection as it
210+-- proceeds. Its internal representation is equivalent to a single
211+-- 'Text': if you feed incremental input to an a parser, it will
212+-- require memory proportional to the amount of input you supply.
213+-- (This is necessary to support arbitrary backtracking.)
159
214
160-- $performance
215-- $performance
161--
216--
162−-- If you write an Attoparsec-based parser carefully, it can be
217+-- If you write an attoparsec-based parser carefully, it can be
163−-- realistic to expect it to perform within a factor of 2 of a
218+-- realistic to expect it to perform similarly to a hand-rolled C
164−-- hand-rolled C parser (measuring megabytes parsed per second).
219+-- parser (measuring megabytes parsed per second).
165--
220--
166-- To actually achieve high performance, there are a few guidelines
221-- To actually achieve high performance, there are a few guidelines
167-- that it is useful to follow.
222-- that it is useful to follow.
@@ -182,14 +237,6 @@ import qualified Data.Text as T
182-- Make active use of benchmarking and profiling tools to measure,
237-- Make active use of benchmarking and profiling tools to measure,
183-- find the problems with, and improve the performance of your parser.
238-- find the problems with, and improve the performance of your parser.
184
239
185−-- | If a parser has returned a 'Partial' result, supply it with more
186−-- input.
187−feed :: Result r -> Text -> Result r
188−feed f@(T.Fail _ _ _) _ = f
189−feed (T.Partial k) d = k d
190−feed (T.Done bs r) d = T.Done (T.append bs d) r
191−{-# INLINE feed #-}
192−
193-- | Run a parser and print its result to standard output.
240-- | Run a parser and print its result to standard output.
194parseTest :: (Show a) => I.Parser a -> Text -> IO ()
241parseTest :: (Show a) => I.Parser a -> Text -> IO ()
195parseTest p s = print (parse p s)
242parseTest p s = print (parse p s)
@@ -219,9 +266,10 @@ maybeResult _ = Nothing
219-- | Convert a 'Result' value to an 'Either' value. A 'Partial' result
266-- | Convert a 'Result' value to an 'Either' value. A 'Partial' result
220-- is treated as failure.
267-- is treated as failure.
221eitherResult :: Result r -> Either String r
268eitherResult :: Result r -> Either String r
222−eitherResult (T.Done _ r) = Right r
269+eitherResult (T.Done _ r) = Right r
223−eitherResult (T.Fail _ _ msg) = Left msg
270+eitherResult (T.Fail _ [] msg) = Left msg
271+eitherResult (T.Fail _ ctxs msg) = Left (intercalate " > " ctxs ++ ": " ++ msg)
224−eitherResult _ = Left "Result: incomplete input"
272+eitherResult _ = Left "Result: incomplete input"
225
273
226-- | A predicate that matches either a carriage return @\'\\r\'@ or
274-- | A predicate that matches either a carriage return @\'\\r\'@ or
227-- newline @\'\\n\'@ character.
275-- newline @\'\\n\'@ character.
@@ -263,7 +311,7 @@ hexadecimal = T.foldl' step 0 `fmap` takeWhile1 isHexDigit
263
311
264-- | Parse and decode an unsigned decimal number.
312-- | Parse and decode an unsigned decimal number.
265decimal :: Integral a => Parser a
313decimal :: Integral a => Parser a
266−decimal = T.foldl' step 0 `fmap` takeWhile1 isDigit
314+decimal = T.foldl' step 0 `fmap` takeWhile1 isDecimal
267 where step a c = a * 10 + fromIntegral (ord c - 48)
315 where step a c = a * 10 + fromIntegral (ord c - 48)
268{-# SPECIALISE decimal :: Parser Int #-}
316{-# SPECIALISE decimal :: Parser Int #-}
269{-# SPECIALISE decimal :: Parser Int8 #-}
317{-# SPECIALISE decimal :: Parser Int8 #-}
@@ -277,9 +325,9 @@ decimal = T.foldl' step 0 `fmap` takeWhile1 isDigit
277{-# SPECIALISE decimal :: Parser Word32 #-}
325{-# SPECIALISE decimal :: Parser Word32 #-}
278{-# SPECIALISE decimal :: Parser Word64 #-}
326{-# SPECIALISE decimal :: Parser Word64 #-}
279
327
280−isDigit :: Char -> Bool
328+isDecimal :: Char -> Bool
281−isDigit c = c >= '0' && c <= '9'
329+isDecimal c = c >= '0' && c <= '9'
282−{-# INLINE isDigit #-}
330+{-# INLINE isDecimal #-}
283
331
284-- | Parse a number with an optional leading @\'+\'@ or @\'-\'@ sign
332-- | Parse a number with an optional leading @\'+\'@ or @\'-\'@ sign
285-- character.
333-- character.
@@ -294,6 +342,24 @@ signed p = (negate <$> (I.char '-' *> p))
294 <|> (I.char '+' *> p)
342 <|> (I.char '+' *> p)
295 <|> p
343 <|> p
296
344
345+-- | Parse a rational number.
346+--
347+-- The syntax accepted by this parser is the same as for 'double'.
348+--
349+-- /Note/: this parser is not safe for use with inputs from untrusted
350+-- sources. An input with a suitably large exponent such as
351+-- @"1e1000000000"@ will cause a huge 'Integer' to be allocated,
352+-- resulting in what is effectively a denial-of-service attack.
353+--
354+-- In most cases, it is better to use 'double' or 'scientific'
355+-- instead.
356+rational :: Fractional a => Parser a
357+{-# SPECIALIZE rational :: Parser Double #-}
358+{-# SPECIALIZE rational :: Parser Float #-}
359+{-# SPECIALIZE rational :: Parser Rational #-}
360+{-# SPECIALIZE rational :: Parser Scientific #-}
361+rational = scientifically realToFrac
362+
297-- | Parse a rational number.
363-- | Parse a rational number.
298--
364--
299-- This parser accepts an optional leading sign character, followed by
365-- This parser accepts an optional leading sign character, followed by
@@ -308,7 +374,7 @@ signed p = (negate <$> (I.char '-' *> p))
308-- >rational "3.1" == Done 3.1 ""
374-- >rational "3.1" == Done 3.1 ""
309-- >rational "3e4" == Done 30000.0 ""
375-- >rational "3e4" == Done 30000.0 ""
310-- >rational "3.1e4" == Done 31000.0, ""
376-- >rational "3.1e4" == Done 31000.0, ""
311−
377+--
312-- Examples with behaviour identical to 'read':
378-- Examples with behaviour identical to 'read':
313--
379--
314-- >rational ".3" == Fail "input does not start with a digit"
380-- >rational ".3" == Fail "input does not start with a digit"
@@ -321,78 +387,107 @@ signed p = (negate <$> (I.char '-' *> p))
321--
387--
322-- This function does not accept string representations of \"NaN\" or
388-- This function does not accept string representations of \"NaN\" or
323-- \"Infinity\".
389-- \"Infinity\".
324−rational :: Fractional a => Parser a
325−{-# SPECIALIZE rational :: Parser Double #-}
390+double :: Parser Double
326−{-# SPECIALIZE rational :: Parser Float #-}
391+double = scientifically Sci.toRealFloat
327−{-# SPECIALIZE rational :: Parser Rational #-}
328−rational = floaty $ \real frac fracDenom -> fromRational $
329− real % 1 + frac % fracDenom
330
392
331−-- | Parse a rational number.
393+-- | Parse a number, attempting to preserve both speed and precision.
332−--
333−-- The syntax accepted by this parser is the same as for 'rational'.
334−--
335−-- /Note/: This function is almost ten times faster than 'rational',
336−-- but is slightly less accurate.
337--
394--
338−-- The 'Double' type supports about 16 decimal places of accuracy.
395+-- The syntax accepted by this parser is the same as for 'double'.
339−-- For 94.2% of numbers, this function and 'rational' give identical
340−-- results, but for the remaining 5.8%, this function loses precision
341−-- around the 15th decimal place. For 0.001% of numbers, this
342−-- function will lose precision at the 13th or 14th decimal place.
343--
396--
344-- This function does not accept string representations of \"NaN\" or
397-- This function does not accept string representations of \"NaN\" or
345-- \"Infinity\".
398-- \"Infinity\".
346−double :: Parser Double
399+number :: Parser Number
347−double = floaty asDouble
400+number = scientifically $ \s ->
401+ let e = Sci.base10Exponent s
402+ c = Sci.coefficient s
403+ in if e >= 0
404+ then I (c * 10 ^ e)
405+ else D (Sci.toRealFloat s)
406+{-# DEPRECATED number "Use 'scientific' instead." #-}
407+
408+-- | Parse a scientific number.
409+--
410+-- The syntax accepted by this parser is the same as for 'double'.
411+scientific :: Parser Scientific
412+scientific = scientifically id
413+
414+-- A strict pair
415+data SP = SP !Integer {-# UNPACK #-}!Int
416+
417+{-# INLINE scientifically #-}
418+scientifically :: (Scientific -> a) -> Parser a
419+scientifically h = do
420+ !positive <- ((== '+') <$> I.satisfy (\c -> c == '-' || c == '+')) <|>
421+ pure True
348
422
349−asDouble :: Integer -> Integer -> Integer -> Double
423+ n <- decimal
350−asDouble real frac fracDenom =
351− fromIntegral real + fromIntegral frac / fromIntegral fracDenom
352−{-# INLINE asDouble #-}
353
424
354−-- | Parse a number, attempting to preserve both speed and precision.
425+ let f fracDigits = SP (T.foldl' step n fracDigits)
426+ (negate $ T.length fracDigits)
427+ step a c = a * 10 + fromIntegral (ord c - 48)
428+
429+ SP c e <- (I.satisfy (=='.') *> (f <$> I.takeWhile isDigit)) <|>
430+ pure (SP n 0)
431+
432+ let !signedCoeff | positive = c
433+ | otherwise = -c
434+
435+ (I.satisfy (\w -> w == 'e' || w == 'E') *>
436+ fmap (h . Sci.scientific signedCoeff . (e +)) (signed decimal)) <|>
437+ return (h $ Sci.scientific signedCoeff e)
438+
439+-- | Parse a single digit, as recognised by 'isDigit'.
440+digit :: Parser Char
441+digit = I.satisfy isDigit <?> "digit"
442+{-# INLINE digit #-}
443+
444+-- | Parse a letter, as recognised by 'isAlpha'.
445+letter :: Parser Char
446+letter = I.satisfy isAlpha <?> "letter"
447+{-# INLINE letter #-}
448+
449+-- | Parse a space character, as recognised by 'isSpace'.
450+space :: Parser Char
451+space = I.satisfy isSpace <?> "space"
452+{-# INLINE space #-}
453+
454+-- | Skip over white space.
455+skipSpace :: Parser ()
456+skipSpace = I.skipWhile isSpace
457+{-# INLINE skipSpace #-}
458+
459+-- $specalt
355--
460--
356−-- The syntax accepted by this parser is the same as for 'rational'.
461+-- If you enable the @OverloadedStrings@ language extension, you can
462+-- use the '*>' and '<*' combinators to simplify the common task of
463+-- matching a statically known string, then immediately parsing
464+-- something else.
357--
465--
358−-- /Note/: This function is almost ten times faster than 'rational'.
466+-- Instead of writing something like this:
359−-- On integral inputs, it gives perfectly accurate answers, and on
360−-- floating point inputs, it is slightly less accurate than
361−-- 'rational'.
362--
467--
363−-- This function does not accept string representations of \"NaN\" or
468+-- @
364−-- \"Infinity\".
469+--'I.string' \"foo\" '*>' wibble
365−number :: Parser Number
470+-- @
366−number = floaty $ \real frac fracDenom ->
471+--
367− if frac == 0 && fracDenom == 0
472+-- Using @OverloadedStrings@, you can omit the explicit use of
368− then I real
473+-- 'I.string', and write a more compact version:
369− else D (asDouble real frac fracDenom)
474+--
370−{-# INLINE number #-}
475+-- @
476+-- \"foo\" '*>' wibble
477+-- @
478+--
479+-- (Note: the '.*>' and '<*.' combinators that were originally
480+-- provided for this purpose are obsolete and unnecessary, and will be
481+-- removed in the next major version.)
371
482
372−data T = T !Integer !Int
483+-- | /Obsolete/. A type-specialized version of '*>' for 'Text'. Use
484+-- '*>' instead.
485+(.*>) :: Text -> Parser a -> Parser a
486+s .*> f = I.string s *> f
487+{-# DEPRECATED (.*>) "This is no longer necessary, and will be removed. Use '*>' instead." #-}
373
488
374−floaty :: Fractional a => (Integer -> Integer -> Integer -> a) -> Parser a
489+-- | /Obsolete/. A type-specialized version of '<*' for 'Text'. Use
375−{-# INLINE floaty #-}
490+-- '*>' instead.
376−floaty f = do
491+(<*.) :: Parser a -> Text -> Parser a
377− !positive <- ((== '+') <$> I.satisfy (\c -> c == '-' || c == '+')) <|>
492+f <*. s = f <* I.string s
378− return True
493+{-# DEPRECATED (<*.) "This is no longer necessary, and will be removed. Use '<*' instead." #-}
379− real <- decimal
380− let tryFraction = do
381− _ <- I.satisfy (=='.')
382− ds <- I.takeWhile isDigit
383− case I.parseOnly decimal ds of
384− Right n -> return $ T n (T.length ds)
385− _ -> fail "no digits after decimal"
386− T fraction fracDigits <- tryFraction <|> return (T 0 0)
387− let e c = c == 'e' || c == 'E'
388− power <- (I.satisfy e *> signed decimal) <|> return (0::Int)
389− let n = if fracDigits == 0
390− then if power == 0
391− then fromIntegral real
392− else fromIntegral real * (10 ^^ power)
393− else if power == 0
394− then f real fraction (10 ^ fracDigits)
395− else f real fraction (10 ^ fracDigits) * (10 ^^ power)
396− return $ if positive
397− then n
398− else -n
Data/Attoparsec/Text/Buffer.hsnew file+172
@@ -0,0 +1,172 @@
1+{-# LANGUAGE BangPatterns, CPP, MagicHash, RankNTypes, RecordWildCards,
2+ UnboxedTuples #-}
3+
4+-- |
5+-- Module : Data.Attoparsec.Text.Buffer
6+-- Copyright : Bryan O'Sullivan 2007-2015
7+-- License : BSD3
8+--
9+-- Maintainer : bos@serpentine.com
10+-- Stability : experimental
11+-- Portability : GHC
12+--
13+-- An immutable buffer that supports cheap appends.
14+
15+-- A Buffer is divided into an immutable read-only zone, followed by a
16+-- mutable area that we've preallocated, but not yet written to.
17+--
18+-- We overallocate at the end of a Buffer so that we can cheaply
19+-- append. Since a user of an existing Buffer cannot see past the end
20+-- of its immutable zone into the data that will change during an
21+-- append, this is safe.
22+--
23+-- Once we run out of space at the end of a Buffer, we do the usual
24+-- doubling of the buffer size.
25+
26+module Data.Attoparsec.Text.Buffer
27+ (
28+ Buffer
29+ , buffer
30+ , unbuffer
31+ , unbufferAt
32+ , length
33+ , pappend
34+ , iter
35+ , iter_
36+ , substring
37+ , dropWord16
38+ ) where
39+
40+import Control.Exception (assert)
41+import Data.Bits (shiftR)
42+import Data.List (foldl1')
43+import Data.Monoid as Mon (Monoid(..))
44+import Data.Semigroup (Semigroup(..))
45+import Data.Text ()
46+import Data.Text.Internal (Text(..))
47+import Data.Text.Internal.Encoding.Utf16 (chr2)
48+import Data.Text.Internal.Unsafe.Char (unsafeChr)
49+import Data.Text.Unsafe (Iter(..))
50+import Foreign.Storable (sizeOf)
51+import GHC.Base (Int(..), indexIntArray#, unsafeCoerce#, writeIntArray#)
52+import GHC.ST (ST(..), runST)
53+import Prelude hiding (length)
54+import qualified Data.Text.Array as A
55+
56+-- If _cap is zero, this buffer is empty.
57+data Buffer = Buf {
58+ _arr :: {-# UNPACK #-} !A.Array
59+ , _off :: {-# UNPACK #-} !Int
60+ , _len :: {-# UNPACK #-} !Int
61+ , _cap :: {-# UNPACK #-} !Int
62+ , _gen :: {-# UNPACK #-} !Int
63+ }
64+
65+instance Show Buffer where
66+ showsPrec p = showsPrec p . unbuffer
67+
68+-- | The initial 'Buffer' has no mutable zone, so we can avoid all
69+-- copies in the (hopefully) common case of no further input being fed
70+-- to us.
71+buffer :: Text -> Buffer
72+buffer (Text arr off len) = Buf arr off len len 0
73+
74+unbuffer :: Buffer -> Text
75+unbuffer (Buf arr off len _ _) = Text arr off len
76+
77+unbufferAt :: Int -> Buffer -> Text
78+unbufferAt s (Buf arr off len _ _) =
79+ assert (s >= 0 && s <= len) $
80+ Text arr (off+s) (len-s)
81+
82+instance Semigroup Buffer where
83+ (Buf _ _ _ 0 _) <> b = b
84+ a <> (Buf _ _ _ 0 _) = a
85+ buf <> (Buf arr off len _ _) = append buf arr off len
86+ {-# INLINE (<>) #-}
87+
88+instance Monoid Buffer where
89+ mempty = Buf A.empty 0 0 0 0
90+ {-# INLINE mempty #-}
91+
92+ mappend = (<>)
93+
94+ mconcat [] = Mon.mempty
95+ mconcat xs = foldl1' (<>) xs
96+
97+pappend :: Buffer -> Text -> Buffer
98+pappend (Buf _ _ _ 0 _) t = buffer t
99+pappend buf (Text arr off len) = append buf arr off len
100+
101+append :: Buffer -> A.Array -> Int -> Int -> Buffer
102+append (Buf arr0 off0 len0 cap0 gen0) !arr1 !off1 !len1 = runST $ do
103+ let woff = sizeOf (0::Int) `shiftR` 1
104+ newlen = len0 + len1
105+ !gen = if gen0 == 0 then 0 else readGen arr0
106+ if gen == gen0 && newlen <= cap0
107+ then do
108+ let newgen = gen + 1
109+ marr <- unsafeThaw arr0
110+ writeGen marr newgen
111+ A.copyI marr (off0+len0) arr1 off1 (off0+newlen)
112+ arr2 <- A.unsafeFreeze marr
113+ return (Buf arr2 off0 newlen cap0 newgen)
114+ else do
115+ let newcap = newlen * 2
116+ newgen = 1
117+ marr <- A.new (newcap + woff)
118+ writeGen marr newgen
119+ A.copyI marr woff arr0 off0 (woff+len0)
120+ A.copyI marr (woff+len0) arr1 off1 (woff+newlen)
121+ arr2 <- A.unsafeFreeze marr
122+ return (Buf arr2 woff newlen newcap newgen)
123+
124+length :: Buffer -> Int
125+length (Buf _ _ len _ _) = len
126+{-# INLINE length #-}
127+
128+substring :: Int -> Int -> Buffer -> Text
129+substring s l (Buf arr off len _ _) =
130+ assert (s >= 0 && s <= len) .
131+ assert (l >= 0 && l <= len-s) $
132+ Text arr (off+s) l
133+{-# INLINE substring #-}
134+
135+dropWord16 :: Int -> Buffer -> Text
136+dropWord16 s (Buf arr off len _ _) =
137+ assert (s >= 0 && s <= len) $
138+ Text arr (off+s) (len-s)
139+{-# INLINE dropWord16 #-}
140+
141+-- | /O(1)/ Iterate (unsafely) one step forwards through a UTF-16
142+-- array, returning the current character and the delta to add to give
143+-- the next offset to iterate at.
144+iter :: Buffer -> Int -> Iter
145+iter (Buf arr off _ _ _) i
146+ | m < 0xD800 || m > 0xDBFF = Iter (unsafeChr m) 1
147+ | otherwise = Iter (chr2 m n) 2
148+ where m = A.unsafeIndex arr j
149+ n = A.unsafeIndex arr k
150+ j = off + i
151+ k = j + 1
152+{-# INLINE iter #-}
153+
154+-- | /O(1)/ Iterate one step through a UTF-16 array, returning the
155+-- delta to add to give the next offset to iterate at.
156+iter_ :: Buffer -> Int -> Int
157+iter_ (Buf arr off _ _ _) i | m < 0xD800 || m > 0xDBFF = 1
158+ | otherwise = 2
159+ where m = A.unsafeIndex arr (off+i)
160+{-# INLINE iter_ #-}
161+
162+unsafeThaw :: A.Array -> ST s (A.MArray s)
163+unsafeThaw A.Array{..} = ST $ \s# ->
164+ (# s#, A.MArray (unsafeCoerce# aBA) #)
165+
166+readGen :: A.Array -> Int
167+readGen a = case indexIntArray# (A.aBA a) 0# of r# -> I# r#
168+
169+writeGen :: A.MArray s -> Int -> ST s ()
170+writeGen a (I# gen#) = ST $ \s0# ->
171+ case writeIntArray# (A.maBA a) 0# gen# s0# of
172+ s1# -> (# s1#, () #)
Data/Attoparsec/Text/FastSet.hs+85−27
@@ -1,16 +1,20 @@
1−-----------------------------------------------------------------------------
1+{-# LANGUAGE BangPatterns #-}
2+
3+------------------------------------------------------------------------------
2-- |
4-- |
3-- Module : Data.Attoparsec.FastSet
5-- Module : Data.Attoparsec.FastSet
4−-- Copyright : Felipe Lessa 2010, Bryan O'Sullivan 2008
6+-- Copyright : Felipe Lessa 2010, Bryan O'Sullivan 2007-2015
5-- License : BSD3
7-- License : BSD3
6--
8--
7-- Maintainer : felipe.lessa@gmail.com
9-- Maintainer : felipe.lessa@gmail.com
8-- Stability : experimental
10-- Stability : experimental
9-- Portability : unknown
11-- Portability : unknown
10--
12--
11−-- Fast set membership tests for 'Char' values. The set
13+-- Fast set membership tests for 'Char' values. We test for
14+-- membership using a hashtable implemented with Robin Hood
12−-- representation is unboxed for efficiency. We test for
15+-- collision resolution. The set representation is unboxed,
13−-- membership using a binary search.
16+-- and the characters and hashes interleaved, for efficiency.
17+--
14--
18--
15-----------------------------------------------------------------------------
19-----------------------------------------------------------------------------
16module Data.Attoparsec.Text.FastSet
20module Data.Attoparsec.Text.FastSet
@@ -26,38 +30,92 @@ module Data.Attoparsec.Text.FastSet
26 , charClass
30 , charClass
27 ) where
31 ) where
28
32
29−import Data.List (sort)
33+import Data.Bits ((.|.), (.&.), shiftR)
34+import Data.Function (on)
35+import Data.List (sort, sortBy)
30import qualified Data.Array.Base as AB
36import qualified Data.Array.Base as AB
31import qualified Data.Array.Unboxed as A
37import qualified Data.Array.Unboxed as A
32import qualified Data.Text as T
38import qualified Data.Text as T
33
39
34−newtype FastSet = FastSet (A.UArray Int Char)
40+data FastSet = FastSet {
35− deriving (Eq, Ord, Show)
41+ table :: {-# UNPACK #-} !(A.UArray Int Int)
42+ , mask :: {-# UNPACK #-} !Int
43+ }
36
44
37−-- | Create a set.
45+data Entry = Entry {
38−set :: T.Text -> FastSet
46+ key :: {-# UNPACK #-} !Char
39−set t = mkSet (T.length t) (sort $ T.unpack t)
47+ , initialIndex :: {-# UNPACK #-} !Int
48+ , index :: {-# UNPACK #-} !Int
49+ }
50+
51+offset :: Entry -> Int
52+offset e = index e - initialIndex e
53+
54+resolveCollisions :: [Entry] -> [Entry]
55+resolveCollisions [] = []
56+resolveCollisions [e] = [e]
57+resolveCollisions (a:b:entries) = a' : resolveCollisions (b' : entries)
58+ where (a', b')
59+ | index a < index b = (a, b)
60+ | offset a < offset b = (b { index=index a }, a { index=index a + 1 })
61+ | otherwise = (a, b { index=index a + 1 })
40
62
41−fromList :: [Char] -> FastSet
63+pad :: Int -> [Entry] -> [Entry]
42−fromList cs = mkSet (length cs) (sort cs)
64+pad = go 0
65+ where -- ensure that we pad enough so that lookups beyond the
66+ -- last hash in the table fall within the array
67+ go !_ !m [] = replicate (max 1 m + 1) empty
68+ go k m (e:entries) = map (const empty) [k..i - 1] ++ e :
69+ go (i + 1) (m + i - k - 1) entries
70+ where i = index e
71+ empty = Entry '\0' maxBound 0
43
72
44−mkSet :: Int -> [Char] -> FastSet
73+nextPowerOf2 :: Int -> Int
74+nextPowerOf2 0 = 1
75+nextPowerOf2 x = go (x - 1) 1
76+ where go y 32 = y + 1
77+ go y k = go (y .|. (y `shiftR` k)) $ k * 2
78+
79+fastHash :: Char -> Int
80+fastHash = fromEnum
81+
82+fromList :: String -> FastSet
45−mkSet l = FastSet . A.listArray (0,l-1)
83+fromList s = FastSet (AB.listArray (0, length interleaved - 1) interleaved)
84+ mask'
85+ where s' = ordNub (sort s)
86+ l = length s'
87+ mask' = nextPowerOf2 ((5 * l) `div` 4) - 1
88+ entries = pad mask' .
89+ resolveCollisions .
90+ sortBy (compare `on` initialIndex) .
91+ zipWith (\c i -> Entry c i i) s' .
92+ map ((.&. mask') . fastHash) $ s'
93+ interleaved = concatMap (\e -> [fromEnum $ key e, initialIndex e])
94+ entries
95+
96+ordNub :: Eq a => [a] -> [a]
97+ordNub [] = []
98+ordNub (y:ys) = go y ys
99+ where go x (z:zs)
100+ | x == z = go x zs
101+ | otherwise = x : go z zs
102+ go x [] = [x]
103+
104+set :: T.Text -> FastSet
105+set = fromList . T.unpack
46
106
47-- | Check the set for membership.
107-- | Check the set for membership.
48member :: Char -> FastSet -> Bool
108member :: Char -> FastSet -> Bool
49−member c (FastSet a) = uncurry search (A.bounds a)
109+member c a = go (2 * i)
50− where search lo hi
110+ where i = fastHash c .&. mask a
51− | hi < lo = False
111+ lookupAt j b = (i' <= i) && (c == c' || b)
52− | otherwise =
112+ where c' = toEnum $ AB.unsafeAt (table a) j
53− let mid = (lo + hi) `div` 2
113+ i' = AB.unsafeAt (table a) $ j + 1
54− in case compare c (AB.unsafeAt a mid) of
114+ go j = lookupAt j . lookupAt (j + 2) . lookupAt (j + 4) .
55− GT -> search (mid + 1) hi
115+ lookupAt (j + 6) . go $ j + 8
56− LT -> search lo (mid - 1)
57− _ -> True
58
116
59charClass :: String -> FastSet
117charClass :: String -> FastSet
60charClass = fromList . go
118charClass = fromList . go
61− where go (a:'-':b:xs) = [a..b] ++ go xs
119+ where go (a:'-':b:xs) = [a..b] ++ go xs
62− go (x:xs) = x : go xs
120+ go (x:xs) = x : go xs
63− go _ = ""
121+ go _ = ""
Data/Attoparsec/Text/Internal.hs+322−175
@@ -1,14 +1,16 @@
1−{-# LANGUAGE BangPatterns, Rank2Types, OverloadedStrings, RecordWildCards #-}
1+{-# LANGUAGE BangPatterns, FlexibleInstances, GADTs, OverloadedStrings,
2+ Rank2Types, RecordWildCards, TypeFamilies, TypeSynonymInstances #-}
3+{-# OPTIONS_GHC -fno-warn-orphans #-}
2-- |
4-- |
3-- Module : Data.Attoparsec.Text.Internal
5-- Module : Data.Attoparsec.Text.Internal
4−-- Copyright : Bryan O'Sullivan 2011
6+-- Copyright : Bryan O'Sullivan 2007-2015
5-- License : BSD3
7-- License : BSD3
6--
8--
7-- Maintainer : bos@serpentine.com
9-- Maintainer : bos@serpentine.com
8-- Stability : experimental
10-- Stability : experimental
9-- Portability : unknown
11-- Portability : unknown
10--
12--
11−-- Simple, efficient parser combinators for 'T.Text' strings, loosely
13+-- Simple, efficient parser combinators for 'Text' strings, loosely
12-- based on the Parsec library.
14-- based on the Parsec library.
13
15
14module Data.Attoparsec.Text.Internal
16module Data.Attoparsec.Text.Internal
@@ -22,8 +24,6 @@ module Data.Attoparsec.Text.Internal
22 , parseOnly
24 , parseOnly
23
25
24 -- * Combinators
26 -- * Combinators
25− , (<?>)
26− , try
27 , module Data.Attoparsec.Combinator
27 , module Data.Attoparsec.Combinator
28
28
29 -- * Parsing individual characters
29 -- * Parsing individual characters
@@ -34,6 +34,10 @@ module Data.Attoparsec.Text.Internal
34 , char
34 , char
35 , notChar
35 , notChar
36
36
37+ -- ** Lookahead
38+ , peekChar
39+ , peekChar'
40+
37 -- ** Character classes
41 -- ** Character classes
38 , inClass
42 , inClass
39 , notInClass
43 , notInClass
@@ -41,8 +45,11 @@ module Data.Attoparsec.Text.Internal
41 -- * Efficient string handling
45 -- * Efficient string handling
42 , skipWhile
46 , skipWhile
43 , string
47 , string
44− , stringTransform
48+ , stringCI
49+ , asciiCI
45 , take
50 , take
51+ , scan
52+ , runScanner
46 , takeWhile
53 , takeWhile
47 , takeWhile1
54 , takeWhile1
48 , takeTill
55 , takeTill
@@ -51,100 +58,38 @@ module Data.Attoparsec.Text.Internal
51 , takeText
58 , takeText
52 , takeLazyText
59 , takeLazyText
53
60
54− -- * State observation and manipulation functions
55− , endOfInput
56− , atEnd
57− , ensure
58−
59 -- * Utilities
61 -- * Utilities
60 , endOfLine
62 , endOfLine
63+ , endOfInput
64+ , match
65+ , atEnd
61 ) where
66 ) where
62
67
63−import Control.Applicative ((<|>), (<$>))
68+import Control.Applicative ((<|>), (<$>), pure, (*>))
64import Control.Monad (when)
69import Control.Monad (when)
65−import Data.Attoparsec.Combinator
70+import Data.Attoparsec.Combinator ((<?>))
71+import Data.Attoparsec.Internal
66−import Data.Attoparsec.Internal.Types hiding (Parser, Input, Added, Failure, Success)
72+import Data.Attoparsec.Internal.Types hiding (Parser, Failure, Success)
67−import Data.Text (Text)
73+import qualified Data.Attoparsec.Text.Buffer as Buf
74+import Data.Attoparsec.Text.Buffer (Buffer, buffer)
75+import Data.Char (isAsciiUpper, isAsciiLower, toUpper, toLower)
76+import Data.List (intercalate)
77+import Data.String (IsString(..))
78+import Data.Text.Internal (Text(..))
68−import Prelude hiding (getChar, take, takeWhile)
79+import Prelude hiding (getChar, succ, take, takeWhile)
69import qualified Data.Attoparsec.Internal.Types as T
80import qualified Data.Attoparsec.Internal.Types as T
70import qualified Data.Attoparsec.Text.FastSet as Set
81import qualified Data.Attoparsec.Text.FastSet as Set
71import qualified Data.Text as T
82import qualified Data.Text as T
72import qualified Data.Text.Lazy as L
83import qualified Data.Text.Lazy as L
84+import qualified Data.Text.Unsafe as T
73
85
74−type Parser a = T.Parser Text a
86+type Parser = T.Parser Text
75−type Result a = IResult Text a
87+type Result = IResult Text
76−type Input = T.Input Text
77−type Added = T.Added Text
78−type Failure r = T.Failure Text r
88+type Failure r = T.Failure Text Buffer r
79−type Success a r = T.Success Text a r
89+type Success a r = T.Success Text Buffer a r
80
90
81−-- | If at least @n@ characters of input are available, return the
91+instance (a ~ Text) => IsString (Parser a) where
82−-- current input, otherwise fail.
92+ fromString = string . T.pack
83−ensure :: Int -> Parser Text
84−ensure !n = T.Parser $ \i0 a0 m0 kf ks ->
85− if T.length (unI i0) >= n
86− then ks i0 a0 m0 (unI i0)
87− else runParser (demandInput >> ensure n) i0 a0 m0 kf ks
88−
89−-- | Ask for input. If we receive any, pass it to a success
90−-- continuation, otherwise to a failure continuation.
91−prompt :: Input -> Added -> More
92− -> (Input -> Added -> More -> Result r)
93− -> (Input -> Added -> More -> Result r)
94− -> Result r
95−prompt i0 a0 _m0 kf ks = Partial $ \s ->
96− if T.null s
97− then kf i0 a0 Complete
98− else ks (I (unI i0 <> s)) (A (unA a0 <> s)) Incomplete
99−
100−-- | Immediately demand more input via a 'Partial' continuation
101−-- result.
102−demandInput :: Parser ()
103−demandInput = T.Parser $ \i0 a0 m0 kf ks ->
104− if m0 == Complete
105− then kf i0 a0 m0 ["demandInput"] "not enough input"
106− else let kf' i a m = kf i a m ["demandInput"] "not enough input"
107− ks' i a m = ks i a m ()
108− in prompt i0 a0 m0 kf' ks'
109−
110−-- | This parser always succeeds. It returns 'True' if any input is
111−-- available either immediately or on demand, and 'False' if the end
112−-- of all input has been reached.
113−wantInput :: Parser Bool
114−wantInput = T.Parser $ \i0 a0 m0 _kf ks ->
115− case () of
116− _ | not (T.null (unI i0)) -> ks i0 a0 m0 True
117− | m0 == Complete -> ks i0 a0 m0 False
118− | otherwise -> let kf' i a m = ks i a m False
119− ks' i a m = ks i a m True
120− in prompt i0 a0 m0 kf' ks'
121−
122−get :: Parser Text
123−get = T.Parser $ \i0 a0 m0 _kf ks -> ks i0 a0 m0 (unI i0)
124−
125−put :: Text -> Parser ()
126−put s = T.Parser $ \_i0 a0 m0 _kf ks -> ks (I s) a0 m0 ()
127−
128−-- | Attempt a parse, and if it fails, rewind the input so that no
129−-- input appears to have been consumed.
130−--
131−-- This combinator is provided for compatibility with Parsec.
132−-- Attoparsec parsers always backtrack on failure.
133−try :: Parser a -> Parser a
134−try p = p
135−{-# INLINE try #-}
136−
137−unsafeHead :: Text -> Char
138−unsafeHead = T.head
139−
140−unsafeTail :: Text -> Text
141−unsafeTail = T.tail
142−
143−unsafeTake :: Int -> Text -> Text
144−unsafeTake = T.take
145−
146−unsafeDrop :: Int -> Text -> Text
147−unsafeDrop = T.drop
148
93
149-- | The parser @satisfy p@ succeeds for any character for which the
94-- | The parser @satisfy p@ succeeds for any character for which the
150-- predicate @p@ returns 'True'. Returns the character that is
95-- predicate @p@ returns 'True'. Returns the character that is
@@ -154,11 +99,12 @@ unsafeDrop = T.drop
154-- > where isDigit c = c >= '0' && c <= '9'
99-- > where isDigit c = c >= '0' && c <= '9'
155satisfy :: (Char -> Bool) -> Parser Char
100satisfy :: (Char -> Bool) -> Parser Char
156satisfy p = do
101satisfy p = do
157− s <- ensure 1
102+ (k,c) <- ensure 1
158− let w = unsafeHead s
103+ let !h = T.unsafeHead c
159− if p w
104+ if p h
160− then put (unsafeTail s) >> return w
105+ then advance k >> return h
161 else fail "satisfy"
106 else fail "satisfy"
107+{-# INLINE satisfy #-}
162
108
163-- | The parser @skip p@ succeeds for any character for which the
109-- | The parser @skip p@ succeeds for any character for which the
164-- predicate @p@ returns 'True'.
110-- predicate @p@ returns 'True'.
@@ -167,9 +113,9 @@ satisfy p = do
167-- > where isDigit c = c >= '0' && c <= '9'
113-- > where isDigit c = c >= '0' && c <= '9'
168skip :: (Char -> Bool) -> Parser ()
114skip :: (Char -> Bool) -> Parser ()
169skip p = do
115skip p = do
170− s <- ensure 1
116+ (k,s) <- ensure 1
171− if p (unsafeHead s)
117+ if p (T.unsafeHead s)
172− then put (unsafeTail s)
118+ then advance k
173 else fail "skip"
119 else fail "skip"
174
120
175-- | The parser @satisfyWith f p@ transforms a character, and succeeds
121-- | The parser @satisfyWith f p@ transforms a character, and succeeds
@@ -177,26 +123,25 @@ skip p = do
177-- parser returns the transformed character that was parsed.
123-- parser returns the transformed character that was parsed.
178satisfyWith :: (Char -> a) -> (a -> Bool) -> Parser a
124satisfyWith :: (Char -> a) -> (a -> Bool) -> Parser a
179satisfyWith f p = do
125satisfyWith f p = do
180− s <- ensure 1
126+ (k,s) <- ensure 1
181− let c = f (unsafeHead s)
127+ let c = f $! T.unsafeHead s
182 if p c
128 if p c
183− then put (unsafeTail s) >> return c
129+ then advance k >> return c
184 else fail "satisfyWith"
130 else fail "satisfyWith"
131+{-# INLINE satisfyWith #-}
185
132
186-- | Consume @n@ characters of input, but succeed only if the
133-- | Consume @n@ characters of input, but succeed only if the
187-- predicate returns 'True'.
134-- predicate returns 'True'.
188takeWith :: Int -> (Text -> Bool) -> Parser Text
135takeWith :: Int -> (Text -> Bool) -> Parser Text
189takeWith n p = do
136takeWith n p = do
190− s <- ensure n
137+ (k,s) <- ensure n
191− let h = unsafeTake n s
192− t = unsafeDrop n s
193− if p h
138+ if p s
194− then put t >> return h
139+ then advance k >> return s
195 else fail "takeWith"
140 else fail "takeWith"
196
141
197-- | Consume exactly @n@ characters of input.
142-- | Consume exactly @n@ characters of input.
198take :: Int -> Parser Text
143take :: Int -> Parser Text
199−take n = takeWith n (const True)
144+take n = takeWith (max n 0) (const True)
200{-# INLINE take #-}
145{-# INLINE take #-}
201
146
202-- | @string s@ parses a sequence of characters that identically match
147-- | @string s@ parses a sequence of characters that identically match
@@ -206,33 +151,95 @@ take n = takeWith n (const True)
206-- /Note/: The behaviour of this parser is different to that of the
151-- /Note/: The behaviour of this parser is different to that of the
207-- similarly-named parser in Parsec, as this one is all-or-nothing.
152-- similarly-named parser in Parsec, as this one is all-or-nothing.
208-- To illustrate the difference, the following parser will fail under
153-- To illustrate the difference, the following parser will fail under
209−-- Parsec given an input of @"for"@:
154+-- Parsec given an input of @\"for\"@:
210--
155--
211-- >string "foo" <|> string "for"
156-- >string "foo" <|> string "for"
212--
157--
213−-- The reason for its failure is that that the first branch is a
158+-- The reason for its failure is that the first branch is a
214-- partial match, and will consume the letters @\'f\'@ and @\'o\'@
159-- partial match, and will consume the letters @\'f\'@ and @\'o\'@
215−-- before failing. In Attoparsec, the above parser will /succeed/ on
160+-- before failing. In attoparsec, the above parser will /succeed/ on
216-- that input, because the failed first branch will consume nothing.
161-- that input, because the failed first branch will consume nothing.
217string :: Text -> Parser Text
162string :: Text -> Parser Text
218−string s = takeWith (T.length s) (==s)
163+string s = string_ (stringSuspended id) id s
219{-# INLINE string #-}
164{-# INLINE string #-}
220
165
221−stringTransform :: (Text -> Text) -> Text
166+string_ :: (forall r. Text -> Text -> Buffer -> Pos -> More
167+ -> Failure r -> Success Text r -> Result r)
168+ -> (Text -> Text)
222− -> Parser Text
169+ -> Text -> Parser Text
223−stringTransform f s = takeWith (T.length s) ((==f s) . f)
170+string_ suspended f s0 = T.Parser $ \t pos more lose succ ->
224−{-# INLINE stringTransform #-}
171+ let s = f s0
172+ ft = f (Buf.unbufferAt (fromPos pos) t)
173+ in case T.commonPrefixes s ft of
174+ Nothing
175+ | T.null s -> succ t pos more T.empty
176+ | T.null ft -> suspended s s t pos more lose succ
177+ | otherwise -> lose t pos more [] "string"
178+ Just (pfx,ssfx,tsfx)
179+ | T.null ssfx -> let l = Pos (T.lengthWord16 pfx)
180+ in succ t (pos + l) more (substring pos l t)
181+ | not (T.null tsfx) -> lose t pos more [] "string"
182+ | otherwise -> suspended s ssfx t pos more lose succ
183+{-# INLINE string_ #-}
184+
185+stringSuspended :: (Text -> Text)
186+ -> Text -> Text -> Buffer -> Pos -> More
187+ -> Failure r
188+ -> Success Text r
189+ -> Result r
190+stringSuspended f s000 s0 t0 pos0 more0 lose0 succ0 =
191+ runParser (demandInput_ >>= go) t0 pos0 more0 lose0 succ0
192+ where
193+ go s' = T.Parser $ \t pos more lose succ ->
194+ let s = f s'
195+ in case T.commonPrefixes s0 s of
196+ Nothing -> lose t pos more [] "string"
197+ Just (_pfx,ssfx,tsfx)
198+ | T.null ssfx -> let l = Pos (T.lengthWord16 s000)
199+ in succ t (pos + l) more (substring pos l t)
200+ | T.null tsfx -> stringSuspended f s000 ssfx t pos more lose succ
201+ | otherwise -> lose t pos more [] "string"
202+
203+-- | Satisfy a literal string, ignoring case.
204+--
205+-- Note: this function is currently quite inefficient. Unicode case
206+-- folding can change the length of a string (\"&#223;\" becomes
207+-- "ss"), which makes a simple, efficient implementation tricky. We
208+-- have (for now) chosen simplicity over efficiency.
209+stringCI :: Text -> Parser Text
210+stringCI s = go 0
211+ where
212+ go !n
213+ | n > T.length fs = fail "stringCI"
214+ | otherwise = do
215+ (k,t) <- ensure n
216+ if T.toCaseFold t == fs
217+ then advance k >> return t
218+ else go (n+1)
219+ fs = T.toCaseFold s
220+{-# INLINE stringCI #-}
221+{-# DEPRECATED stringCI "this is very inefficient, use asciiCI instead" #-}
222+
223+-- | Satisfy a literal string, ignoring case for characters in the ASCII range.
224+asciiCI :: Text -> Parser Text
225+asciiCI s = fmap fst $ match $ T.foldr ((*>) . asciiCharCI) (pure ()) s
226+{-# INLINE asciiCI #-}
227+
228+asciiCharCI :: Char -> Parser Char
229+asciiCharCI c
230+ | isAsciiUpper c = char c <|> char (toLower c)
231+ | isAsciiLower c = char c <|> char (toUpper c)
232+ | otherwise = char c
233+{-# INLINE asciiCharCI #-}
225
234
226-- | Skip past input for as long as the predicate returns 'True'.
235-- | Skip past input for as long as the predicate returns 'True'.
227skipWhile :: (Char -> Bool) -> Parser ()
236skipWhile :: (Char -> Bool) -> Parser ()
228skipWhile p = go
237skipWhile p = go
229 where
238 where
230 go = do
239 go = do
231− t <- T.dropWhile p <$> get
240+ t <- T.takeWhile p <$> get
232− put t
241+ continue <- inputSpansChunks (size t)
233− when (T.null t) $ do
234− input <- wantInput
235− when input go
242+ when continue go
236{-# INLINE skipWhile #-}
243{-# INLINE skipWhile #-}
237
244
238-- | Consume input as long as the predicate returns 'False'
245-- | Consume input as long as the predicate returns 'False'
@@ -242,8 +249,9 @@ skipWhile p = go
242-- predicate returns 'True' on the first character of input.
249-- predicate returns 'True' on the first character of input.
243--
250--
244-- /Note/: Because this parser does not fail, do not use it with
251-- /Note/: Because this parser does not fail, do not use it with
245−-- combinators such as 'many', because such parsers loop until a
252+-- combinators such as 'Control.Applicative.many', because such
246−-- failure occurs. Careless use will thus result in an infinite loop.
253+-- parsers loop until a failure occurs. Careless use will thus result
254+-- in an infinite loop.
247takeTill :: (Char -> Bool) -> Parser Text
255takeTill :: (Char -> Bool) -> Parser Text
248takeTill p = takeWhile (not . p)
256takeTill p = takeWhile (not . p)
249{-# INLINE takeTill #-}
257{-# INLINE takeTill #-}
@@ -255,21 +263,29 @@ takeTill p = takeWhile (not . p)
255-- predicate returns 'False' on the first character of input.
263-- predicate returns 'False' on the first character of input.
256--
264--
257-- /Note/: Because this parser does not fail, do not use it with
265-- /Note/: Because this parser does not fail, do not use it with
258−-- combinators such as 'many', because such parsers loop until a
266+-- combinators such as 'Control.Applicative.many', because such
259−-- failure occurs. Careless use will thus result in an infinite loop.
267+-- parsers loop until a failure occurs. Careless use will thus result
268+-- in an infinite loop.
260takeWhile :: (Char -> Bool) -> Parser Text
269takeWhile :: (Char -> Bool) -> Parser Text
261−takeWhile p = (T.concat . reverse) `fmap` go []
270+takeWhile p = do
271+ h <- T.takeWhile p <$> get
272+ continue <- inputSpansChunks (size h)
273+ -- only use slow concat path if necessary
274+ if continue
275+ then takeWhileAcc p [h]
276+ else return h
277+{-# INLINE takeWhile #-}
278+
279+takeWhileAcc :: (Char -> Bool) -> [Text] -> Parser Text
280+takeWhileAcc p = go
262 where
281 where
263 go acc = do
282 go acc = do
264− (h,t) <- T.span p <$> get
283+ h <- T.takeWhile p <$> get
265− put t
284+ continue <- inputSpansChunks (size h)
266− if T.null t
285+ if continue
267− then do
268− input <- wantInput
269− if input
270− then go (h:acc)
286+ then go (h:acc)
271− else return (h:acc)
287+ else return $ concatReverse (h:acc)
272− else return (h:acc)
288+{-# INLINE takeWhileAcc #-}
273
289
274takeRest :: Parser [Text]
290takeRest :: Parser [Text]
275takeRest = go []
291takeRest = go []
@@ -279,7 +295,7 @@ takeRest = go []
279 if input
295 if input
280 then do
296 then do
281 s <- get
297 s <- get
282− put T.empty
298+ advance (size s)
283 go (s:acc)
299 go (s:acc)
284 else return (reverse acc)
300 else return (reverse acc)
285
301
@@ -291,6 +307,51 @@ takeText = T.concat `fmap` takeRest
291takeLazyText :: Parser L.Text
307takeLazyText :: Parser L.Text
292takeLazyText = L.fromChunks `fmap` takeRest
308takeLazyText = L.fromChunks `fmap` takeRest
293
309
310+data Scan s = Continue s
311+ | Finished s {-# UNPACK #-} !Int Text
312+
313+scan_ :: (s -> [Text] -> Parser r) -> s -> (s -> Char -> Maybe s) -> Parser r
314+scan_ f s0 p = go [] s0
315+ where
316+ scanner s !n t =
317+ case T.uncons t of
318+ Just (c,t') -> case p s c of
319+ Just s' -> scanner s' (n+1) t'
320+ Nothing -> Finished s n t
321+ Nothing -> Continue s
322+ go acc s = do
323+ input <- get
324+ case scanner s 0 input of
325+ Continue s' -> do continue <- inputSpansChunks (size input)
326+ if continue
327+ then go (input : acc) s'
328+ else f s' (input : acc)
329+ Finished s' n t -> do advance (size input - size t)
330+ f s' (T.take n input : acc)
331+{-# INLINE scan_ #-}
332+
333+-- | A stateful scanner. The predicate consumes and transforms a
334+-- state argument, and each transformed state is passed to successive
335+-- invocations of the predicate on each character of the input until one
336+-- returns 'Nothing' or the input ends.
337+--
338+-- This parser does not fail. It will return an empty string if the
339+-- predicate returns 'Nothing' on the first character of input.
340+--
341+-- /Note/: Because this parser does not fail, do not use it with
342+-- combinators such as 'Control.Applicative.many', because such
343+-- parsers loop until a failure occurs. Careless use will thus result
344+-- in an infinite loop.
345+scan :: s -> (s -> Char -> Maybe s) -> Parser Text
346+scan = scan_ $ \_ chunks -> return $! concatReverse chunks
347+{-# INLINE scan #-}
348+
349+-- | Like 'scan', but generalized to return the final state of the
350+-- scanner.
351+runScanner :: s -> (s -> Char -> Maybe s) -> Parser (Text, s)
352+runScanner = scan_ $ \s xs -> let !sx = concatReverse xs in return (sx, s)
353+{-# INLINE runScanner #-}
354+
294-- | Consume input as long as the predicate returns 'True', and return
355-- | Consume input as long as the predicate returns 'True', and return
295-- the consumed input.
356-- the consumed input.
296--
357--
@@ -299,13 +360,16 @@ takeLazyText = L.fromChunks `fmap` takeRest
299-- 'True' or if there is no input left.
360-- 'True' or if there is no input left.
300takeWhile1 :: (Char -> Bool) -> Parser Text
361takeWhile1 :: (Char -> Bool) -> Parser Text
301takeWhile1 p = do
362takeWhile1 p = do
302− (`when` demandInput) =<< T.null <$> get
363+ (`when` demandInput) =<< endOfChunk
303− (h,t) <- T.span p <$> get
364+ h <- T.takeWhile p <$> get
365+ let size' = size h
304− when (T.null h) $ fail "takeWhile1"
366+ when (size' == 0) $ fail "takeWhile1"
305− put t
367+ advance size'
306− if T.null t
368+ eoc <- endOfChunk
307− then (h<>) `fmap` takeWhile p
369+ if eoc
370+ then takeWhileAcc p [h]
308 else return h
371 else return h
372+{-# INLINE takeWhile1 #-}
309
373
310-- | Match any character in a set.
374-- | Match any character in a set.
311--
375--
@@ -343,60 +407,143 @@ notChar :: Char -> Parser Char
343notChar c = satisfy (/= c) <?> "not " ++ show c
407notChar c = satisfy (/= c) <?> "not " ++ show c
344{-# INLINE notChar #-}
408{-# INLINE notChar #-}
345
409
346−-- | Match only if all input has been consumed.
410+-- | Match any character, to perform lookahead. Returns 'Nothing' if
347−endOfInput :: Parser ()
411+-- end of input has been reached. Does not consume any input.
348−endOfInput = T.Parser $ \i0 a0 m0 kf ks ->
412+--
349− if T.null (unI i0)
413+-- /Note/: Because this parser does not fail, do not use it with
414+-- combinators such as 'Control.Applicative.many', because such
415+-- parsers loop until a failure occurs. Careless use will thus result
416+-- in an infinite loop.
417+peekChar :: Parser (Maybe Char)
418+peekChar = T.Parser $ \t pos more _lose succ ->
419+ case () of
420+ _| pos < lengthOf t ->
421+ let T.Iter !c _ = Buf.iter t (fromPos pos)
422+ in succ t pos more (Just c)
350− then if m0 == Complete
423+ | more == Complete ->
351− then ks i0 a0 m0 ()
424+ succ t pos more Nothing
352− else let kf' i1 a1 m1 _ _ = addS i0 a0 m0 i1 a1 m1 $
425+ | otherwise ->
353− \ i2 a2 m2 -> ks i2 a2 m2 ()
426+ let succ' t' pos' more' =
354− ks' i1 a1 m1 _ = addS i0 a0 m0 i1 a1 m1 $
427+ let T.Iter !c _ = Buf.iter t' (fromPos pos')
355− \ i2 a2 m2 -> kf i2 a2 m2 []
428+ in succ t' pos' more' (Just c)
356− "endOfInput"
429+ lose' t' pos' more' = succ t' pos' more' Nothing
357− in runParser demandInput i0 a0 m0 kf' ks'
430+ in prompt t pos more lose' succ'
358− else kf i0 a0 m0 [] "endOfInput"
431+{-# INLINE peekChar #-}
359−
432+
360−-- | Return an indication of whether the end of input has been
433+-- | Match any character, to perform lookahead. Does not consume any
361−-- reached.
434+-- input, but will fail if end of input has been reached.
362−atEnd :: Parser Bool
435+peekChar' :: Parser Char
363−atEnd = not <$> wantInput
436+peekChar' = do
437+ (_,s) <- ensure 1
438+ return $! T.unsafeHead s
364−{-# INLINE atEnd #-}
439+{-# INLINE peekChar' #-}
365
440
366-- | Match either a single newline character @\'\\n\'@, or a carriage
441-- | Match either a single newline character @\'\\n\'@, or a carriage
367-- return followed by a newline character @\"\\r\\n\"@.
442-- return followed by a newline character @\"\\r\\n\"@.
368endOfLine :: Parser ()
443endOfLine :: Parser ()
369endOfLine = (char '\n' >> return ()) <|> (string "\r\n" >> return ())
444endOfLine = (char '\n' >> return ()) <|> (string "\r\n" >> return ())
370
445
371−--- | Name the parser, in case failure occurs.
372−(<?>) :: Parser a
373− -> String -- ^ the name to use if parsing fails
374− -> Parser a
375−p <?> msg0 = T.Parser $ \i0 a0 m0 kf ks ->
376− let kf' i a m strs msg = kf i a m (msg0:strs) msg
377− in runParser p i0 a0 m0 kf' ks
378−{-# INLINE (<?>) #-}
379−infix 0 <?>
380−
381-- | Terminal failure continuation.
446-- | Terminal failure continuation.
382failK :: Failure a
447failK :: Failure a
383−failK i0 _a0 _m0 stack msg = Fail (unI i0) stack msg
448+failK t (Pos pos) _more stack msg = Fail (Buf.dropWord16 pos t) stack msg
384{-# INLINE failK #-}
449{-# INLINE failK #-}
385
450
386-- | Terminal success continuation.
451-- | Terminal success continuation.
387successK :: Success a a
452successK :: Success a a
388−successK i0 _a0 _m0 a = Done (unI i0) a
453+successK t (Pos pos) _more a = Done (Buf.dropWord16 pos t) a
389{-# INLINE successK #-}
454{-# INLINE successK #-}
390
455
391-- | Run a parser.
456-- | Run a parser.
392parse :: Parser a -> Text -> Result a
457parse :: Parser a -> Text -> Result a
393−parse m s = runParser m (I s) (A T.empty) Incomplete failK successK
458+parse m s = runParser m (buffer s) 0 Incomplete failK successK
394{-# INLINE parse #-}
459{-# INLINE parse #-}
395
460
396-- | Run a parser that cannot be resupplied via a 'Partial' result.
461-- | Run a parser that cannot be resupplied via a 'Partial' result.
462+--
463+-- This function does not force a parser to consume all of its input.
464+-- Instead, any residual input will be discarded. To force a parser
465+-- to consume all of its input, use something like this:
466+--
467+-- @
468+--'parseOnly' (myParser 'Control.Applicative.<*' 'endOfInput')
469+-- @
397parseOnly :: Parser a -> Text -> Either String a
470parseOnly :: Parser a -> Text -> Either String a
398−parseOnly m s = case runParser m (I s) (A T.empty) Complete failK successK of
471+parseOnly m s = case runParser m (buffer s) 0 Complete failK successK of
472+ Fail _ [] err -> Left err
399− Fail _ _ err -> Left err
473+ Fail _ ctxs err -> Left (intercalate " > " ctxs ++ ": " ++ err)
400− Done _ a -> Right a
474+ Done _ a -> Right a
401− _ -> error "parseOnly: impossible error!"
475+ _ -> error "parseOnly: impossible error!"
402{-# INLINE parseOnly #-}
476{-# INLINE parseOnly #-}
477+
478+get :: Parser Text
479+get = T.Parser $ \t pos more _lose succ ->
480+ succ t pos more (Buf.dropWord16 (fromPos pos) t)
481+{-# INLINE get #-}
482+
483+endOfChunk :: Parser Bool
484+endOfChunk = T.Parser $ \t pos more _lose succ ->
485+ succ t pos more (pos == lengthOf t)
486+{-# INLINE endOfChunk #-}
487+
488+inputSpansChunks :: Pos -> Parser Bool
489+inputSpansChunks i = T.Parser $ \t pos_ more _lose succ ->
490+ let pos = pos_ + i
491+ in if pos < lengthOf t || more == Complete
492+ then succ t pos more False
493+ else let lose' t' pos' more' = succ t' pos' more' False
494+ succ' t' pos' more' = succ t' pos' more' True
495+ in prompt t pos more lose' succ'
496+{-# INLINE inputSpansChunks #-}
497+
498+advance :: Pos -> Parser ()
499+advance n = T.Parser $ \t pos more _lose succ -> succ t (pos+n) more ()
500+{-# INLINE advance #-}
501+
502+ensureSuspended :: Int -> Buffer -> Pos -> More
503+ -> Failure r -> Success (Pos, Text) r
504+ -> Result r
505+ensureSuspended n t pos more lose succ =
506+ runParser (demandInput >> go) t pos more lose succ
507+ where go = T.Parser $ \t' pos' more' lose' succ' ->
508+ case lengthAtLeast pos' n t' of
509+ Just n' -> succ' t' pos' more' (n', substring pos n' t')
510+ Nothing -> runParser (demandInput >> go) t' pos' more' lose' succ'
511+
512+-- | If at least @n@ elements of input are available, return the
513+-- current input, otherwise fail.
514+ensure :: Int -> Parser (Pos, Text)
515+ensure n = T.Parser $ \t pos more lose succ ->
516+ case lengthAtLeast pos n t of
517+ Just n' -> succ t pos more (n', substring pos n' t)
518+ -- The uncommon case is kept out-of-line to reduce code size:
519+ Nothing -> ensureSuspended n t pos more lose succ
520+{-# INLINE ensure #-}
521+
522+-- | Return both the result of a parse and the portion of the input
523+-- that was consumed while it was being parsed.
524+match :: Parser a -> Parser (Text, a)
525+match p = T.Parser $ \t pos more lose succ ->
526+ let succ' t' pos' more' a = succ t' pos' more'
527+ (substring pos (pos'-pos) t', a)
528+ in runParser p t pos more lose succ'
529+
530+-- | Ensure that at least @n@ code points of input are available.
531+-- Returns the number of words consumed while traversing.
532+lengthAtLeast :: Pos -> Int -> Buffer -> Maybe Pos
533+lengthAtLeast pos n t = go 0 (fromPos pos)
534+ where go i !p
535+ | i == n = Just (Pos p - pos)
536+ | p == len = Nothing
537+ | otherwise = go (i+1) (p + Buf.iter_ t p)
538+ Pos len = lengthOf t
539+{-# INLINE lengthAtLeast #-}
540+
541+substring :: Pos -> Pos -> Buffer -> Text
542+substring (Pos pos) (Pos n) = Buf.substring pos n
543+{-# INLINE substring #-}
544+
545+lengthOf :: Buffer -> Pos
546+lengthOf = Pos . Buf.length
547+
548+size :: Text -> Pos
549+size (Text _ _ l) = Pos l
Data/Attoparsec/Text/Lazy.hs+26−15
@@ -1,13 +1,19 @@
1+{-# LANGUAGE CPP #-}
2+#if __GLASGOW_HASKELL__ >= 702
3+{-# LANGUAGE Trustworthy #-} -- Imports internal modules
4+#endif
5+
6+{-# OPTIONS_GHC -fno-warn-warnings-deprecations #-}
1-- |
7-- |
2-- Module : Data.Attoparsec.Text.Lazy
8-- Module : Data.Attoparsec.Text.Lazy
3−-- Copyright : Bryan O'Sullivan 2011
9+-- Copyright : Bryan O'Sullivan 2007-2015
4-- License : BSD3
10-- License : BSD3
5−--
11+--
6-- Maintainer : bos@serpentine.com
12-- Maintainer : bos@serpentine.com
7-- Stability : experimental
13-- Stability : experimental
8-- Portability : unknown
14-- Portability : unknown
9--
15--
10−-- Simple, efficient combinator parsing for lazy 'Text'
16+-- Simple, efficient combinator parsing that can consume lazy 'Text'
11-- strings, loosely based on the Parsec library.
17-- strings, loosely based on the Parsec library.
12--
18--
13-- This is essentially the same code as in the 'Data.Attoparsec.Text'
19-- This is essentially the same code as in the 'Data.Attoparsec.Text'
@@ -16,10 +22,11 @@
16-- more input to be fed in. Think of this as suitable for use with a
22-- more input to be fed in. Think of this as suitable for use with a
17-- lazily read file, e.g. via 'L.readFile' or 'L.hGetContents'.
23-- lazily read file, e.g. via 'L.readFile' or 'L.hGetContents'.
18--
24--
25+-- /Note:/ The various parser functions and combinators such as
26+-- 'string' still expect /strict/ 'T.Text' parameters, and return
19−-- Behind the scenes, strict 'T.Text' values are still used
27+-- strict 'T.Text' results. Behind the scenes, strict 'T.Text' values
20−-- internally to store parser input and manipulate it efficiently.
28+-- are still used internally to store parser input and manipulate it
21−-- High-performance parsers such as 'string' still expect strict
29+-- efficiently.
22−-- 'T.Text' parameters.
23
30
24module Data.Attoparsec.Text.Lazy
31module Data.Attoparsec.Text.Lazy
25 (
32 (
@@ -33,6 +40,8 @@ module Data.Attoparsec.Text.Lazy
33 , eitherResult
40 , eitherResult
34 ) where
41 ) where
35
42
43+import Control.DeepSeq (NFData(rnf))
44+import Data.List (intercalate)
36import Data.Text.Lazy.Internal (Text(..), chunk)
45import Data.Text.Lazy.Internal (Text(..), chunk)
37import qualified Data.Attoparsec.Internal.Types as T
46import qualified Data.Attoparsec.Internal.Types as T
38import qualified Data.Attoparsec.Text as A
47import qualified Data.Attoparsec.Text as A
@@ -42,20 +51,21 @@ import Data.Attoparsec.Text hiding (IResult(..), Result, eitherResult,
42
51
43-- | The result of a parse.
52-- | The result of a parse.
44data Result r = Fail Text [String] String
53data Result r = Fail Text [String] String
45− -- ^ The parse failed. The 'ByteString' is the input
54+ -- ^ The parse failed. The 'Text' is the input
46 -- that had not yet been consumed when the failure
55 -- that had not yet been consumed when the failure
47 -- occurred. The @[@'String'@]@ is a list of contexts
56 -- occurred. The @[@'String'@]@ is a list of contexts
48 -- in which the error occurred. The 'String' is the
57 -- in which the error occurred. The 'String' is the
49 -- message describing the error, if any.
58 -- message describing the error, if any.
50 | Done Text r
59 | Done Text r
51− -- ^ The parse succeeded. The 'ByteString' is the
60+ -- ^ The parse succeeded. The 'Text' is the
52 -- input that had not yet been consumed (if any) when
61 -- input that had not yet been consumed (if any) when
53 -- the parse succeeded.
62 -- the parse succeeded.
63+ deriving (Show)
54
64
55−instance Show r => Show (Result r) where
65+instance NFData r => NFData (Result r) where
56− show (Fail bs stk msg) =
66+ rnf (Fail bs ctxs msg) = rnf bs `seq` rnf ctxs `seq` rnf msg
57− "Fail " ++ show bs ++ " " ++ show stk ++ " " ++ show msg
67+ rnf (Done bs r) = rnf bs `seq` rnf r
58− show (Done bs r) = "Done " ++ show bs ++ " " ++ show r
68+ {-# INLINE rnf #-}
59
69
60fmapR :: (a -> b) -> Result a -> Result b
70fmapR :: (a -> b) -> Result a -> Result b
61fmapR _ (Fail st stk msg) = Fail st stk msg
71fmapR _ (Fail st stk msg) = Fail st stk msg
@@ -86,5 +96,6 @@ maybeResult _ = Nothing
86
96
87-- | Convert a 'Result' value to an 'Either' value.
97-- | Convert a 'Result' value to an 'Either' value.
88eitherResult :: Result r -> Either String r
98eitherResult :: Result r -> Either String r
89−eitherResult (Done _ r) = Right r
99+eitherResult (Done _ r) = Right r
90−eitherResult (Fail _ _ msg) = Left msg
100+eitherResult (Fail _ [] msg) = Left msg
101+eitherResult (Fail _ ctxs msg) = Left (intercalate " > " ctxs ++ ": " ++ msg)
Data/Attoparsec/Types.hs+3−2
@@ -1,6 +1,6 @@
1-- |
1-- |
2-- Module : Data.Attoparsec.Types
2-- Module : Data.Attoparsec.Types
3−-- Copyright : Bryan O'Sullivan 2011
3+-- Copyright : Bryan O'Sullivan 2007-2015
4-- License : BSD3
4-- License : BSD3
5--
5--
6-- Maintainer : bos@serpentine.com
6-- Maintainer : bos@serpentine.com
@@ -14,6 +14,7 @@ module Data.Attoparsec.Types
14 (
14 (
15 Parser
15 Parser
16 , IResult(..)
16 , IResult(..)
17+ , Chunk(chunkElemToChar)
17 ) where
18 ) where
18
19
19−import Data.Attoparsec.Internal.Types (Parser(..), IResult(..))
20+import Data.Attoparsec.Internal.Types (Parser(..), IResult(..), Chunk(..))
Data/Attoparsec/Zepto.hs+89−47
@@ -1,10 +1,14 @@
1−{-# LANGUAGE BangPatterns, MagicHash, UnboxedTuples #-}
1+{-# LANGUAGE CPP #-}
2+#if __GLASGOW_HASKELL__ >= 702
3+{-# LANGUAGE Trustworthy #-} -- Data.ByteString.Unsafe
4+#endif
5+{-# LANGUAGE BangPatterns #-}
2
6
3-- |
7-- |
4-- Module : Data.Attoparsec.Zepto
8-- Module : Data.Attoparsec.Zepto
5−-- Copyright : Bryan O'Sullivan 2011
9+-- Copyright : Bryan O'Sullivan 2007-2015
6-- License : BSD3
10-- License : BSD3
7−--
11+--
8-- Maintainer : bos@serpentine.com
12-- Maintainer : bos@serpentine.com
9-- Stability : experimental
13-- Stability : experimental
10-- Portability : unknown
14-- Portability : unknown
@@ -12,112 +16,150 @@
12-- A tiny, highly specialized combinator parser for 'B.ByteString'
16-- A tiny, highly specialized combinator parser for 'B.ByteString'
13-- strings.
17-- strings.
14--
18--
15−-- While the main Attoparsec module generally performs well, this
19+-- While the main attoparsec module generally performs well, this
16-- module is particularly fast for simple non-recursive loops that
20-- module is particularly fast for simple non-recursive loops that
17-- should not normally result in failed parses.
21-- should not normally result in failed parses.
18--
22--
19-- /Warning/: on more complex inputs involving recursion or failure,
23-- /Warning/: on more complex inputs involving recursion or failure,
20-- parsers based on this module may be as much as /ten times slower/
24-- parsers based on this module may be as much as /ten times slower/
21−-- than regular Attoparsec! You should /only/ use this module when you
25+-- than regular attoparsec! You should /only/ use this module when you
22-- have benchmarks that prove that its use speeds your code up.
26-- have benchmarks that prove that its use speeds your code up.
23module Data.Attoparsec.Zepto
27module Data.Attoparsec.Zepto
24 (
28 (
25 Parser
29 Parser
30+ , ZeptoT
26 , parse
31 , parse
32+ , parseT
27 , atEnd
33 , atEnd
28 , string
34 , string
29 , take
35 , take
30 , takeWhile
36 , takeWhile
31 ) where
37 ) where
32
38
33−import Data.Word (Word8)
34import Control.Applicative
39import Control.Applicative
35−import Control.Monad
40+import Control.Monad (MonadPlus(..), ap)
36−import Data.Monoid
37−import qualified Data.ByteString as B
41+import qualified Control.Monad.Fail as Fail
38−import qualified Data.ByteString.Unsafe as B
42+import Control.Monad.IO.Class (MonadIO(..))
39import Data.ByteString (ByteString)
43import Data.ByteString (ByteString)
44+import Data.Functor.Identity (Identity(runIdentity))
45+import Data.Monoid as Mon (Monoid(..))
46+import Data.Semigroup (Semigroup(..))
47+import Data.Word (Word8)
40import Prelude hiding (take, takeWhile)
48import Prelude hiding (take, takeWhile)
49+import qualified Data.ByteString as B
50+import qualified Data.ByteString.Unsafe as B
41
51
42newtype S = S {
52newtype S = S {
43 input :: ByteString
53 input :: ByteString
44 }
54 }
45
55
46data Result a = Fail String
56data Result a = Fail String
47− | OK !a
57+ | OK !a S
48
58
49-- | A simple parser.
59-- | A simple parser.
50--
60--
51-- This monad is strict in its state, and the monadic bind operator
61-- This monad is strict in its state, and the monadic bind operator
52-- ('>>=') evaluates each result to weak head normal form before
62-- ('>>=') evaluates each result to weak head normal form before
53-- passing it along.
63-- passing it along.
54−newtype Parser a = Parser {
64+newtype ZeptoT m a = Parser {
55− runParser :: S -> (# Result a, S #)
65+ runParser :: S -> m (Result a)
56 }
66 }
57
67
68+type Parser a = ZeptoT Identity a
69+
58−instance Functor Parser where
70+instance Monad m => Functor (ZeptoT m) where
59− fmap f m = Parser $ \s -> case runParser m s of
71+ fmap f m = Parser $ \s -> do
72+ result <- runParser m s
73+ case result of
60− (# OK a, s' #) -> (# OK (f a), s' #)
74+ OK a s' -> return (OK (f a) s')
61− (# Fail err, s' #) -> (# Fail err, s' #)
75+ Fail err -> return (Fail err)
62 {-# INLINE fmap #-}
76 {-# INLINE fmap #-}
63
77
64−instance Monad Parser where
78+instance MonadIO m => MonadIO (ZeptoT m) where
65− return a = Parser $ \s -> (# OK a, s #)
79+ liftIO act = Parser $ \s -> do
80+ result <- liftIO act
81+ return (OK result s)
82+ {-# INLINE liftIO #-}
83+
84+instance Monad m => Monad (ZeptoT m) where
85+ return = pure
66 {-# INLINE return #-}
86 {-# INLINE return #-}
67
87
68− m >>= k = Parser $ \s -> case runParser m s of
88+ m >>= k = Parser $ \s -> do
89+ result <- runParser m s
90+ case result of
69− (# OK a, s' #) -> runParser (k a) s'
91+ OK a s' -> runParser (k a) s'
70− (# Fail err, s' #) -> (# Fail err, s' #)
92+ Fail err -> return (Fail err)
71 {-# INLINE (>>=) #-}
93 {-# INLINE (>>=) #-}
72
94
95+#if !(MIN_VERSION_base(4,13,0))
73− fail msg = Parser $ \s -> (# Fail msg, s #)
96+ fail = Fail.fail
97+ {-# INLINE fail #-}
98+#endif
74
99
75−instance MonadPlus Parser where
100+instance Monad m => Fail.MonadFail (ZeptoT m) where
101+ fail msg = Parser $ \_ -> return (Fail msg)
102+ {-# INLINE fail #-}
103+
104+instance Monad m => MonadPlus (ZeptoT m) where
76 mzero = fail "mzero"
105 mzero = fail "mzero"
77 {-# INLINE mzero #-}
106 {-# INLINE mzero #-}
78
107
79− mplus a b = Parser $ \s ->
108+ mplus a b = Parser $ \s -> do
80− case runParser a s of
109+ result <- runParser a s
110+ case result of
81− (# ok@(OK _), s' #) -> (# ok, s' #)
111+ ok@(OK _ _) -> return ok
82− (# _, _ #) -> case runParser b s of
112+ _ -> runParser b s
83− (# ok@(OK _), s'' #) -> (# ok, s'' #)
84− (# err, s'' #) -> (# err, s'' #)
85 {-# INLINE mplus #-}
113 {-# INLINE mplus #-}
86
114
87−instance Applicative Parser where
115+instance (Monad m) => Applicative (ZeptoT m) where
88− pure = return
116+ pure a = Parser $ \s -> return (OK a s)
89 {-# INLINE pure #-}
117 {-# INLINE pure #-}
90 (<*>) = ap
118 (<*>) = ap
91 {-# INLINE (<*>) #-}
119 {-# INLINE (<*>) #-}
92
120
93−gets :: (S -> a) -> Parser a
121+gets :: Monad m => (S -> a) -> ZeptoT m a
94−gets f = Parser $ \s -> (# OK (f s), s #)
122+gets f = Parser $ \s -> return (OK (f s) s)
95{-# INLINE gets #-}
123{-# INLINE gets #-}
96
124
97−put :: S -> Parser ()
125+put :: Monad m => S -> ZeptoT m ()
98−put s = Parser $ \_ -> (# OK (), s #)
126+put s = Parser $ \_ -> return (OK () s)
99{-# INLINE put #-}
127{-# INLINE put #-}
100
128
101-- | Run a parser.
129-- | Run a parser.
102parse :: Parser a -> ByteString -> Either String a
130parse :: Parser a -> ByteString -> Either String a
103−parse p bs = case runParser p (S bs) of
131+parse p bs = case runIdentity (runParser p (S bs)) of
104− (# OK a, _ #) -> Right a
132+ (OK a _) -> Right a
105− (# Fail err, _ #) -> Left err
133+ (Fail err) -> Left err
106−
134+{-# INLINE parse #-}
107−instance Monoid (Parser a) where
135+
136+-- | Run a parser on top of the given base monad.
137+parseT :: Monad m => ZeptoT m a -> ByteString -> m (Either String a)
138+parseT p bs = do
139+ result <- runParser p (S bs)
140+ case result of
141+ OK a _ -> return (Right a)
142+ Fail err -> return (Left err)
143+{-# INLINE parseT #-}
144+
145+instance Monad m => Semigroup (ZeptoT m a) where
146+ (<>) = mplus
147+ {-# INLINE (<>) #-}
148+
149+instance Monad m => Mon.Monoid (ZeptoT m a) where
108 mempty = fail "mempty"
150 mempty = fail "mempty"
109 {-# INLINE mempty #-}
151 {-# INLINE mempty #-}
110− mappend = mplus
152+ mappend = (<>)
111 {-# INLINE mappend #-}
153 {-# INLINE mappend #-}
112
154
113−instance Alternative Parser where
155+instance Monad m => Alternative (ZeptoT m) where
114 empty = fail "empty"
156 empty = fail "empty"
115 {-# INLINE empty #-}
157 {-# INLINE empty #-}
116 (<|>) = mplus
158 (<|>) = mplus
117 {-# INLINE (<|>) #-}
159 {-# INLINE (<|>) #-}
118
160
119-- | Consume input while the predicate returns 'True'.
161-- | Consume input while the predicate returns 'True'.
120−takeWhile :: (Word8 -> Bool) -> Parser ByteString
162+takeWhile :: Monad m => (Word8 -> Bool) -> ZeptoT m ByteString
121takeWhile p = do
163takeWhile p = do
122 (h,t) <- gets (B.span p . input)
164 (h,t) <- gets (B.span p . input)
123 put (S t)
165 put (S t)
@@ -125,7 +167,7 @@ takeWhile p = do
125{-# INLINE takeWhile #-}
167{-# INLINE takeWhile #-}
126
168
127-- | Consume @n@ bytes of input.
169-- | Consume @n@ bytes of input.
128−take :: Int -> Parser ByteString
170+take :: Monad m => Int -> ZeptoT m ByteString
129take !n = do
171take !n = do
130 s <- gets input
172 s <- gets input
131 if B.length s >= n
173 if B.length s >= n
@@ -134,7 +176,7 @@ take !n = do
134{-# INLINE take #-}
176{-# INLINE take #-}
135
177
136-- | Match a string exactly.
178-- | Match a string exactly.
137−string :: ByteString -> Parser ()
179+string :: Monad m => ByteString -> ZeptoT m ()
138string s = do
180string s = do
139 i <- gets input
181 i <- gets input
140 if s `B.isPrefixOf` i
182 if s `B.isPrefixOf` i
@@ -143,7 +185,7 @@ string s = do
143{-# INLINE string #-}
185{-# INLINE string #-}
144
186
145-- | Indicate whether the end of the input has been reached.
187-- | Indicate whether the end of the input has been reached.
146−atEnd :: Parser Bool
188+atEnd :: Monad m => ZeptoT m Bool
147atEnd = do
189atEnd = do
148 i <- gets input
190 i <- gets input
149 return $! B.null i
191 return $! B.null i
README.markdown−6
@@ -16,12 +16,6 @@ Master [git repository](https://github.com/bos/attoparsec):
16
16
17* `git clone git://github.com/bos/attoparsec.git`
17* `git clone git://github.com/bos/attoparsec.git`
18
18
19−There's also a [Mercurial mirror](https://bitbucket.org/bos/attoparsec):
20−
21−* `hg clone https://bitbucket.org/bos/attoparsec`
22−
23−(You can create and contribute changes using either Mercurial or git.)
24−
25Authors
19Authors
26-------
20-------
27
21
attoparsec.cabal+131−29
@@ -1,13 +1,14 @@
1name: attoparsec
1name: attoparsec
2−version: 0.10.0.0
2+version: 0.13.2.2
3+x-revision: 3
3license: BSD3
4license: BSD3
4license-file: LICENSE
5license-file: LICENSE
5category: Text, Parsing
6category: Text, Parsing
6author: Bryan O'Sullivan <bos@serpentine.com>
7author: Bryan O'Sullivan <bos@serpentine.com>
7−maintainer: Bryan O'Sullivan <bos@serpentine.com>
8+maintainer: Bryan O'Sullivan <bos@serpentine.com>, Ben Gamari <ben@smart-cactus.org>
8stability: experimental
9stability: experimental
9−tested-with: GHC == 6.12.3, GHC == 7.0.3, GHC == 7.2.1
10+tested-with: GHC == 7.0.4, GHC == 7.2.2, GHC == 7.4.2, GHC ==7.6.3, GHC ==7.8.4, GHC ==7.10.3, GHC ==8.0.2, GHC ==8.2.2, GHC==8.4.4, GHC==8.6.5, GHC==8.8.1
10−synopsis: Fast combinator parsing for bytestrings
11+synopsis: Fast combinator parsing for bytestrings and text
11cabal-version: >= 1.8
12cabal-version: >= 1.8
12homepage: https://github.com/bos/attoparsec
13homepage: https://github.com/bos/attoparsec
13bug-reports: https://github.com/bos/attoparsec/issues
14bug-reports: https://github.com/bos/attoparsec/issues
@@ -18,75 +19,176 @@ description:
18 file formats.
19 file formats.
19extra-source-files:
20extra-source-files:
20 README.markdown
21 README.markdown
22+ benchmarks/*.cabal
23+ benchmarks/*.hs
24+ benchmarks/*.txt
25+ benchmarks/json-data/*.json
21 benchmarks/Makefile
26 benchmarks/Makefile
22− benchmarks/Tiny.hs
23 benchmarks/med.txt.bz2
27 benchmarks/med.txt.bz2
24− tests/Makefile
28+ changelog.md
25− tests/QC.hs
29+ examples/*.c
26− tests/QCSupport.hs
30+ examples/*.hs
27− tests/TestFastSet.hs
28 examples/Makefile
31 examples/Makefile
29− examples/Parsec_RFC2616.hs
32+ tests/*.hs
30− examples/RFC2616.hs
33+ tests/QC/*.hs
31− examples/TestRFC2616.hs
34+ tests/QC/IPv6/*.hs
32− examples/rfc2616.c
33
35
34Flag developer
36Flag developer
35 Description: Whether to build the library in development mode
37 Description: Whether to build the library in development mode
36 Default: False
38 Default: False
39+ Manual: True
37
40
38library
41library
39 build-depends: array,
42 build-depends: array,
40− base >= 3 && < 5,
43+ base >= 4.3 && < 5,
41 bytestring,
44 bytestring,
42 containers,
45 containers,
43 deepseq,
46 deepseq,
47+ scientific >= 0.3.1 && < 0.4,
48+ transformers >= 0.2 && (< 0.4 || >= 0.4.1.0) && < 0.6,
44− text >= 0.11.1.5
49+ text >= 1.1.1.3
50+ if impl(ghc < 7.4)
51+ build-depends:
52+ bytestring < 0.10.4.0
53+
54+ if !impl(ghc >= 8.0)
55+ -- Data.Semigroup && Control.Monad.Fail are available in base-4.9+
56+ build-depends: fail == 4.9.*,
57+ semigroups >=0.16.1 && <0.20
45
58
46− extensions: CPP
47 exposed-modules: Data.Attoparsec
59 exposed-modules: Data.Attoparsec
48 Data.Attoparsec.ByteString
60 Data.Attoparsec.ByteString
49 Data.Attoparsec.ByteString.Char8
61 Data.Attoparsec.ByteString.Char8
50 Data.Attoparsec.ByteString.Lazy
62 Data.Attoparsec.ByteString.Lazy
51 Data.Attoparsec.Char8
63 Data.Attoparsec.Char8
52 Data.Attoparsec.Combinator
64 Data.Attoparsec.Combinator
65+ Data.Attoparsec.Internal
66+ Data.Attoparsec.Internal.Types
53 Data.Attoparsec.Lazy
67 Data.Attoparsec.Lazy
54 Data.Attoparsec.Number
68 Data.Attoparsec.Number
55 Data.Attoparsec.Text
69 Data.Attoparsec.Text
56 Data.Attoparsec.Text.Lazy
70 Data.Attoparsec.Text.Lazy
57 Data.Attoparsec.Types
71 Data.Attoparsec.Types
58 Data.Attoparsec.Zepto
72 Data.Attoparsec.Zepto
59− other-modules: Data.Attoparsec.ByteString.FastSet
73+ other-modules: Data.Attoparsec.ByteString.Buffer
74+ Data.Attoparsec.ByteString.FastSet
60 Data.Attoparsec.ByteString.Internal
75 Data.Attoparsec.ByteString.Internal
61− Data.Attoparsec.Internal.Types
76+ Data.Attoparsec.Internal.Fhthagn
77+ Data.Attoparsec.Text.Buffer
62 Data.Attoparsec.Text.FastSet
78 Data.Attoparsec.Text.FastSet
63 Data.Attoparsec.Text.Internal
79 Data.Attoparsec.Text.Internal
64− ghc-options: -Wall
80+ ghc-options: -O2 -Wall
65
81
66 if flag(developer)
82 if flag(developer)
67 ghc-prof-options: -auto-all
83 ghc-prof-options: -auto-all
84+ ghc-options: -Werror
68
85
69test-suite tests
86test-suite tests
70 type: exitcode-stdio-1.0
87 type: exitcode-stdio-1.0
71− hs-source-dirs: tests
88+ hs-source-dirs: tests .
72 main-is: QC.hs
89 main-is: QC.hs
90+ other-modules: QC.Buffer
91+ QC.ByteString
92+ QC.Combinator
93+ QC.Common
94+ QC.IPv6.Internal
95+ QC.IPv6.Types
96+ QC.Rechunked
97+ QC.Simple
98+ QC.Text
99+ QC.Text.FastSet
100+ QC.Text.Regressions
101+
102+ other-modules: Data.Attoparsec.ByteString
103+ Data.Attoparsec.ByteString.Buffer
104+ Data.Attoparsec.ByteString.Char8
105+ Data.Attoparsec.ByteString.FastSet
106+ Data.Attoparsec.ByteString.Internal
107+ Data.Attoparsec.ByteString.Lazy
108+ Data.Attoparsec.Combinator
109+ Data.Attoparsec.Internal
110+ Data.Attoparsec.Internal.Fhthagn
111+ Data.Attoparsec.Internal.Types
112+ Data.Attoparsec.Number
113+ Data.Attoparsec.Text
114+ Data.Attoparsec.Text.Buffer
115+ Data.Attoparsec.Text.FastSet
116+ Data.Attoparsec.Text.Internal
117+ Data.Attoparsec.Text.Lazy
118+ Data.Attoparsec.Zepto
73
119
74 ghc-options:
120 ghc-options:
75 -Wall -threaded -rtsopts
121 -Wall -threaded -rtsopts
76
122
123+ if flag(developer)
124+ ghc-options: -Werror
125+
77 build-depends:
126 build-depends:
78− attoparsec,
127+ array,
79− base >= 4 && < 5,
128+ base,
80 bytestring,
129 bytestring,
130+ deepseq >= 1.1,
81− QuickCheck >= 2.4,
131+ QuickCheck >= 2.13.2 && < 2.14,
82− test-framework >= 0.4,
132+ quickcheck-unicode,
83− test-framework-quickcheck2 >= 0.2,
133+ scientific,
134+ tasty >= 0.11,
135+ tasty-quickcheck >= 0.8,
136+ text,
137+ transformers >= 0.2 && (< 0.4 || >= 0.4.1.0) && < 0.6,
138+ vector
139+
140+ if !impl(ghc >= 8.0)
141+ -- Data.Semigroup && Control.Monad.Fail are available in base-4.9+
142+ build-depends: fail == 4.9.*,
143+ semigroups >=0.16.1 && <0.20
144+
145+benchmark benchmarks
146+ type: exitcode-stdio-1.0
147+ hs-source-dirs: benchmarks benchmarks/warp-3.0.1.1 .
148+ ghc-options: -O2 -Wall -rtsopts
149+ main-is: Benchmarks.hs
150+ other-modules:
151+ Common
152+ HeadersByteString
153+ HeadersByteString.Atto
154+ HeadersText
155+ Links
156+ Network.Wai.Handler.Warp.ReadInt
157+ Network.Wai.Handler.Warp.RequestHeader
158+ Numbers
159+ Sets
160+ TextFastSet
161+ Warp
162+ ghc-options: -O2 -Wall
163+
164+ if flag(developer)
165+ ghc-options: -Werror
166+
167+ build-depends:
168+ array,
169+ base == 4.*,
170+ bytestring >= 0.10.4.0,
171+ case-insensitive,
172+ containers,
173+ criterion >= 1.0,
174+ deepseq >= 1.1,
175+ directory,
176+ filepath,
177+ ghc-prim,
178+ http-types,
179+ parsec >= 3.1.2,
180+ scientific,
84− text
181+ text >= 1.1.1.0,
182+ transformers >= 0.2 && (< 0.4 || >= 0.4.1.0) && < 0.6,
183+ unordered-containers,
184+ vector
185+
186+ if !impl(ghc >= 8.0)
187+ -- Data.Semigroup && Control.Monad.Fail are available in base-4.9+
188+ build-depends: fail == 4.9.*,
189+ semigroups >=0.16.1 && <0.19
85
190
86source-repository head
191source-repository head
87 type: git
192 type: git
88 location: https://github.com/bos/attoparsec
193 location: https://github.com/bos/attoparsec
89
194
90−source-repository head
91− type: mercurial
92− location: https://bitbucket.org/bos/attoparsec
benchmarks/Aeson.hsnew file+353
@@ -0,0 +1,353 @@
1+{-# LANGUAGE BangPatterns, CPP, OverloadedStrings #-}
2+{-# OPTIONS_GHC -fno-warn-unused-binds #-}
3+
4+module Aeson
5+ (
6+ aeson
7+ , value'
8+ ) where
9+
10+import Data.ByteString.Builder
11+ (Builder, byteString, toLazyByteString, charUtf8, word8)
12+
13+#if !MIN_VERSION_base(4,8,0)
14+import Control.Applicative ((*>), (<$>), (<*), pure)
15+import Data.Monoid (mappend, mempty)
16+#endif
17+
18+import Common (pathTo)
19+import Control.Applicative (liftA2)
20+import Control.DeepSeq (NFData(..))
21+import Control.Monad (forM)
22+import Data.Attoparsec.ByteString.Char8 (Parser, char, endOfInput, scientific,
23+ skipSpace, string)
24+import Data.Bits ((.|.), shiftL)
25+import Data.ByteString (ByteString)
26+import Data.Char (chr)
27+import Data.List (sort)
28+import Data.Scientific (Scientific)
29+import Data.Text (Text)
30+import Data.Text.Encoding (decodeUtf8')
31+import Data.Vector as Vector (Vector, foldl', fromList)
32+import Data.Word (Word8)
33+import System.Directory (getDirectoryContents)
34+import System.FilePath ((</>), dropExtension)
35+import qualified Data.Attoparsec.ByteString as A
36+import qualified Data.Attoparsec.Lazy as L
37+import qualified Data.Attoparsec.Zepto as Z
38+import qualified Data.ByteString as B
39+import qualified Data.ByteString.Lazy as L
40+import qualified Data.ByteString.Unsafe as B
41+import qualified Data.HashMap.Strict as H
42+import Criterion.Main
43+
44+#define BACKSLASH 92
45+#define CLOSE_CURLY 125
46+#define CLOSE_SQUARE 93
47+#define COMMA 44
48+#define DOUBLE_QUOTE 34
49+#define OPEN_CURLY 123
50+#define OPEN_SQUARE 91
51+#define C_0 48
52+#define C_9 57
53+#define C_A 65
54+#define C_F 70
55+#define C_a 97
56+#define C_f 102
57+#define C_n 110
58+#define C_t 116
59+
60+data Result a = Error String
61+ | Success a
62+ deriving (Eq, Show)
63+
64+
65+-- | A JSON \"object\" (key\/value map).
66+type Object = H.HashMap Text Value
67+
68+-- | A JSON \"array\" (sequence).
69+type Array = Vector Value
70+
71+-- | A JSON value represented as a Haskell value.
72+data Value = Object !Object
73+ | Array !Array
74+ | String !Text
75+ | Number !Scientific
76+ | Bool !Bool
77+ | Null
78+ deriving (Eq, Show)
79+
80+instance NFData Value where
81+ rnf (Object o) = rnf o
82+ rnf (Array a) = Vector.foldl' (\x y -> rnf y `seq` x) () a
83+ rnf (String s) = rnf s
84+ rnf (Number n) = rnf n
85+ rnf (Bool b) = rnf b
86+ rnf Null = ()
87+
88+-- | Parse a top-level JSON value. This must be either an object or
89+-- an array, per RFC 4627.
90+--
91+-- The conversion of a parsed value to a Haskell value is deferred
92+-- until the Haskell value is needed. This may improve performance if
93+-- only a subset of the results of conversions are needed, but at a
94+-- cost in thunk allocation.
95+json :: Parser Value
96+json = json_ object_ array_
97+
98+-- | Parse a top-level JSON value. This must be either an object or
99+-- an array, per RFC 4627.
100+--
101+-- This is a strict version of 'json' which avoids building up thunks
102+-- during parsing; it performs all conversions immediately. Prefer
103+-- this version if most of the JSON data needs to be accessed.
104+json' :: Parser Value
105+json' = json_ object_' array_'
106+
107+json_ :: Parser Value -> Parser Value -> Parser Value
108+json_ obj ary = do
109+ w <- skipSpace *> A.satisfy (\w -> w == OPEN_CURLY || w == OPEN_SQUARE)
110+ if w == OPEN_CURLY
111+ then obj
112+ else ary
113+{-# INLINE json_ #-}
114+
115+object_ :: Parser Value
116+object_ = {-# SCC "object_" #-} Object <$> objectValues jstring value
117+
118+object_' :: Parser Value
119+object_' = {-# SCC "object_'" #-} do
120+ !vals <- objectValues jstring' value'
121+ return (Object vals)
122+ where
123+ jstring' = do
124+ !s <- jstring
125+ return s
126+
127+objectValues :: Parser Text -> Parser Value -> Parser (H.HashMap Text Value)
128+objectValues str val = do
129+ skipSpace
130+ let pair = liftA2 (,) (str <* skipSpace) (char ':' *> skipSpace *> val)
131+ H.fromList <$> commaSeparated pair CLOSE_CURLY
132+{-# INLINE objectValues #-}
133+
134+array_ :: Parser Value
135+array_ = {-# SCC "array_" #-} Array <$> arrayValues value
136+
137+array_' :: Parser Value
138+array_' = {-# SCC "array_'" #-} do
139+ !vals <- arrayValues value'
140+ return (Array vals)
141+
142+commaSeparated :: Parser a -> Word8 -> Parser [a]
143+commaSeparated item endByte = do
144+ w <- A.peekWord8'
145+ if w == endByte
146+ then A.anyWord8 >> return []
147+ else loop
148+ where
149+ loop = do
150+ v <- item <* skipSpace
151+ ch <- A.satisfy $ \w -> w == COMMA || w == endByte
152+ if ch == COMMA
153+ then skipSpace >> (v:) <$> loop
154+ else return [v]
155+{-# INLINE commaSeparated #-}
156+
157+arrayValues :: Parser Value -> Parser (Vector Value)
158+arrayValues val = do
159+ skipSpace
160+ Vector.fromList <$> commaSeparated val CLOSE_SQUARE
161+{-# INLINE arrayValues #-}
162+
163+-- | Parse any JSON value. You should usually 'json' in preference to
164+-- this function, as this function relaxes the object-or-array
165+-- requirement of RFC 4627.
166+--
167+-- In particular, be careful in using this function if you think your
168+-- code might interoperate with Javascript. A na&#xef;ve Javascript
169+-- library that parses JSON data using @eval@ is vulnerable to attack
170+-- unless the encoded data represents an object or an array. JSON
171+-- implementations in other languages conform to that same restriction
172+-- to preserve interoperability and security.
173+value :: Parser Value
174+value = do
175+ w <- A.peekWord8'
176+ case w of
177+ DOUBLE_QUOTE -> A.anyWord8 *> (String <$> jstring_)
178+ OPEN_CURLY -> A.anyWord8 *> object_
179+ OPEN_SQUARE -> A.anyWord8 *> array_
180+ C_f -> string "false" *> pure (Bool False)
181+ C_t -> string "true" *> pure (Bool True)
182+ C_n -> string "null" *> pure Null
183+ _ | w >= 48 && w <= 57 || w == 45
184+ -> Number <$> scientific
185+ | otherwise -> fail "not a valid json value"
186+
187+-- | Strict version of 'value'. See also 'json''.
188+value' :: Parser Value
189+value' = do
190+ w <- A.peekWord8'
191+ case w of
192+ DOUBLE_QUOTE -> do
193+ !s <- A.anyWord8 *> jstring_
194+ return (String s)
195+ OPEN_CURLY -> A.anyWord8 *> object_'
196+ OPEN_SQUARE -> A.anyWord8 *> array_'
197+ C_f -> string "false" *> pure (Bool False)
198+ C_t -> string "true" *> pure (Bool True)
199+ C_n -> string "null" *> pure Null
200+ _ | w >= 48 && w <= 57 || w == 45
201+ -> do
202+ !n <- scientific
203+ return (Number n)
204+ | otherwise -> fail "not a valid json value"
205+
206+-- | Parse a quoted JSON string.
207+jstring :: Parser Text
208+jstring = A.word8 DOUBLE_QUOTE *> jstring_
209+
210+-- | Parse a string without a leading quote.
211+jstring_ :: Parser Text
212+jstring_ = {-# SCC "jstring_" #-} do
213+ s <- A.scan False $ \s c -> if s then Just False
214+ else if c == DOUBLE_QUOTE
215+ then Nothing
216+ else Just (c == BACKSLASH)
217+ _ <- A.word8 DOUBLE_QUOTE
218+ s1 <- if BACKSLASH `B.elem` s
219+ then case Z.parse unescape s of
220+ Right r -> return r
221+ Left err -> fail err
222+ else return s
223+
224+ case decodeUtf8' s1 of
225+ Right r -> return r
226+ Left err -> fail $ show err
227+
228+{-# INLINE jstring_ #-}
229+
230+unescape :: Z.Parser ByteString
231+unescape = toByteString <$> go mempty where
232+ go acc = do
233+ h <- Z.takeWhile (/=BACKSLASH)
234+ let rest = do
235+ start <- Z.take 2
236+ let !slash = B.unsafeHead start
237+ !t = B.unsafeIndex start 1
238+ escape = case B.findIndex (==t) "\"\\/ntbrfu" of
239+ Just i -> i
240+ _ -> 255
241+ if slash /= BACKSLASH || escape == 255
242+ then fail "invalid JSON escape sequence"
243+ else do
244+ let cont m = go (acc `mappend` byteString h `mappend` m)
245+ {-# INLINE cont #-}
246+ if t /= 117 -- 'u'
247+ then cont (word8 (B.unsafeIndex mapping escape))
248+ else do
249+ a <- hexQuad
250+ if a < 0xd800 || a > 0xdfff
251+ then cont (charUtf8 (chr a))
252+ else do
253+ b <- Z.string "\\u" *> hexQuad
254+ if a <= 0xdbff && b >= 0xdc00 && b <= 0xdfff
255+ then let !c = ((a - 0xd800) `shiftL` 10) +
256+ (b - 0xdc00) + 0x10000
257+ in cont (charUtf8 (chr c))
258+ else fail "invalid UTF-16 surrogates"
259+ done <- Z.atEnd
260+ if done
261+ then return (acc `mappend` byteString h)
262+ else rest
263+ mapping = "\"\\/\n\t\b\r\f"
264+
265+hexQuad :: Z.Parser Int
266+hexQuad = do
267+ s <- Z.take 4
268+ let hex n | w >= C_0 && w <= C_9 = w - C_0
269+ | w >= C_a && w <= C_f = w - 87
270+ | w >= C_A && w <= C_F = w - 55
271+ | otherwise = 255
272+ where w = fromIntegral $ B.unsafeIndex s n
273+ a = hex 0; b = hex 1; c = hex 2; d = hex 3
274+ if (a .|. b .|. c .|. d) /= 255
275+ then return $! d .|. (c `shiftL` 4) .|. (b `shiftL` 8) .|. (a `shiftL` 12)
276+ else fail "invalid hex escape"
277+
278+decodeWith :: Parser Value -> (Value -> Result a) -> L.ByteString -> Maybe a
279+decodeWith p to s =
280+ case L.parse p s of
281+ L.Done _ v -> case to v of
282+ Success a -> Just a
283+ _ -> Nothing
284+ _ -> Nothing
285+{-# INLINE decodeWith #-}
286+
287+decodeStrictWith :: Parser Value -> (Value -> Result a) -> B.ByteString
288+ -> Maybe a
289+decodeStrictWith p to s =
290+ case either Error to (A.parseOnly p s) of
291+ Success a -> Just a
292+ Error _ -> Nothing
293+{-# INLINE decodeStrictWith #-}
294+
295+eitherDecodeWith :: Parser Value -> (Value -> Result a) -> L.ByteString
296+ -> Either String a
297+eitherDecodeWith p to s =
298+ case L.parse p s of
299+ L.Done _ v -> case to v of
300+ Success a -> Right a
301+ Error msg -> Left msg
302+ L.Fail _ _ msg -> Left msg
303+{-# INLINE eitherDecodeWith #-}
304+
305+eitherDecodeStrictWith :: Parser Value -> (Value -> Result a) -> B.ByteString
306+ -> Either String a
307+eitherDecodeStrictWith p to s =
308+ case either Error to (A.parseOnly p s) of
309+ Success a -> Right a
310+ Error msg -> Left msg
311+{-# INLINE eitherDecodeStrictWith #-}
312+
313+-- $lazy
314+--
315+-- The 'json' and 'value' parsers decouple identification from
316+-- conversion. Identification occurs immediately (so that an invalid
317+-- JSON document can be rejected as early as possible), but conversion
318+-- to a Haskell value is deferred until that value is needed.
319+--
320+-- This decoupling can be time-efficient if only a smallish subset of
321+-- elements in a JSON value need to be inspected, since the cost of
322+-- conversion is zero for uninspected elements. The trade off is an
323+-- increase in memory usage, due to allocation of thunks for values
324+-- that have not yet been converted.
325+
326+-- $strict
327+--
328+-- The 'json'' and 'value'' parsers combine identification with
329+-- conversion. They consume more CPU cycles up front, but have a
330+-- smaller memory footprint.
331+
332+-- | Parse a top-level JSON value followed by optional whitespace and
333+-- end-of-input. See also: 'json'.
334+jsonEOF :: Parser Value
335+jsonEOF = json <* skipSpace <* endOfInput
336+
337+-- | Parse a top-level JSON value followed by optional whitespace and
338+-- end-of-input. See also: 'json''.
339+jsonEOF' :: Parser Value
340+jsonEOF' = json' <* skipSpace <* endOfInput
341+
342+toByteString :: Builder -> ByteString
343+toByteString = L.toStrict . toLazyByteString
344+{-# INLINE toByteString #-}
345+
346+aeson :: IO Benchmark
347+aeson = do
348+ path <- pathTo "json-data"
349+ names <- sort . filter (`notElem` [".", ".."]) <$> getDirectoryContents path
350+ benches <- forM names $ \name -> do
351+ bs <- B.readFile (path </> name)
352+ return . bench (dropExtension name) $ nf (A.parseOnly jsonEOF') bs
353+ return $ bgroup "aeson" benches
benchmarks/Alternative.hsnew file+20
@@ -0,0 +1,20 @@
1+{-# LANGUAGE OverloadedStrings #-}
2+
3+-- This benchmark reveals a huge performance regression that showed up
4+-- under GHC 7.8.1 (https://github.com/bos/attoparsec/issues/56).
5+--
6+-- With GHC 7.6.3 and older, this program runs in 0.04 seconds. Under
7+-- GHC 7.8.1 with (<|>) inlined, time jumps to 12 seconds!
8+
9+import Control.Applicative
10+import Data.Text (Text)
11+import qualified Data.Attoparsec.Text as A
12+import qualified Data.Text as T
13+
14+testParser :: Text -> Either String Int
15+testParser f = fmap length -- avoid printing out the entire matched list
16+ . A.parseOnly (many ((() <$ A.string "b") <|> (() <$ A.anyChar)))
17+ $ f
18+
19+main :: IO ()
20+main = print . testParser $ T.replicate 50000 "a"
benchmarks/Benchmarks.hsnew file+126
@@ -0,0 +1,126 @@
1+{-# LANGUAGE BangPatterns, CPP #-}
2+
3+import Common ()
4+import Control.Applicative (many)
5+import Criterion.Main (bench, bgroup, defaultMain, nf)
6+import Data.Bits
7+import Data.Char (isAlpha)
8+import Data.Word (Word32)
9+import Data.Word (Word8)
10+import Numbers (numbers)
11+import Common (chunksOf)
12+import Text.Parsec.Text ()
13+import Text.Parsec.Text.Lazy ()
14+import qualified Warp
15+import qualified Aeson
16+import qualified Genome
17+import qualified Data.Attoparsec.ByteString as AB
18+import qualified Data.Attoparsec.ByteString.Char8 as AC
19+import qualified Data.Attoparsec.ByteString.Lazy as ABL
20+import qualified Data.Attoparsec.Text as AT
21+import qualified Data.Attoparsec.Text.Lazy as ATL
22+import qualified Data.ByteString as B
23+import qualified Data.ByteString.Char8 as BC
24+import qualified Data.ByteString.Lazy as BL
25+import qualified Data.Text as T
26+import qualified Data.Text.Lazy as TL
27+import qualified HeadersByteString
28+import qualified HeadersText
29+import qualified Links
30+import qualified Text.Parsec as P
31+import qualified Sets
32+
33+main :: IO ()
34+main = do
35+ let s = take 1024 . cycle $ ['a'..'z'] ++ ['A'..'Z']
36+ !b = BC.pack s
37+ !bl = BL.fromChunks . map BC.pack . chunksOf 4 $ s
38+ !t = T.pack s
39+ !tl = TL.fromChunks . map T.pack . chunksOf 4 $ s
40+ aeson <- Aeson.aeson
41+ headersBS <- HeadersByteString.headers
42+ headersT <- HeadersText.headers
43+ defaultMain [
44+ bgroup "many" [
45+ bgroup "attoparsec" [
46+ bench "B" $ nf (AB.parse (many (AC.satisfy AC.isAlpha_ascii))) b
47+ , bench "BL" $ nf (ABL.parse (many (AC.satisfy AC.isAlpha_ascii))) bl
48+ , bench "T" $ nf (AT.parse (many (AT.satisfy AC.isAlpha_ascii))) t
49+ , bench "TL" $ nf (ATL.parse (many (AT.satisfy AC.isAlpha_ascii))) tl
50+ ]
51+ , bgroup "parsec" [
52+ bench "S" $ nf (P.parse (many (P.satisfy AC.isAlpha_ascii)) "") s
53+ , bench "B" $ nf (P.parse (many (P.satisfy AC.isAlpha_ascii)) "") b
54+ , bench "BL" $ nf (P.parse (many (P.satisfy AC.isAlpha_ascii)) "") bl
55+ , bench "T" $ nf (P.parse (many (P.satisfy AC.isAlpha_ascii)) "") t
56+ , bench "TL" $ nf (P.parse (many (P.satisfy AC.isAlpha_ascii)) "") tl
57+ ]
58+ ]
59+ , bgroup "comparison" [
60+ bgroup "many-vs-takeWhile" [
61+ bench "many" $ nf (AB.parse (many (AC.satisfy AC.isAlpha_ascii))) b
62+ , bench "takeWhile" $ nf (AB.parse (AC.takeWhile AC.isAlpha_ascii)) b
63+ ]
64+ , bgroup "letter-vs-isAlpha" [
65+ bench "letter" $ nf (AB.parse (many AC.letter_ascii)) b
66+ , bench "isAlpha" $ nf (AB.parse (many (AC.satisfy AC.isAlpha_ascii))) b
67+ ]
68+ ]
69+ , bgroup "takeWhile" [
70+ bench "isAlpha" $ nf (ABL.parse (AC.takeWhile isAlpha)) bl
71+ , bench "isAlpha_ascii" $ nf (ABL.parse (AC.takeWhile AC.isAlpha_ascii)) bl
72+ , bench "isAlpha_iso8859_15" $
73+ nf (ABL.parse (AC.takeWhile AC.isAlpha_iso8859_15)) bl
74+ , bench "T isAlpha" $ nf (AT.parse (AT.takeWhile isAlpha)) t
75+ , bench "TL isAlpha" $ nf (ATL.parse (AT.takeWhile isAlpha)) tl
76+ ]
77+ , bgroup "takeWhile1" [
78+ bench "isAlpha" $ nf (ABL.parse (AC.takeWhile1 isAlpha)) bl
79+ , bench "isAlpha_ascii" $ nf (ABL.parse (AC.takeWhile1 AC.isAlpha_ascii)) bl
80+ , bench "T isAlpha" $ nf (AT.parse (AT.takeWhile1 isAlpha)) t
81+ , bench "TL isAlpha" $ nf (ATL.parse (AT.takeWhile1 isAlpha)) tl
82+ ]
83+ , bench "word32LE" $ nf (AB.parse word32LE) b
84+ , bgroup "scan" [
85+ bench "short" $ nf (AB.parse quotedString) (BC.pack "abcdefghijk\"")
86+ , bench "long" $ nf (AB.parse quotedString) b
87+ ]
88+ , aeson
89+ , Genome.genome
90+ , headersBS
91+ , headersT
92+ , Links.links
93+ , numbers
94+ , Sets.benchmarks
95+ , Warp.benchmarks
96+ ]
97+
98+-- Benchmarks bind and (potential) bounds-check merging.
99+word32LE :: AB.Parser Word32
100+word32LE = do
101+ w1 <- AB.anyWord8
102+ w2 <- AB.anyWord8
103+ w3 <- AB.anyWord8
104+ w4 <- AB.anyWord8
105+ return $! (fromIntegral w1 :: Word32) +
106+ fromIntegral w2 `unsafeShiftL` 8 +
107+ fromIntegral w3 `unsafeShiftL` 16 +
108+ fromIntegral w4 `unsafeShiftL` 32
109+
110+doubleQuote, backslash :: Word8
111+doubleQuote = 34
112+backslash = 92
113+{-# INLINE backslash #-}
114+{-# INLINE doubleQuote #-}
115+
116+-- | Parse a string without a leading quote.
117+quotedString :: AB.Parser B.ByteString
118+quotedString = AB.scan False $ \s c -> if s then Just False
119+ else if c == doubleQuote
120+ then Nothing
121+ else Just (c == backslash)
122+
123+#if !MIN_VERSION_base(4,5,0)
124+unsafeShiftL :: Bits a => a -> Int -> a
125+unsafeShiftL = shiftL
126+#endif
benchmarks/Common.hsnew file+47
@@ -0,0 +1,47 @@
1+{-# LANGUAGE CPP #-}
2+{-# OPTIONS_GHC -fno-warn-orphans #-}
3+
4+module Common (
5+ chunksOf
6+ , pathTo
7+ , rechunkBS
8+ , rechunkT
9+ ) where
10+
11+import Control.DeepSeq (NFData(rnf))
12+import System.Directory (doesDirectoryExist)
13+import System.FilePath ((</>))
14+import Text.Parsec (ParseError)
15+import qualified Data.ByteString as B
16+import qualified Data.ByteString.Lazy as BL
17+import qualified Data.Text as T
18+import qualified Data.Text.Lazy as TL
19+
20+#if !MIN_VERSION_bytestring(0,10,0)
21+import Data.ByteString.Internal (ByteString(..))
22+
23+instance NFData ByteString where
24+ rnf (PS _ _ _) = ()
25+#endif
26+
27+instance NFData ParseError where
28+ rnf = rnf . show
29+
30+chunksOf :: Int -> [a] -> [[a]]
31+chunksOf k = go
32+ where go xs = case splitAt k xs of
33+ ([],_) -> []
34+ (y, ys) -> y : go ys
35+
36+rechunkBS :: Int -> B.ByteString -> BL.ByteString
37+rechunkBS n = BL.fromChunks . map B.pack . chunksOf n . B.unpack
38+
39+rechunkT :: Int -> T.Text -> TL.Text
40+rechunkT n = TL.fromChunks . map T.pack . chunksOf n . T.unpack
41+
42+pathTo :: String -> IO FilePath
43+pathTo wat = do
44+ exists <- doesDirectoryExist "benchmarks"
45+ return $ if exists
46+ then "benchmarks" </> wat
47+ else wat
benchmarks/Genome.hsnew file+75
@@ -0,0 +1,75 @@
1+{-# LANGUAGE OverloadedStrings #-}
2+
3+module Genome
4+ (
5+ genome
6+ ) where
7+
8+import Control.Applicative
9+import Criterion.Main
10+import Data.ByteString (ByteString)
11+import qualified Data.ByteString.Char8 as B8
12+import qualified Data.ByteString.Lazy.Char8 as L8
13+import Data.Attoparsec.ByteString.Char8 as B
14+import qualified Data.Attoparsec.ByteString.Lazy as BL
15+import Data.Text (Text)
16+import qualified Data.Text as T
17+import qualified Data.Text.Lazy as TL
18+import Data.Attoparsec.Text as T
19+import qualified Data.Attoparsec.Text.Lazy as TL
20+import Common (rechunkBS, rechunkT)
21+
22+genome :: Benchmark
23+genome = bgroup "genome" [
24+ bgroup "bytestring" [
25+ bench "s" $ nf (map (B.parse searchBS)) (B8.tails geneB)
26+ , bench "l" $ nf (map (BL.parse searchBS)) (L8.tails geneBL)
27+ , bgroup "CI" [
28+ bench "s" $ nf (map (B.parse searchBSCI)) (B8.tails geneB)
29+ , bench "l" $ nf (map (BL.parse searchBSCI)) (L8.tails geneBL)
30+ ]
31+ ]
32+ , bgroup "text" [
33+ bench "s" $ nf (map (T.parse searchT)) (T.tails geneT)
34+ , bench "l" $ nf (map (TL.parse searchT)) (TL.tails geneTL)
35+ , bgroup "CI" [
36+ bench "s" $ nf (map (T.parse searchTCI)) (T.tails geneT)
37+ , bench "l" $ nf (map (TL.parse searchTCI)) (TL.tails geneTL)
38+ ]
39+ ]
40+ ]
41+ where geneB = B8.pack gene
42+ geneBL = rechunkBS 4 geneB
43+ geneT = T.pack gene
44+ geneTL = rechunkT 4 geneT
45+
46+searchBS :: B.Parser ByteString
47+searchBS = "caac" *> ("aaca" <|> "aact")
48+
49+searchBSCI :: B.Parser ByteString
50+searchBSCI = B.stringCI "CAAC" *> (B.stringCI "AACA" <|> B.stringCI "AACT")
51+
52+searchT :: T.Parser Text
53+searchT = "caac" *> ("aaca" <|> "aact")
54+
55+searchTCI :: T.Parser Text
56+searchTCI = T.asciiCI "CAAC" *> (T.asciiCI "AACA" <|> T.asciiCI "AACT")
57+
58+-- Dictyostelium discoideum developmental protein DG1094 (gacT) gene,
59+-- partial cds. http://www.ncbi.nlm.nih.gov/nuccore/AF081586.1
60+
61+gene :: String
62+gene = "atcgatttagaaagatacaaagatagaaccatcaataataaacaagagaagagagcaagt\
63+ \agagatattaataaagagattgaaagagagattgaaaagaagagattatcaccaagagaa\
64+ \agattaaatttatttggtctttcttcctcatcttcatcagtgaattcaacattaacaaga\
65+ \tctacagcaaatattatctctacaatagacggtagtggaggtagtaatcgtaatagtaaa\
66+ \aattatggtaatggctcatcctcctcctcaaatagaagatatagtaatactattaatcaa\
67+ \caattacaaatgcaattacaacaacttcaaatccaacaacaacaatatcaacaaactcaa\
68+ \caatctcaaataccattacaatatcaacaacaacaacagcaacaacaacaacaaaccact\
69+ \acaactacaactacatcaagtggtagtaatagattctcttcaaatagatataaaccagtt\
70+ \gatcttacacaatcatcttcaaactttcgttattcacgtgaaatttatgatgatgattat\
71+ \tattcaaataataatttaatgatgtttggtaatgagcaaccaaatcaaacaccaatttct\
72+ \gtatcatcttcatctgcattcacacgtcaaagatctcaaagttgctttgaaccagagaat\
73+ \cttgtattgctacaacaacaatatcaacaatatcaacaacaacaacaacaacaacaacaa\
74+ \attccattccaagcaaatccacaatatagtaatgctgttattgaacaaaaattggatcaa\
75+ \attagagataccattaataatttacatagagataaccgagtctctaga"
benchmarks/HeadersByteString.hsnew file+37
@@ -0,0 +1,37 @@
1+module HeadersByteString (headers) where
2+
3+import Common (pathTo, rechunkBS)
4+import Criterion.Main (bench, bgroup, nf, nfIO)
5+import Criterion.Types (Benchmark)
6+import HeadersByteString.Atto (request, response)
7+import Network.Wai.Handler.Warp.RequestHeader (parseHeaderLines)
8+import qualified Data.Attoparsec.ByteString.Char8 as B
9+import qualified Data.Attoparsec.ByteString.Lazy as BL
10+import qualified Data.ByteString.Char8 as B
11+
12+-- Note: In the benchmarks for parsing an http request
13+-- from a strict bytestring, we consider warp's implementation,
14+-- which has highly optimized code for handling the first
15+-- line in particular. It's treatment of the headers
16+-- is more relaxed from the treatment they are given by the
17+-- attoparsec parser benchmarked here. Consequently, it
18+-- is should not be possible to match its performance since
19+-- it accepts header names with disallowed characters.
20+
21+headers :: IO Benchmark
22+headers = do
23+ req <- B.readFile =<< pathTo "http-request.txt"
24+ resp <- B.readFile =<< pathTo "http-response.txt"
25+ let reql = rechunkBS 4 req
26+ respl = rechunkBS 4 resp
27+ return $ bgroup "headers" [
28+ bgroup "B" [
29+ bench "request" $ nf (B.parseOnly request) req
30+ , bench "warp" $ nfIO (parseHeaderLines (B.split '\n' req))
31+ , bench "response" $ nf (B.parseOnly response) resp
32+ ]
33+ , bgroup "BL" [
34+ bench "request" $ nf (BL.parse request) reql
35+ , bench "response" $ nf (BL.parse response) respl
36+ ]
37+ ]
benchmarks/HeadersByteString/Atto.hsnew file+57
@@ -0,0 +1,57 @@
1+{-# LANGUAGE BangPatterns, OverloadedStrings #-}
2+{-# OPTIONS_GHC -fno-warn-missing-signatures -fno-warn-orphans #-}
3+module HeadersByteString.Atto
4+ (
5+ request
6+ , response
7+ ) where
8+
9+import Control.Applicative
10+import Control.DeepSeq (NFData(..))
11+import Network.HTTP.Types.Version (HttpVersion, http11)
12+import qualified Data.Attoparsec.ByteString.Char8 as B
13+import qualified Data.ByteString.Char8 as B
14+
15+instance NFData HttpVersion where
16+ rnf !_ = ()
17+
18+isHeaderChar :: Char -> Bool
19+isHeaderChar c =
20+ (c >= 'a' && c <= 'z') ||
21+ (c >= 'A' && c <= 'Z') ||
22+ (c >= '0' && c <= '9') ||
23+ (c == '_') ||
24+ (c == '-')
25+
26+header = do
27+ name <- B.takeWhile1 isHeaderChar <* B.char ':' <* B.skipSpace
28+ body <- bodyLine
29+ return (name, body)
30+
31+bodyLine = B.takeTill (\c -> c == '\r' || c == '\n') <* B.endOfLine
32+
33+requestLine = do
34+ m <- (B.takeTill B.isSpace <* B.char ' ')
35+ (p,q) <- B.break (=='?') <$> (B.takeTill B.isSpace <* B.char ' ')
36+ v <- httpVersion
37+ return (m,p,q,v)
38+
39+httpVersion = http11 <$ "HTTP/1.1"
40+
41+responseLine = (,,) <$>
42+ (httpVersion <* B.skipSpace) <*>
43+ (int <* B.skipSpace) <*>
44+ bodyLine
45+
46+int :: B.Parser Int
47+int = B.decimal
48+
49+request = (,) <$> (requestLine <* B.endOfLine) <*> manyheader
50+
51+response = (,) <$> responseLine <*> many header
52+
53+manyheader = do
54+ c <- B.peekChar'
55+ if c == '\r' || c == '\n'
56+ then return []
57+ else (:) <$> header <*> manyheader
benchmarks/HeadersText.hsnew file+57
@@ -0,0 +1,57 @@
1+{-# LANGUAGE OverloadedStrings #-}
2+{-# OPTIONS_GHC -fno-warn-missing-signatures #-}
3+module HeadersText (headers) where
4+
5+import Common (pathTo, rechunkT)
6+import Control.Applicative
7+import Criterion.Main (bench, bgroup, nf)
8+import Criterion.Types (Benchmark)
9+import Data.Char (isSpace)
10+import qualified Data.Attoparsec.Text as T
11+import qualified Data.Attoparsec.Text.Lazy as TL
12+import qualified Data.Text.IO as T
13+
14+header = do
15+ name <- T.takeWhile1 (T.inClass "a-zA-Z0-9_-") <* T.char ':' <* T.skipSpace
16+ body <- (:) <$> bodyLine <*> many (T.takeWhile1 isSpace *> bodyLine)
17+ return (name, body)
18+
19+bodyLine = T.takeTill (\c -> c == '\r' || c == '\n') <* T.endOfLine
20+
21+requestLine =
22+ (,,) <$>
23+ (method <* T.skipSpace) <*>
24+ (T.takeTill isSpace <* T.skipSpace) <*>
25+ httpVersion
26+ where method = "GET" <|> "POST"
27+
28+httpVersion = "HTTP/" *> ((,) <$> (int <* T.char '.') <*> int)
29+
30+responseLine = (,,) <$>
31+ (httpVersion <* T.skipSpace) <*>
32+ (int <* T.skipSpace) <*>
33+ bodyLine
34+
35+int :: T.Parser Int
36+int = T.decimal
37+
38+request = (,) <$> (requestLine <* T.endOfLine) <*> many header
39+
40+response = (,) <$> responseLine <*> many header
41+
42+headers :: IO Benchmark
43+headers = do
44+ req <- T.readFile =<< pathTo "http-request.txt"
45+ resp <- T.readFile =<< pathTo "http-response.txt"
46+ let reql = rechunkT 4 req
47+ respl = rechunkT 4 resp
48+ return $ bgroup "headers" [
49+ bgroup "T" [
50+ bench "request" $ nf (T.parseOnly request) req
51+ , bench "response" $ nf (T.parseOnly response) resp
52+ ]
53+ , bgroup "TL" [
54+ bench "request" $ nf (TL.parse request) reql
55+ , bench "response" $ nf (TL.parse response) respl
56+ ]
57+ ]
benchmarks/Links.hsnew file+63
@@ -0,0 +1,63 @@
1+{-# LANGUAGE OverloadedStrings #-}
2+
3+module Links (links) where
4+
5+import Control.Applicative
6+import Control.DeepSeq (NFData(..))
7+import Criterion.Main (Benchmark, bench, nf)
8+import Data.Attoparsec.ByteString as A
9+import Data.Attoparsec.ByteString.Char8 as A8
10+import Data.ByteString.Char8 as B8
11+
12+data Link = Link {
13+ linkURL :: ByteString
14+ , linkParams :: [(ByteString, ByteString)]
15+ } deriving (Eq, Show)
16+
17+instance NFData Link where
18+ rnf l = rnf (linkURL l) `seq` rnf (linkParams l)
19+
20+link :: Parser Link
21+link = Link <$> url <*> many (char8 ';' *> skipSpace *> param)
22+ where url = char8 '<' *> A8.takeTill (=='>') <* char8 '>' <* skipSpace
23+
24+param :: Parser (ByteString, ByteString)
25+param = do
26+ name <- paramName
27+ skipSpace *> "=" *> skipSpace
28+ c <- peekChar'
29+ let isTokenChar = A.inClass "!#$%&'()*+./0-9:<=>?@a-zA-Z[]^_`{|}~-"
30+ val <- case c of
31+ '"' -> quotedString
32+ _ -> A.takeWhile isTokenChar
33+ skipSpace
34+ return (name, val)
35+
36+data Quot = Literal | Backslash
37+
38+quotedString :: Parser ByteString
39+quotedString = char '"' *> (fixup <$> body) <* char '"'
40+ where body = A8.scan Literal $ \s c ->
41+ case (s,c) of
42+ (Literal, '\\') -> backslash
43+ (Literal, '"') -> Nothing
44+ _ -> literal
45+ literal = Just Literal
46+ backslash = Just Backslash
47+ fixup = B8.pack . go . B8.unpack
48+ where go ('\\' : x@'\\' : xs) = x : go xs
49+ go ('\\' : x@'"' : xs) = x : go xs
50+ go (x : xs) = x : go xs
51+ go xs = xs
52+
53+paramName :: Parser ByteString
54+paramName = do
55+ name <- A.takeWhile1 $ A.inClass "a-zA-Z0-9!#$&+-.^_`|~"
56+ c <- peekChar
57+ return $ case c of
58+ Just '*' -> B8.snoc name '*'
59+ _ -> name
60+
61+links :: Benchmark
62+links = bench "links" $ nf (A.parseOnly link) lnk
63+ where lnk = "<https://api.github.com/search/code?q=addClass+user%3Amozilla&page=2>; rel=\"next\", <https://api.github.com/search/code?q=addClass+user%3Amozilla&page=34>; rel=\"last\""
benchmarks/Numbers.hsnew file+82
@@ -0,0 +1,82 @@
1+{-# LANGUAGE BangPatterns #-}
2+{-# OPTIONS_GHC -fno-warn-deprecations #-}
3+
4+module Numbers (numbers) where
5+
6+import Criterion.Main (bench, bgroup, nf)
7+import Criterion.Types (Benchmark)
8+import Data.Scientific (Scientific(..))
9+import Text.Parsec.Text ()
10+import Text.Parsec.Text.Lazy ()
11+import qualified Data.Attoparsec.ByteString.Char8 as AC
12+import qualified Data.Attoparsec.Text as AT
13+import qualified Data.ByteString.Char8 as BC
14+import qualified Data.Text as T
15+
16+strN, strNePos, strNeNeg :: String
17+strN = "1234.56789"
18+strNePos = "1234.56789e3"
19+strNeNeg = "1234.56789e-3"
20+
21+numbers :: Benchmark
22+numbers = bgroup "numbers" [
23+ let !tN = T.pack strN
24+ !tNePos = T.pack strNePos
25+ !tNeNeg = T.pack strNeNeg
26+ in bgroup "Text"
27+ [
28+ bgroup "no power"
29+ [ bench "double" $ nf (AT.parseOnly AT.double) tN
30+ , bench "number" $ nf (AT.parseOnly AT.number) tN
31+ , bench "rational" $
32+ nf (AT.parseOnly (AT.rational :: AT.Parser Rational)) tN
33+ , bench "scientific" $
34+ nf (AT.parseOnly (AT.rational :: AT.Parser Scientific)) tN
35+ ]
36+ , bgroup "positive power"
37+ [ bench "double" $ nf (AT.parseOnly AT.double) tNePos
38+ , bench "number" $ nf (AT.parseOnly AT.number) tNePos
39+ , bench "rational" $
40+ nf (AT.parseOnly (AT.rational :: AT.Parser Rational)) tNePos
41+ , bench "scientific" $
42+ nf (AT.parseOnly (AT.rational :: AT.Parser Scientific)) tNePos
43+ ]
44+ , bgroup "negative power"
45+ [ bench "double" $ nf (AT.parseOnly AT.double) tNeNeg
46+ , bench "number" $ nf (AT.parseOnly AT.number) tNeNeg
47+ , bench "rational" $
48+ nf (AT.parseOnly (AT.rational :: AT.Parser Rational)) tNeNeg
49+ , bench "scientific" $
50+ nf (AT.parseOnly (AT.rational :: AT.Parser Scientific)) tNeNeg
51+ ]
52+ ]
53+ , let !bN = BC.pack strN
54+ !bNePos = BC.pack strNePos
55+ !bNeNeg = BC.pack strNeNeg
56+ in bgroup "ByteString"
57+ [ bgroup "no power"
58+ [ bench "double" $ nf (AC.parseOnly AC.double) bN
59+ , bench "number" $ nf (AC.parseOnly AC.number) bN
60+ , bench "rational" $
61+ nf (AC.parseOnly (AC.rational :: AC.Parser Rational)) bN
62+ , bench "scientific" $
63+ nf (AC.parseOnly (AC.rational :: AC.Parser Scientific)) bN
64+ ]
65+ , bgroup "positive power"
66+ [ bench "double" $ nf (AC.parseOnly AC.double) bNePos
67+ , bench "number" $ nf (AC.parseOnly AC.number) bNePos
68+ , bench "rational" $
69+ nf (AC.parseOnly (AC.rational :: AC.Parser Rational)) bNePos
70+ , bench "scientific" $
71+ nf (AC.parseOnly (AC.rational :: AC.Parser Scientific)) bNePos
72+ ]
73+ , bgroup "negative power"
74+ [ bench "double" $ nf (AC.parseOnly AC.double) bNeNeg
75+ , bench "number" $ nf (AC.parseOnly AC.number) bNeNeg
76+ , bench "rational" $
77+ nf (AC.parseOnly (AC.rational :: AC.Parser Rational)) bNeNeg
78+ , bench "scientific" $
79+ nf (AC.parseOnly (AC.rational :: AC.Parser Scientific)) bNeNeg
80+ ]
81+ ]
82+ ]
benchmarks/Sets.hsnew file+21
@@ -0,0 +1,21 @@
1+module Sets (benchmarks) where
2+
3+import Criterion
4+import Data.Char (ord)
5+import qualified Data.Attoparsec.Text.FastSet as FastSet
6+import qualified TextFastSet
7+import qualified Data.HashSet as HashSet
8+import qualified Data.IntSet as IntSet
9+
10+smallSet :: String
11+smallSet = ['a'..'z'] ++ ['A'..'Z'] ++ ['0'..'9']
12+
13+benchmarks :: Benchmark
14+benchmarks = bgroup "sets" [
15+ bench "Fast" $ whnf (FastSet.member '*') (FastSet.fromList smallSet)
16+ , bench "Hash" $ whnf (HashSet.member '*') (HashSet.fromList smallSet)
17+ , bench "Int" $ whnf (IntSet.member (ord '*'))
18+ (IntSet.fromList (map ord smallSet))
19+ , bench "TextFast" $ whnf (TextFastSet.member '*')
20+ (TextFastSet.fromList smallSet)
21+ ]
benchmarks/TextFastSet.hsnew file+121
@@ -0,0 +1,121 @@
1+{-# LANGUAGE BangPatterns #-}
2+
3+------------------------------------------------------------------------------
4+-- |
5+-- Module : Data.Attoparsec.FastSet
6+-- Copyright : Felipe Lessa 2010, Bryan O'Sullivan 2007-2015
7+-- License : BSD3
8+--
9+-- Maintainer : felipe.lessa@gmail.com
10+-- Stability : experimental
11+-- Portability : unknown
12+--
13+-- Fast set membership tests for 'Char' values. We test for
14+-- membership using a hashtable implemented with Robin Hood
15+-- collision resolution. The set representation is unboxed,
16+-- and the characters and hashes interleaved, for efficiency.
17+--
18+--
19+-----------------------------------------------------------------------------
20+module TextFastSet
21+ (
22+ -- * Data type
23+ FastSet
24+ -- * Construction
25+ , fromList
26+ , set
27+ -- * Lookup
28+ , member
29+ -- * Handy interface
30+ , charClass
31+ ) where
32+
33+import Data.Bits ((.|.), (.&.), shiftR)
34+import Data.Function (on)
35+import Data.List (sort, sortBy)
36+import qualified Data.Array.Base as AB
37+import qualified Data.Array.Unboxed as A
38+import qualified Data.Text as T
39+
40+data FastSet = FastSet {
41+ table :: {-# UNPACK #-} !(A.UArray Int Int)
42+ , mask :: {-# UNPACK #-} !Int
43+ }
44+
45+data Entry = Entry {
46+ key :: {-# UNPACK #-} !Char
47+ , initialIndex :: {-# UNPACK #-} !Int
48+ , index :: {-# UNPACK #-} !Int
49+ }
50+
51+offset :: Entry -> Int
52+offset e = index e - initialIndex e
53+
54+resolveCollisions :: [Entry] -> [Entry]
55+resolveCollisions [] = []
56+resolveCollisions [e] = [e]
57+resolveCollisions (a:b:entries) = a' : resolveCollisions (b' : entries)
58+ where (a', b')
59+ | index a < index b = (a, b)
60+ | offset a < offset b = (b { index=index a }, a { index=index a + 1 })
61+ | otherwise = (a, b { index=index a + 1 })
62+
63+pad :: Int -> [Entry] -> [Entry]
64+pad = go 0
65+ where -- ensure that we pad enough so that lookups beyond the
66+ -- last hash in the table fall within the array
67+ go !_ !m [] = replicate (max 1 m + 1) empty
68+ go k m (e:entries) = map (const empty) [k..i - 1] ++ e :
69+ go (i + 1) (m + i - k - 1) entries
70+ where i = index e
71+ empty = Entry '\0' maxBound 0
72+
73+nextPowerOf2 :: Int -> Int
74+nextPowerOf2 0 = 1
75+nextPowerOf2 x = go (x - 1) 1
76+ where go y 32 = y + 1
77+ go y k = go (y .|. (y `shiftR` k)) $ k * 2
78+
79+fastHash :: Char -> Int
80+fastHash = fromEnum
81+
82+fromList :: String -> FastSet
83+fromList s = FastSet (AB.listArray (0, length interleaved - 1) interleaved)
84+ mask'
85+ where s' = ordNub (sort s)
86+ l = length s'
87+ mask' = nextPowerOf2 ((5 * l) `div` 4) - 1
88+ entries = pad mask' .
89+ resolveCollisions .
90+ sortBy (compare `on` initialIndex) .
91+ zipWith (\c i -> Entry c i i) s' .
92+ map ((.&. mask') . fastHash) $ s'
93+ interleaved = concatMap (\e -> [fromEnum $ key e, initialIndex e])
94+ entries
95+
96+ordNub :: Eq a => [a] -> [a]
97+ordNub [] = []
98+ordNub (y:ys) = go y ys
99+ where go x (z:zs)
100+ | x == z = go x zs
101+ | otherwise = x : go z zs
102+ go x [] = [x]
103+
104+set :: T.Text -> FastSet
105+set = fromList . T.unpack
106+
107+-- | Check the set for membership.
108+member :: Char -> FastSet -> Bool
109+member c a = go (2 * i)
110+ where i = fastHash c .&. mask a
111+ lookupAt j b = (i' <= i) && (c == c' || b)
112+ where c' = toEnum $ AB.unsafeAt (table a) j
113+ i' = AB.unsafeAt (table a) $ j + 1
114+ go j = lookupAt j . lookupAt (j + 2) . lookupAt (j + 4) .
115+ lookupAt (j + 6) . go $ j + 8
116+
117+charClass :: String -> FastSet
118+charClass = fromList . go
119+ where go (a:'-':b:xs) = [a..b] ++ go xs
120+ go (x:xs) = x : go xs
121+ go _ = ""
benchmarks/Tiny.hs+4−4
@@ -1,7 +1,7 @@
1−import Control.Applicative ((<|>))
1+import Control.Applicative ((<|>), many)
2import Control.Monad (forM_)
2import Control.Monad (forM_)
3import System.Environment (getArgs)
3import System.Environment (getArgs)
4−import qualified Data.Attoparsec.Char8 as A
4+import qualified Data.Attoparsec.ByteString.Char8 as A
5import qualified Data.ByteString.Char8 as B
5import qualified Data.ByteString.Char8 as B
6import qualified Text.Parsec as P
6import qualified Text.Parsec as P
7import qualified Text.Parsec.ByteString as P
7import qualified Text.Parsec.ByteString as P
@@ -14,8 +14,8 @@ attoparsec = do
14 A.Done _ xs -> print (length xs)
14 A.Done _ xs -> print (length xs)
15 what -> print what
15 what -> print what
16 where
16 where
17− slow = A.many (A.many1 A.letter_ascii <|> A.many1 A.digit)
17+ slow = many (A.many1 A.letter_ascii <|> A.many1 A.digit)
18− fast = A.many (A.takeWhile1 isLetter <|> A.takeWhile1 isDigit)
18+ fast = many (A.takeWhile1 isLetter <|> A.takeWhile1 isDigit)
19 isDigit c = c >= '0' && c <= '9'
19 isDigit c = c >= '0' && c <= '9'
20 isLetter c = (c >= 'a' && c <= 'z') || (c >= 'A' && c <= 'Z')
20 isLetter c = (c >= 'a' && c <= 'z') || (c >= 'A' && c <= 'Z')
21 p = fast
21 p = fast
benchmarks/Warp.hsnew file+17
@@ -0,0 +1,17 @@
1+{-# LANGUAGE OverloadedStrings #-}
2+
3+module Warp (benchmarks) where
4+
5+import Criterion.Main (bench, bgroup, nf)
6+import Criterion.Types (Benchmark)
7+import Data.ByteString (ByteString)
8+import Network.Wai.Handler.Warp.ReadInt (readInt)
9+import qualified Data.Attoparsec.ByteString.Char8 as B
10+
11+benchmarks :: Benchmark
12+benchmarks = bgroup "warp" [
13+ bgroup "decimal" [
14+ bench "warp" $ nf (readInt :: ByteString -> Int) "31337"
15+ , bench "atto" $ nf (B.parse (B.decimal :: B.Parser Int)) "31337"
16+ ]
17+ ]
benchmarks/attoparsec-benchmarks.cabalnew file+41
@@ -0,0 +1,41 @@
1+-- These benchmarks are not intended to be installed.
2+-- So don't install 'em.
3+
4+name: attoparsec-benchmarks
5+version: 0
6+cabal-version: >=1.6
7+build-type: Simple
8+
9+executable attoparsec-benchmarks
10+ main-is: Benchmarks.hs
11+ other-modules:
12+ Common
13+ HeadersByteString
14+ HeadersByteString.Atto
15+ HeadersText
16+ Links
17+ Numbers
18+ Network.Wai.Handler.Warp.ReadInt
19+ Sets
20+ TextFastSet
21+ Warp
22+ hs-source-dirs: .. . warp-3.0.1.1
23+ ghc-options: -O2 -Wall -rtsopts
24+ build-depends:
25+ array,
26+ base == 4.*,
27+ bytestring >= 0.10.4.0,
28+ case-insensitive,
29+ containers,
30+ criterion >= 1.0,
31+ deepseq >= 1.1,
32+ directory,
33+ filepath,
34+ ghc-prim,
35+ http-types,
36+ parsec >= 3.1.2,
37+ scientific >= 0.3.1,
38+ text >= 1.1.1.0,
39+ transformers,
40+ unordered-containers,
41+ vector
benchmarks/http-request.txtnew file+9
@@ -0,0 +1,9 @@
1+GET / HTTP/1.1
2+Host: twitter.com
3+Accept: text/html, application/xhtml+xml, application/xml; q=0.9, image/webp, */*; q=0.8
4+Accept-Encoding: gzip,deflate,sdch
5+Accept-Language: en-GB,en-US;q=0.8,en;q=0.6
6+Cache-Control: max-age=0
7+Cookie: guest_id=v1%3A139; _twitter_sess=BAh7CSIKZmxhc2hJQz-e1e1; __utma=43838368.452555194.1399611824.1; __utmb=43838368; __utmc=43838368; __utmz=1399611824.1.1.utmcsr=(direct)|utmcmd=(none)
8+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10_8_5) AppleWebKit/537.36 (KHTML, like Gecko) Chrome/35.0.1916.86 Safari/537.36
9+
benchmarks/http-response.txtnew file+14
@@ -0,0 +1,14 @@
1+HTTP/1.1 200 OK
2+Date: Fri, 09 May 2014 04:24:57 GMT
3+Expires: -1
4+Cache-Control: private, max-age=0
5+Content-Type: text/html; charset=ISO-8859-1
6+Set-Cookie: PREF=ID=1a871afc4240db5e:FF:LM=1399609497:S=e5MZ0itEekjVwNcU; expires=Sun, 08-May-2016 04:24:57 GMT; path=/; domain=.google.com
7+Set-Cookie: NID=67=-WlfaDG6VSEPk7abAjrK98HBSoCD2ID6JKkUR95tEumzDmg7Fc8pSQ8; expires=Sat, 08-Nov-2014 04:24:57 GMT; path=/; domain=.google.com; HttpOnly
8+P3P: CP="This is not a P3P policy! See http://www.google.com/support/accounts/bin/answer.py?hl=en&answer=151657 for more info."
9+Server: gws
10+X-XSS-Protection: 1; mode=block
11+X-Frame-Options: SAMEORIGIN
12+Alternate-Protocol: 80:quic
13+Transfer-Encoding: chunked
14+
benchmarks/json-data/example.jsonnew file+88
@@ -0,0 +1,88 @@
1+{"web-app": {
2+ "servlet": [
3+ {
4+ "servlet-name": "cofaxCDS",
5+ "servlet-class": "org.cofax.cds.CDSServlet",
6+ "init-param": {
7+ "configGlossary:installationAt": "Philadelphia, PA",
8+ "configGlossary:adminEmail": "ksm@pobox.com",
9+ "configGlossary:poweredBy": "Cofax",
10+ "configGlossary:poweredByIcon": "/images/cofax.gif",
11+ "configGlossary:staticPath": "/content/static",
12+ "templateProcessorClass": "org.cofax.WysiwygTemplate",
13+ "templateLoaderClass": "org.cofax.FilesTemplateLoader",
14+ "templatePath": "templates",
15+ "templateOverridePath": "",
16+ "defaultListTemplate": "listTemplate.htm",
17+ "defaultFileTemplate": "articleTemplate.htm",
18+ "useJSP": false,
19+ "jspListTemplate": "listTemplate.jsp",
20+ "jspFileTemplate": "articleTemplate.jsp",
21+ "cachePackageTagsTrack": 200,
22+ "cachePackageTagsStore": 200,
23+ "cachePackageTagsRefresh": 60,
24+ "cacheTemplatesTrack": 100,
25+ "cacheTemplatesStore": 50,
26+ "cacheTemplatesRefresh": 15,
27+ "cachePagesTrack": 200,
28+ "cachePagesStore": 100,
29+ "cachePagesRefresh": 10,
30+ "cachePagesDirtyRead": 10,
31+ "searchEngineListTemplate": "forSearchEnginesList.htm",
32+ "searchEngineFileTemplate": "forSearchEngines.htm",
33+ "searchEngineRobotsDb": "WEB-INF/robots.db",
34+ "useDataStore": true,
35+ "dataStoreClass": "org.cofax.SqlDataStore",
36+ "redirectionClass": "org.cofax.SqlRedirection",
37+ "dataStoreName": "cofax",
38+ "dataStoreDriver": "com.microsoft.jdbc.sqlserver.SQLServerDriver",
39+ "dataStoreUrl": "jdbc:microsoft:sqlserver://LOCALHOST:1433;DatabaseName=goon",
40+ "dataStoreUser": "sa",
41+ "dataStorePassword": "dataStoreTestQuery",
42+ "dataStoreTestQuery": "SET NOCOUNT ON;select test='test';",
43+ "dataStoreLogFile": "/usr/local/tomcat/logs/datastore.log",
44+ "dataStoreInitConns": 10,
45+ "dataStoreMaxConns": 100,
46+ "dataStoreConnUsageLimit": 100,
47+ "dataStoreLogLevel": "debug",
48+ "maxUrlLength": 500}},
49+ {
50+ "servlet-name": "cofaxEmail",
51+ "servlet-class": "org.cofax.cds.EmailServlet",
52+ "init-param": {
53+ "mailHost": "mail1",
54+ "mailHostOverride": "mail2"}},
55+ {
56+ "servlet-name": "cofaxAdmin",
57+ "servlet-class": "org.cofax.cds.AdminServlet"},
58+
59+ {
60+ "servlet-name": "fileServlet",
61+ "servlet-class": "org.cofax.cds.FileServlet"},
62+ {
63+ "servlet-name": "cofaxTools",
64+ "servlet-class": "org.cofax.cms.CofaxToolsServlet",
65+ "init-param": {
66+ "templatePath": "toolstemplates/",
67+ "log": 1,
68+ "logLocation": "/usr/local/tomcat/logs/CofaxTools.log",
69+ "logMaxSize": "",
70+ "dataLog": 1,
71+ "dataLogLocation": "/usr/local/tomcat/logs/dataLog.log",
72+ "dataLogMaxSize": "",
73+ "removePageCache": "/content/admin/remove?cache=pages&id=",
74+ "removeTemplateCache": "/content/admin/remove?cache=templates&id=",
75+ "fileTransferFolder": "/usr/local/tomcat/webapps/content/fileTransferFolder",
76+ "lookInContext": 1,
77+ "adminGroupID": 4,
78+ "betaServer": true}}],
79+ "servlet-mapping": {
80+ "cofaxCDS": "/",
81+ "cofaxEmail": "/cofaxutil/aemail/*",
82+ "cofaxAdmin": "/admin/*",
83+ "fileServlet": "/static/*",
84+ "cofaxTools": "/tools/*"},
85+
86+ "taglib": {
87+ "taglib-uri": "cofax.tld",
88+ "taglib-location": "/WEB-INF/tlds/cofax.tld"}}}
benchmarks/json-data/geometry.jsonnew file+1
@@ -0,0 +1 @@
1+{"geometry": {"type": "Polygon", "coordinates": [[[-0.939359853061118, 51.57401065198471], [-0.939440892477492, 51.57431080772057], [-0.939543636564569, 51.57460846194951], [-0.939564627628489, 51.574822653966265], [-0.939763179055758, 51.575406210178826], [-0.939787182642249, 51.575552991614], [-0.939819571231525, 51.57564949527348], [-0.939851290904264, 51.57571272360808], [-0.939975682132949, 51.57588648747347], [-0.940036822193859, 51.57598774653439], [-0.940072640734852, 51.57606090267849], [-0.940109693338918, 51.576205104339515], [-0.940125502187331, 51.57645611534466], [-0.940118623499009, 51.57662779459441], [-0.94008851367835, 51.57680555827417], [-0.939998015208524, 51.57709787034017], [-0.939928028667517, 51.577252794653916], [-0.939830628174189, 51.57740747134858], [-0.939796941313687, 51.57749078985784], [-0.939785586773343, 51.57754463746666], [-0.939770656147318, 51.57769016804059], [-0.939658154074368, 51.57824573765943], [-0.939485738834128, 51.57883313597966], [-0.93945717030888, 51.579192545519916], [-0.939524336079755, 51.57928306919007], [-0.939540939284811, 51.57931379092206], [-0.939553921057406, 51.579748206813974], [-0.939549110634237, 51.57983088690364], [-0.939520940649101, 51.58004913048237], [-0.93951863934971, 51.58014801827346], [-0.939525037302583, 51.580245186310094], [-0.939540364690294, 51.58033074581249], [-0.939561798495469, 51.58040197377017], [-0.939594984852117, 51.58046431619436], [-0.939708262827559, 51.580619996404984], [-0.939729069878358, 51.58065615108302], [-0.939759224390201, 51.58072476025555], [-0.939813615319267, 51.58093026195459], [-0.939900523550716, 51.58172321441459], [-0.939894144544868, 51.581997403240464], [-0.939910832471369, 51.58208657162566], [-0.940114353648015, 51.582457967531546], [-0.94022333049887, 51.58267475179605], [-0.940267247821581, 51.58277225843995], [-0.94038427828014, 51.583077233742756], [-0.940493362377966, 51.583289522851196], [-0.940571515796737, 51.58340442254201], [-0.940725857371931, 51.58359464061899], [-0.941198340240742, 51.584069167875626], [-0.941335307610427, 51.584261925920295], [-0.941372786463165, 51.5843261048293], [-0.941416540699353, 51.58443080287741], [-0.941461326187118, 51.584739621364996], [-0.941517445876004, 51.5849954910945], [-0.941575869597484, 51.58533860085252], [-0.941574762730556, 51.58538624677686], [-0.941565185406358, 51.58542572382202], [-0.941550002863301, 51.58545795698674], [-0.941515976834126, 51.58549361692739], [-0.941470510606583, 51.585524677868065], [-0.941423872780384, 51.585544039043356], [-0.94131509921043, 51.585566436558274], [-0.941075026707647, 51.58558675057684], [-0.940953181611661, 51.58561262652464], [-0.940734943851404, 51.58568708689612], [-0.940229533088359, 51.585883040066975], [-0.940067635923264, 51.58595531027499], [-0.939917220191166, 51.58603038143916], [-0.939797255285709, 51.586099433232604], [-0.939675637701456, 51.586177461657186], [-0.939611074554604, 51.58622273608784], [-0.939340396866166, 51.586441486256], [-0.93912244296424, 51.58662744303347], [-0.938817233975319, 51.58671729893312], [-0.938661522913105, 51.586771639765516], [-0.938087678078033, 51.586992141762096], [-0.937332636663603, 51.5873072119485], [-0.93492634290483, 51.58836081134952], [-0.934774110277819, 51.58845114531925], [-0.934663126573178, 51.588505886685766], [-0.934565467487243, 51.588546362183585], [-0.934462140700832, 51.588582290320545], [-0.934337145222589, 51.58861892084846], [-0.934213782000904, 51.588647473549656], [-0.934055887760941, 51.588671216763295], [-0.933259701136762, 51.58864510257983], [-0.933213278816969, 51.588716614209304], [-0.932681740160827, 51.588792708227174], [-0.931992471253759, 51.58900853446031], [-0.930629113767652, 51.58946908647644], [-0.928525036745892, 51.59005953842682], [-0.928533690860491, 51.59024394687689], [-0.928456010745829, 51.59047792078815], [-0.928256501298223, 51.5906748158337], [-0.927916132025856, 51.59066181734799], [-0.927671608556404, 51.590624516635486], [-0.927319567022116, 51.59061680481465], [-0.926850285435352, 51.59062240702726], [-0.926313746570405, 51.59066425819173], [-0.925516790702947, 51.59079184232522], [-0.925387133168341, 51.59078076476673], [-0.925293323156809, 51.59077990606886], [-0.925202187496562, 51.59078806346173], [-0.925112304116411, 51.59080432476366], [-0.925036768134577, 51.59082431403807], [-0.924968299737815, 51.59085066215826], [-0.924899640304234, 51.59088510100373], [-0.924851228495836, 51.590917926896914], [-0.924734051019008, 51.59105082982951], [-0.924694255912291, 51.59108553291224], [-0.924446018071168, 51.59126668934789], [-0.924204972773907, 51.59150995377465], [-0.923492520665307, 51.59215352189589], [-0.922775141969353, 51.59288246146081], [-0.922298613651092, 51.59343737077436], [-0.922101568270595, 51.59365046303728], [-0.92149319027045, 51.59422483935332], [-0.921029930136652, 51.59464499018023], [-0.919455791303858, 51.595519790418045], [-0.919908472816787, 51.59560757835559], [-0.919902358174605, 51.595621908790214], [-0.919721503870405, 51.59588190272939], [-0.919513222918683, 51.59614164398608], [-0.919057326435374, 51.59661490568889], [-0.918991959815932, 51.59669253146064], [-0.918853979663433, 51.59690975873926], [-0.91882720841051, 51.59694278142396], [-0.918711889332325, 51.597056812913756], [-0.918614808732714, 51.59713234806153], [-0.918297245740306, 51.59749448485627], [-0.918073703114389, 51.59778825130676], [-0.917853804369843, 51.59811082427763], [-0.917772408698363, 51.59831598343439], [-0.917709563771812, 51.59853030520902], [-0.917692745480418, 51.59856971355161], [-0.917634249201942, 51.59866178857289], [-0.917443039919903, 51.59887043094418], [-0.917335250471836, 51.598971042984616], [-0.916888284039272, 51.599309503426845], [-0.916921110547038, 51.59938623548714], [-0.916942485633783, 51.5995195094582], [-0.916937652924948, 51.599601289122916], [-0.916945811778801, 51.599683188627004], [-0.916964246289877, 51.599757989575366], [-0.917049297107238, 51.59994580090974], [-0.917089705367533, 51.60000731699611], [-0.917171120773417, 51.60010517795964], [-0.91752823274465, 51.60044925531009], [-0.917834023417531, 51.600765883511485], [-0.917913079603466, 51.600902386385464], [-0.918033251654948, 51.60107073894696], [-0.91851090277833, 51.601507638962644], [-0.918694916056997, 51.601663091331545], [-0.919167224655989, 51.60214309940451], [-0.919302231291783, 51.6024167896932], [-0.919552009673002, 51.60266096432073], [-0.919812571846437, 51.60293760761218], [-0.920091738726093, 51.60358667644501], [-0.920208566517809, 51.603592246724574], [-0.920644522919282, 51.60359715428394], [-0.921093152621479, 51.6036156641763], [-0.921168285587618, 51.603613657034074], [-0.921469264587163, 51.6035867495928], [-0.921584776688781, 51.603586911416876], [-0.921718864440287, 51.603595336217005], [-0.921999521996191, 51.60363387995426], [-0.922136050325758, 51.603661209181794], [-0.922248015684399, 51.60368921195661], [-0.922346882036963, 51.60372159023333], [-0.922478548042792, 51.60377135359644], [-0.922605777045377, 51.603825571929555], [-0.92269948345521, 51.60389297005248], [-0.922855181916126, 51.60396453348124], [-0.922908065211369, 51.60398749776935], [-0.923525984356841, 51.604174796116844], [-0.923689774691443, 51.6042095667925], [-0.923842334751645, 51.60423074681459], [-0.924020987014581, 51.604247669912816], [-0.924152253615336, 51.604253368572344], [-0.924379056519158, 51.60424915231234], [-0.924491916632975, 51.60423939614583], [-0.925129396784027, 51.604149022807746], [-0.925308707040747, 51.60413807581467], [-0.925396812395019, 51.604137083863186], [-0.925816640142735, 51.60415261457396], [-0.926339243350925, 51.604157394450915], [-0.926627592983669, 51.60417621577326], [-0.928219342008724, 51.60433911850777], [-0.928540897883304, 51.60435823822504], [-0.928666454251138, 51.6043611822271], [-0.928925123731038, 51.60435275210506], [-0.929272427371303, 51.60432085222454], [-0.929350681081097, 51.604308977474346], [-0.929525019586135, 51.60426381040009], [-0.929730308556221, 51.60419195021111], [-0.929806393059037, 51.60414948374236], [-0.929854111423592, 51.60408517871234], [-0.929877477717563, 51.604012559228565], [-0.929880189120251, 51.60395863398061], [-0.930157001898001, 51.603362311928585], [-0.930233415197893, 51.60324431822904], [-0.930397156019029, 51.60303540508514], [-0.93058677482955, 51.602831223239896], [-0.930747612253953, 51.60268432562219], [-0.931065151604954, 51.602443542878724], [-0.931358556224333, 51.60224659876122], [-0.931494751600125, 51.602165114969594], [-0.931807666849096, 51.601998019766675], [-0.932115553298882, 51.60186055047904], [-0.932344261944379, 51.601774512081256], [-0.932581062209752, 51.601712824287226], [-0.932837650566022, 51.60166929919289], [-0.93304760157037, 51.60164423223924], [-0.933247236692325, 51.60162806284857], [-0.933524572231589, 51.601623388892406], [-0.93367307135076, 51.60163283011416], [-0.933854562367985, 51.601651562386515], [-0.934222940436163, 51.60170526005669], [-0.934582321335698, 51.60177326158339], [-0.935176916778695, 51.60190903449902], [-0.935323237909383, 51.60194992468383], [-0.935449328012611, 51.60199153042619], [-0.935555166022244, 51.60203475076641], [-0.935754957696255, 51.60213547009268], [-0.935920944220561, 51.60219991608389], [-0.936105992086264, 51.60225194623237], [-0.936251123590137, 51.60228203448254], [-0.9362553703842, 51.602285669620606], [-0.935954861941404, 51.603034649313756], [-0.936025513047831, 51.60328615677915], [-0.937604653681525, 51.60374194595848], [-0.937842729718605, 51.6037494948452], [-0.937998245297976, 51.60376798569096], [-0.938149157504488, 51.60379812385097], [-0.938282536474463, 51.60383709493093], [-0.938398403200176, 51.60388400001471], [-0.938549544157173, 51.60396629131982], [-0.938542113846477, 51.60403725821696], [-0.938540670189083, 51.60403724516617], [-0.938690470772444, 51.60417707075241], [-0.93885671831091, 51.60429276731543], [-0.938949655717409, 51.60433227129961], [-0.939171393952754, 51.60435945147724], [-0.939491406642938, 51.60438302306183], [-0.939580914110842, 51.60438383145672], [-0.939698081584302, 51.604374998744255], [-0.939860253923854, 51.60435578228165], [-0.940131370864495, 51.60430877574863], [-0.940224037565311, 51.60429792302206], [-0.941065905352937, 51.604358569226044], [-0.941456261791824, 51.60439985396626], [-0.94172260946072, 51.604433725629356], [-0.942065117075164, 51.604483568721975], [-0.942405972956444, 51.60454238758566], [-0.942542307804962, 51.60457868292929], [-0.942668453620936, 51.60461848302318], [-0.942754322773386, 51.60465162617505], [-0.942930037674105, 51.6047332338937], [-0.94300827141212, 51.60478429141865], [-0.943050642772121, 51.60482513526179], [-0.943095505071305, 51.604883085645305], [-0.943175837511794, 51.60503037259752], [-0.943199044776033, 51.60508812802956], [-0.943264927978451, 51.605360268787045], [-0.94328295289835, 51.6055168856955], [-0.943285556153251, 51.605653582182974], [-0.94327790338372, 51.60573443814757], [-0.943262026480571, 51.60579633763445], [-0.943228365851772, 51.605877858692274], [-0.943092212068021, 51.60614458434088], [-0.943074097962666, 51.60624063192375], [-0.943061365824471, 51.606415854446915], [-0.943044862244347, 51.60650472320056], [-0.943017897594943, 51.606608783583646], [-0.942979591589439, 51.606703750216774], [-0.942905884027612, 51.60683076806164], [-0.942741267849139, 51.60707925374213], [-0.942655006715899, 51.607249318295594], [-0.942630361430127, 51.60731563455148], [-0.942616263944651, 51.607425205688976], [-0.942621958529523, 51.60749089598715], [-0.942636336634899, 51.60755576531453], [-0.942660904708633, 51.607617129739225], [-0.942696981288364, 51.607680396114986], [-0.942747433102709, 51.60774648940761], [-0.942856244975984, 51.6078490746924], [-0.94299552290573, 51.60794563997599], [-0.943040847342192, 51.60798381288104], [-0.943186973159248, 51.608158666884215], [-0.943285889122319, 51.60825217104693], [-0.943509689787491, 51.60844031193307], [-0.94379690141149, 51.609007570967925], [-0.943824004868445, 51.60908424372538], [-0.943831400135399, 51.609201201602104], [-0.943839541642426, 51.60922375393887], [-0.943852077204152, 51.6092436483043], [-0.943874740412961, 51.60926273459518], [-0.943900416430683, 51.60927645299323], [-0.944008015202393, 51.60930709311221], [-0.944074894993692, 51.60934995527111], [-0.944126815315737, 51.60941516198104], [-0.944143328071964, 51.60945037786937], [-0.944150844233183, 51.609499899486615], [-0.944148608042361, 51.60953404761941], [-0.944074023202655, 51.60969882315075], [-0.94403415265091, 51.60986121332522], [-0.944017357658548, 51.60996266784037], [-0.943992023164905, 51.61030771903426], [-0.943965568458423, 51.61051428886229], [-0.943938629028152, 51.61067949277199], [-0.943919488028492, 51.61075754789674], [-0.943885949921455, 51.61083367520212], [-0.943827406881077, 51.61092935920088], [-0.943739589608875, 51.61104186395993], [-0.943638735204063, 51.61115604969767], [-0.943533757272514, 51.611261206608894], [-0.942952360107171, 51.61179457356613], [-0.942768364001955, 51.61194397664764], [-0.942436714102017, 51.61217027698273], [-0.942010518369458, 51.61248743929258], [-0.941742162181165, 51.61266215641604], [-0.941369087685306, 51.61286829880399], [-0.941218061678922, 51.612965845186196], [-0.941055044244821, 51.613082165678385], [-0.940962318642569, 51.61315685920963], [-0.940802313735133, 51.613329853845215], [-0.940532273923746, 51.613638528438315], [-0.940201080800705, 51.61403027273604], [-0.940058816377521, 51.614185443187054], [-0.939985695447699, 51.614286388653916], [-0.939953592073967, 51.614362527773245], [-0.939906859457064, 51.614508669589505], [-0.939802341993177, 51.61490335803689], [-0.939554942446072, 51.615603370947234], [-0.939452722231603, 51.61596121406953], [-0.939421935085161, 51.61604275989804], [-0.939387192811998, 51.616108085051245], [-0.939207265482904, 51.61639149465681], [-0.939036585027605, 51.61671185322904], [-0.938852844916865, 51.61697274874371], [-0.938765881571911, 51.61710953487875], [-0.938636321443754, 51.617400592062225], [-0.93858227703968, 51.617550263869646], [-0.938563060896774, 51.61763101488344], [-0.938557821588965, 51.617793716095726], [-0.938568952285691, 51.6178738422429], [-0.938586194898738, 51.61793963701825], [-0.93864824402059, 51.61806608070808], [-0.938712639101221, 51.61815388154161], [-0.938801458484915, 51.61824729803767], [-0.938902019778203, 51.61833272809444], [-0.939001577491258, 51.61839926656718], [-0.939080060597956, 51.6184404379885], [-0.939144458958051, 51.618466196342986], [-0.93924483456823, 51.61849767462955], [-0.939389936057716, 51.61853135511866], [-0.939533886937889, 51.618552436752374], [-0.939605967169062, 51.618558482633226], [-0.939704125343146, 51.618561167280205], [-0.940011869234288, 51.61855765138392], [-0.940970156479417, 51.61846828865034], [-0.942814559287174, 51.61834913395653], [-0.9433943585448, 51.61832378069166], [-0.943791844341078, 51.61831207069643], [-0.944095316626396, 51.61830580819228], [-0.944345189840605, 51.61830625638639], [-0.944633949874169, 51.618311549349706], [-0.944866264500346, 51.618321729423634], [-0.945069571918896, 51.61833704343469], [-0.945259736594118, 51.618358533188456], [-0.945405071369022, 51.6183823175338], [-0.945538707551366, 51.61841229079249], [-0.945670733169093, 51.618449442740584], [-0.945789657802543, 51.61849097274293], [-0.945898390514756, 51.618536007789324], [-0.946002624502939, 51.61858819565799], [-0.946144975691139, 51.61867849034559], [-0.946290660655923, 51.61881197458077], [-0.946424293873759, 51.618966930407886], [-0.94648587943588, 51.619052004215185], [-0.946597289998464, 51.61923103785771], [-0.946748500992991, 51.619500344620654], [-0.946865282768134, 51.619759451627154], [-0.94692090631825, 51.619852564183816], [-0.946986743272162, 51.619941272483025], [-0.947121992710119, 51.62008904866086], [-0.947221067183078, 51.620177155655796], [-0.947357337089385, 51.62028088174252], [-0.947636341593443, 51.62045871900467], [-0.947732020809812, 51.62050633282523], [-0.947832261440868, 51.62054409665008], [-0.948024909405708, 51.6205835873772], [-0.948272727755043, 51.62061098363029], [-0.94903310890345, 51.62064836261257], [-0.949342820854191, 51.62068530212313], [-0.949548509996597, 51.62072310869445], [-0.949603327033706, 51.620726296510135], [-0.94966121922192, 51.62072141934501], [-0.949725095662238, 51.62070760405018], [-0.949813979767225, 51.620674230793945], [-0.949850856696741, 51.620766275113425], [-0.949938127431095, 51.62092800552347], [-0.95012170684362, 51.62142328688538], [-0.950137689181391, 51.621481875301626], [-0.950144591409982, 51.621558365780544], [-0.950143525838059, 51.62166715485939], [-0.950086848280287, 51.62218276713024], [-0.950081566444785, 51.62234906486587], [-0.950091380322934, 51.6227375905417], [-0.950012857804674, 51.623198158520914], [-0.949963053357781, 51.62366617649237], [-0.94993621019599, 51.62382778558582], [-0.949887611273865, 51.62405573809743], [-0.94981748429385, 51.62434014525264], [-0.949698012983878, 51.6246969431444], [-0.949601071539472, 51.62520410239216], [-0.949519655994856, 51.62547671925938], [-0.949509640700394, 51.62553507516918], [-0.949509569744091, 51.62560071332227], [-0.949517625184728, 51.6256898023632], [-0.949539397678852, 51.62581048474923], [-0.949602831958219, 51.626066413978656], [-0.949622600072634, 51.6262113557699], [-0.949625807500304, 51.62644786389373], [-0.949588359660548, 51.62688092470566], [-0.949587162842075, 51.62718303218221], [-0.949593421398238, 51.627287390862], [-0.949641886384285, 51.62762860642186], [-0.949677564559904, 51.627772791296934], [-0.949732061930258, 51.62791534613564], [-0.949847071945823, 51.62812767746571], [-0.95005020451512, 51.62890367131774], [-0.949860358893705, 51.62924185674224], [-0.949849459019953, 51.62927592739189], [-0.949848649628705, 51.62931098742953], [-0.949857806222275, 51.62935243070728], [-0.949882540677514, 51.62940750068883], [-0.949782851646605, 51.62940750843079], [-0.949684104107472, 51.6296170289926], [-0.949619670293909, 51.62984214210067], [-0.949589348281571, 51.62990391300069], [-0.949478823262764, 51.63006027755304], [-0.949419643728549, 51.63018293320961], [-0.949378577882241, 51.63033452402259], [-0.949364251310331, 51.63051692549393], [-0.949339228920643, 51.63059942443184], [-0.949248633732607, 51.63076855530058], [-0.949181283974238, 51.630869557872636], [-0.949044504574139, 51.63103647701982], [-0.948893935504611, 51.63136242402941], [-0.948761069414249, 51.631297394415576], [-0.948669492362367, 51.63125880992652], [-0.948537801268757, 51.63120547966423], [-0.948447461288637, 51.63117589768262], [-0.948353982967507, 51.63115707745748], [-0.948302104865814, 51.63115121794117], [-0.948079606840815, 51.63115102360314], [-0.947964190602531, 51.63114369566099], [-0.94782149485015, 51.63112892992514], [-0.947725107052886, 51.63111098229264], [-0.947684910040859, 51.63109983219839], [-0.947483021604023, 51.63102069524269], [-0.947447137482345, 51.63101048287877], [-0.947306094892948, 51.630986739722026], [-0.947000710620611, 51.63094713644845], [-0.946674033898238, 51.6308911565172], [-0.946364247153943, 51.63079216747898], [-0.946230490849763, 51.63076579091048], [-0.946172752135344, 51.63076347450912], [-0.94612066649297, 51.630766603772976], [-0.945914796224295, 51.63079712600587], [-0.94583241748209, 51.63079818492752], [-0.945382953779145, 51.63067905708907], [-0.945085984219956, 51.63058827220451], [-0.944883205963743, 51.630547786680644], [-0.944304065189339, 51.630538086402446], [-0.94394898927073, 51.630523204990325], [-0.943611477254356, 51.63049858971805], [-0.943603681926519, 51.6307098224617], [-0.943277115569317, 51.63102249010073], [-0.943359247728321, 51.63109426279834], [-0.942862682241593, 51.631385618132356], [-0.942777562378065, 51.63144239822567], [-0.942532313252267, 51.63161282917167], [-0.942337892928893, 51.63177202827151], [-0.94226606523137, 51.631816339444626], [-0.942197377359527, 51.63184988892168], [-0.942115813951467, 51.631877927416205], [-0.941937005967162, 51.631924871353945], [-0.941512981586086, 51.63201636159427], [-0.94144898217334, 51.6320346671529], [-0.94125937051438, 51.632111184999914], [-0.940790185204025, 51.6323425346351], [-0.940501042462563, 51.632535943664614], [-0.940243238615803, 51.63268647504363], [-0.940131608045529, 51.632764593869275], [-0.939328651391563, 51.63361514453957], [-0.939011405652477, 51.634145481445906], [-0.93882930544315, 51.63451878632893], [-0.93850479164515, 51.63486472819315], [-0.93841585373771, 51.63483694950617], [-0.938308667759282, 51.63503379600045], [-0.938237520065274, 51.63511048065125], [-0.938174497877949, 51.635148574806536], [-0.938097155068085, 51.63518114448376], [-0.938014243480848, 51.63520467214815], [-0.937885103100742, 51.635227781700706], [-0.937899482630853, 51.63529265131639], [-0.937852791962712, 51.635312010611116], [-0.937756752174709, 51.63534081433219], [-0.93768849662133, 51.635355482713884], [-0.937445207164159, 51.63537845841074], [-0.937282775985471, 51.6354039635962], [-0.936848828519967, 51.635485456519916], [-0.935951432459366, 51.63561220386278], [-0.935719677036262, 51.635636179646525], [-0.935420148631615, 51.63565414571281], [-0.935249454884316, 51.63560044703531], [-0.935077590540852, 51.635535048401415], [-0.934717727795324, 51.63535285185533], [-0.934413155884105, 51.635216113905294], [-0.934240481559584, 51.635123731852076], [-0.934130824273522, 51.63505529964683], [-0.934018404467151, 51.63498144729724], [-0.93379675026591, 51.63482118293064], [-0.933679892303923, 51.6347517857655], [-0.933595523374065, 51.63471415412531], [-0.933350473747258, 51.63462740768713], [-0.933261876876166, 51.63458524160035], [-0.933052343088727, 51.63446285066096], [-0.932887751506176, 51.63439571653097], [-0.932638117941304, 51.63431971687678], [-0.932307197466639, 51.63419801967628], [-0.931343887912331, 51.63380981222079], [-0.931071830619705, 51.63376597498289], [-0.930956833347264, 51.63374065092008], [-0.930823331188951, 51.63370346918478], [-0.930701576222194, 51.633658301797674], [-0.930601553796263, 51.63361063468632], [-0.930506119022842, 51.63355221932683], [-0.930386739592999, 51.633467510133144], [-0.930286034494439, 51.633387466714524], [-0.930225334024314, 51.63332666999925], [-0.930188937852857, 51.633276884582266], [-0.930114567680391, 51.63312155131756], [-0.92999324620862, 51.63293521875163], [-0.929900400330813, 51.63282827174111], [-0.929602366751531, 51.6325378240622], [-0.929499431873266, 51.632429885607195], [-0.929341000864788, 51.63222433167361], [-0.929059923028374, 51.631889079042224], [-0.928963213558906, 51.63176231446386], [-0.928896162303318, 51.6316645934755], [-0.928844852932023, 51.631573310156845], [-0.928688841592085, 51.63126527289447], [-0.928672375509884, 51.6312282570475], [-0.928615004479859, 51.631026321392014], [-0.928599834825331, 51.63099561149414], [-0.928552267379979, 51.63092953870757], [-0.928477466267079, 51.630854225808044], [-0.928389580173335, 51.630782390113474], [-0.928294323595921, 51.6307167812279], [-0.928190294396403, 51.63065558801307], [-0.928078937075949, 51.630598823630024], [-0.927494137115659, 51.630339021667446], [-0.927177150281751, 51.63017967221046], [-0.927053070740772, 51.63011110151437], [-0.926922044883713, 51.63003077810591], [-0.926774152423019, 51.6299305188448], [-0.926569924361936, 51.62976860145066], [-0.926465515994788, 51.62966244509719], [-0.926222881099496, 51.62935271335746], [-0.925807083215573, 51.62885077488713], [-0.925685153671251, 51.62869140695483], [-0.925627779063265, 51.628612654944924], [-0.925107975398826, 51.62780494620014], [-0.925039238852947, 51.627717997425265], [-0.924853081975605, 51.627525670804864], [-0.924566287633664, 51.62725149768458], [-0.924018135317732, 51.62666651663998], [-0.9236755124427, 51.62631000590676], [-0.923506463123086, 51.62618886774415], [-0.92325024557972, 51.62602736696645], [-0.923179326155173, 51.62597186775246], [-0.923151247824846, 51.62593744208942], [-0.923025917353845, 51.62573937605691], [-0.922746731858051, 51.625388839233764], [-0.922647729925315, 51.625421200084226], [-0.922438316532782, 51.62517470633975], [-0.922266691774008, 51.62491866820555], [-0.922176577184834, 51.624819832363215], [-0.921722712186069, 51.62440384906751], [-0.921324388846087, 51.624082786314446], [-0.921078577970903, 51.623909687134365], [-0.920860652296657, 51.62377910436709], [-0.920574889783577, 51.623646099345635], [-0.920239048968319, 51.623492851580735], [-0.920014292502202, 51.62371107994427], [-0.919774493442185, 51.623954346092496], [-0.9196346398006, 51.62406455586703], [-0.919395541436808, 51.62427815528515], [-0.919291601043514, 51.624396787581134], [-0.919216417933559, 51.6245210794288], [-0.919153464283899, 51.62467785367513], [-0.919134125069682, 51.624762197061855], [-0.919115026043568, 51.62495803894169], [-0.919049238753011, 51.62517323267518], [-0.919009465019033, 51.625266379578875], [-0.918926652164549, 51.625407685106715], [-0.91889138185638, 51.62549368011671], [-0.918887531877765, 51.62553410703284], [-0.918896749679156, 51.62569334383204], [-0.918892707420934, 51.62574186144837], [-0.918872585162246, 51.62579832350382], [-0.918836276012485, 51.62586722482348], [-0.918763089019947, 51.62596815648993], [-0.918486277330256, 51.626309088016214], [-0.918317614737411, 51.62653682130949], [-0.917905561785174, 51.626975413689514], [-0.917718470441796, 51.62724883363936], [-0.917588198962995, 51.627380709193844], [-0.917518986462533, 51.627435819379606], [-0.917391270738013, 51.627520961779815], [-0.916852199941663, 51.62783249660931], [-0.916708494011591, 51.62822500463541], [-0.916564194300437, 51.62882431452802], [-0.91642514281193, 51.62950639562586], [-0.916399138398425, 51.62974892972319], [-0.916394191477189, 51.62995659074321], [-0.917260413231125, 51.62992321851857], [-0.917422640699178, 51.63166639247214], [-0.91745600722272, 51.63232848375385], [-0.917204699151121, 51.632324368705305], [-0.916787813832452, 51.632356490901394], [-0.916473041038736, 51.63240843616508], [-0.91615824611563, 51.63246127954521], [-0.916096846672852, 51.632491284427324], [-0.916000979824314, 51.632573122584574], [-0.916035541448316, 51.63300234215989], [-0.916058746179642, 51.633180590521675], [-0.916070697537387, 51.63322475979131], [-0.916098260729099, 51.63328076225654], [-0.916287121367376, 51.6334803208717], [-0.916556537933578, 51.63369500893812], [-0.916833436931067, 51.63389897542989], [-0.916980624704717, 51.63396776999687], [-0.917236275570907, 51.634093312450645], [-0.91746761535009, 51.63414759643489], [-0.917599467742121, 51.63382870989293], [-0.917652284973834, 51.63367364156546], [-0.917677934007693, 51.63362802065708], [-0.917745133700401, 51.63359716923921], [-0.917749446066394, 51.633598108140106], [-0.917778102484095, 51.633608262991594], [-0.918084580428658, 51.633662338963], [-0.918258883815884, 51.633684625273325], [-0.918506861448772, 51.63370758977881], [-0.918953829589691, 51.63374767133924], [-0.919245145699076, 51.633771033193085], [-0.919300707852053, 51.63386505735126], [-0.919518444759651, 51.63449197843591], [-0.919277685382965, 51.63446908250848], [-0.919031520477806, 51.63467362436313], [-0.918786199566619, 51.63490335001199], [-0.918632752044247, 51.63503681158531], [-0.918623327237537, 51.63512933850577], [-0.918590569006466, 51.635413172104], [-0.918679820058316, 51.63554886817429], [-0.918329488250497, 51.63557621368664], [-0.918276435808259, 51.635741170885815], [-0.918247752304029, 51.6360358318421], [-0.918226764712395, 51.6364321689642], [-0.918316733144818, 51.63702374696847], [-0.918287332378286, 51.63783452012518], [-0.918306713699577, 51.63835621240955], [-0.918316674296085, 51.639213205140855], [-0.918347519668651, 51.639799742499974], [-0.918322169732004, 51.63995416480466], [-0.918318885834364, 51.64003146244247], [-0.91832686087795, 51.64012145202931], [-0.91837911416845, 51.640354816042915], [-0.918418495846573, 51.64070405330022], [-0.918530296534871, 51.64128953760163], [-0.918512952473936, 51.64147190762244], [-0.918367217757134, 51.64200916315153], [-0.917905817511154, 51.6420255938785], [-0.917874522823857, 51.64200462484983], [-0.9178264462409, 51.64196012300076], [-0.917792775459127, 51.641917552189355], [-0.917773553228143, 51.64187511449974], [-0.917765526057023, 51.64184806570082], [-0.917757894232724, 51.6417436926823], [-0.917749532884981, 51.64142711089125], [-0.917739557627689, 51.64136048104305], [-0.917720785029217, 51.641299165096676], [-0.917688816437575, 51.64124581999865], [-0.917649452591449, 51.641199600032465], [-0.917568381483579, 51.64114490323613], [-0.917433423830488, 51.64098630616572], [-0.917315173490429, 51.64079369481265], [-0.916601390868836, 51.640243120219885], [-0.916329281834837, 51.640018517003504], [-0.916001068304932, 51.63966211774633], [-0.915790319174844, 51.63947044935813], [-0.915502073944432, 51.63913509831614], [-0.915393357554307, 51.63902799332443], [-0.915169439572157, 51.63884339546647], [-0.914312592230519, 51.638234837864296], [-0.913969150495335, 51.63797270396478], [-0.913808719070197, 51.63773204326735], [-0.913709021859032, 51.63761063348384], [-0.913238840648949, 51.637814889395024], [-0.912211197236081, 51.63818662075986], [-0.912057780107923, 51.6382571327065], [-0.911911629192503, 51.63832591344631], [-0.911683066608314, 51.6384568717294], [-0.911571655864317, 51.638583520328496], [-0.910821072629623, 51.63897039510019], [-0.910799442348496, 51.63890815232427], [-0.910457034748542, 51.63884473254883], [-0.90959863753988, 51.63872527019996], [-0.909397970101408, 51.639078576087414], [-0.909048252097236, 51.63925965643008], [-0.909362542404515, 51.63959166868019], [-0.90780907162756, 51.64013291512084], [-0.906217399025103, 51.640939038154336], [-0.905898125060113, 51.64111499768922], [-0.905490384709512, 51.641363863281036], [-0.905329841704473, 51.64154939281248], [-0.905189541321435, 51.641794455508446], [-0.90489098319803, 51.64194992468491], [-0.904781623731163, 51.641990266433346], [-0.904676706895303, 51.64202615370086], [-0.904609919053975, 51.64203901826923], [-0.904237228330216, 51.64209218907456], [-0.90337364044862, 51.64224597828853], [-0.902975191138407, 51.642348358507896], [-0.90292303291413, 51.6422939216028], [-0.902563354675933, 51.64240655335107], [-0.902346768622897, 51.642458479170756], [-0.900824166346957, 51.64291090498388], [-0.900831401206159, 51.64297031739377], [-0.900456613238591, 51.64299018760407], [-0.900019098619797, 51.64297440185565], [-0.899740380937974, 51.64290615240652], [-0.899740489711103, 51.64290165761423], [-0.899316872364163, 51.642849133775655], [-0.899203336991784, 51.642822893203494], [-0.898949902655656, 51.64272520647125], [-0.898783095909619, 51.642631028913314], [-0.898613530793898, 51.64253143027416], [-0.898274969154989, 51.64230885935864], [-0.898003026265053, 51.642080618381755], [-0.897815191816853, 51.641840577798526], [-0.897681652652772, 51.6416262230417], [-0.897327401428262, 51.64091885338664], [-0.896908641882592, 51.6401308512027], [-0.896689777704333, 51.63985994571793], [-0.896199107519928, 51.639356299928586], [-0.896147069948886, 51.63929736526477], [-0.896071667668875, 51.63912941223961], [-0.896034388155249, 51.63881974973283], [-0.89604243255033, 51.63866696761571], [-0.896079873457203, 51.63849378104931], [-0.896158355572289, 51.63829670279626], [-0.896345617779906, 51.63796397393339], [-0.896436991088377, 51.637771512438086], [-0.896627579786388, 51.63748017587825], [-0.896853716275347, 51.63721255114492], [-0.896930541034958, 51.63714313797598], [-0.897052325259386, 51.63706695367484], [-0.897622203318074, 51.636806151704704], [-0.897875248140837, 51.636679946210485], [-0.898045509693898, 51.63657094674504], [-0.898161794997489, 51.63648302058021], [-0.898300490282884, 51.636364732965696], [-0.898761753797595, 51.63587451909389], [-0.898944791614438, 51.635595696246455], [-0.899167964890093, 51.63497197055003], [-0.899296205851425, 51.63450920414348], [-0.899574174378538, 51.633591065468096], [-0.89965934952667, 51.63323579470252], [-0.899745200652967, 51.632733067337156], [-0.89977291429982, 51.632065248259224], [-0.899749317297925, 51.63190587518938], [-0.899730833669311, 51.631833768913715], [-0.899698165870897, 51.631750739777836], [-0.89965967663145, 51.63166945441679], [-0.899415121605884, 51.63126703489972], [-0.899342021743563, 51.6311233827535], [-0.899274678557411, 51.630980683675816], [-0.899221406706553, 51.63067446858268], [-0.899099405183406, 51.63046202142283], [-0.899036514315775, 51.63037421293725], [-0.898969246754073, 51.63028816171176], [-0.898790586842518, 51.63008867047265], [-0.898592010806669, 51.62987640386868], [-0.898497321924236, 51.62978919602221], [-0.898330098469121, 51.62965455114822], [-0.898092642525963, 51.62949676796704], [-0.897090362270362, 51.62894426419184], [-0.896737033461809, 51.62879887742956], [-0.896347312922056, 51.6286648367393], [-0.895633444660858, 51.62837398981453], [-0.895432402381131, 51.628264199314984], [-0.895328663542796, 51.62819308870188], [-0.895257753282041, 51.62813847178444], [-0.895144755729953, 51.62803220648194], [-0.894948239644532, 51.627795675481295], [-0.894944118635818, 51.62766795529761], [-0.894659948504904, 51.62723368184], [-0.894597856997988, 51.62711350846984], [-0.894557343909314, 51.62699713484451], [-0.894469809950127, 51.62655661915932], [-0.894297931114171, 51.625960652861906], [-0.894027819576293, 51.62530531541029], [-0.893931965007508, 51.62514795788166], [-0.893770350871199, 51.62496210671055], [-0.893637995566781, 51.62476124514902], [-0.893507481839104, 51.62466290563429], [-0.892108104715385, 51.62369479825078], [-0.891788795844237, 51.623459800649094], [-0.891922368328922, 51.62337294285213], [-0.891402229815371, 51.62296161084893], [-0.891224922435199, 51.622768414566416], [-0.890089770742591, 51.621276764770215], [-0.890188416566163, 51.62120036880181], [-0.889947380146256, 51.62101466068101], [-0.889727152716072, 51.62086421627997], [-0.889328903798693, 51.62066892786315], [-0.889153387824523, 51.620758083474584], [-0.888409981594066, 51.6201459098237], [-0.888016456293258, 51.619876030785385], [-0.887588982852847, 51.619754191291285], [-0.887143566599165, 51.61965735685454], [-0.88701981132148, 51.61963820065132], [-0.886790744842007, 51.619613550199404], [-0.886603228328527, 51.619602780759124], [-0.886388075513318, 51.619599841439666], [-0.886090409498186, 51.61960421155123], [-0.8851368584814, 51.61967159165818], [-0.883828125903616, 51.61979133688442], [-0.883515973065361, 51.619797361107345], [-0.883424375160774, 51.6198216668555], [-0.883259776293847, 51.619877648328995], [-0.883163867754863, 51.61990101371408], [-0.883044634749604, 51.619815357981636], [-0.881854770311083, 51.61956485587701], [-0.881704286246311, 51.61951666620604], [-0.881635675440863, 51.619487239450166], [-0.881560131370525, 51.619446057447796], [-0.881477720403852, 51.619390423316226], [-0.881374708667671, 51.619291432867335], [-0.880834298239682, 51.61853547912722], [-0.880617549323506, 51.618127888748454], [-0.880388345702594, 51.61816796449318], [-0.879226788544387, 51.6185884841998], [-0.878534686661489, 51.61883184500677], [-0.878385021629543, 51.61898507235025], [-0.878148819949825, 51.61913297697072], [-0.878102165244257, 51.61915051459153], [-0.87804120240859, 51.61916252048532], [-0.877967464227806, 51.619165412606506], [-0.877896924603018, 51.61915574690363], [-0.877839648002824, 51.61913541789456], [-0.877812586845032, 51.61911987344738], [-0.877382402665225, 51.61869944717381], [-0.877261875140598, 51.61866682400238], [-0.877087293116294, 51.618600414623565], [-0.876592344555959, 51.61846350297477], [-0.876408990128558, 51.61845995037962], [-0.876374465270622, 51.61845422502283], [-0.876347205240439, 51.61844677083749], [-0.87630299358364, 51.61842386858449], [-0.876241963569583, 51.618380124514495], [-0.876216636094276, 51.618352907107045], [-0.876152781748704, 51.618131100785114], [-0.876106882196741, 51.61811807314475], [-0.876305643178539, 51.617614643124426], [-0.875030363348109, 51.6174927341714], [-0.874705473526163, 51.61748872204597], [-0.874564111923802, 51.6174810731233], [-0.874279482039409, 51.61730930128958], [-0.874259717266618, 51.61699889890464], [-0.874416434195306, 51.61673604585861], [-0.874423036602998, 51.61652750219062], [-0.870144618410033, 51.61769939147719], [-0.870074692270606, 51.617607003497994], [-0.869665459226217, 51.61768399010514], [-0.869137937974611, 51.617812887107476], [-0.868711126950696, 51.61789959196275], [-0.868460959800069, 51.617969115035805], [-0.866874516019656, 51.61827841686334], [-0.866642434191741, 51.6183175388698], [-0.866517885416195, 51.61833072340073], [-0.866392071649004, 51.61833670224208], [-0.865776872894858, 51.61833166083683], [-0.865633662902087, 51.618340168339564], [-0.865493072065054, 51.618359490991885], [-0.864874419821269, 51.618492883413026], [-0.864829070270363, 51.61851582340227], [-0.8648101986804, 51.61846169086974], [-0.864778464993556, 51.618402038980314], [-0.864733824417545, 51.61833866562683], [-0.864681918741689, 51.61827702035103], [-0.864649512487616, 51.61824433697217], [-0.864492159027339, 51.61812502442397], [-0.864510219622979, 51.618037979732996], [-0.864490008258273, 51.61792179156664], [-0.863791866117017, 51.616668790850674], [-0.863578496430752, 51.61619016667409], [-0.863939572338851, 51.6160749702936], [-0.864141702322916, 51.61602027805823], [-0.864343742093738, 51.615969181278444], [-0.864684853799959, 51.61590144547291], [-0.864287415633653, 51.61573755014447], [-0.864114344880943, 51.615611790807684], [-0.86394143216696, 51.615479738556914], [-0.863424226660599, 51.6150224515856], [-0.863108525016747, 51.61470918210108], [-0.862999136822108, 51.61463618943345], [-0.862947760773663, 51.614611414387845], [-0.862827479233939, 51.614569786988696], [-0.862764327092327, 51.6145538895073], [-0.862690954996651, 51.614542388851355], [-0.862422671693898, 51.614528100870835], [-0.862278208948609, 51.61452939875511], [-0.862025067586916, 51.614544929155834], [-0.861633333855888, 51.61461576315295], [-0.861195617216796, 51.61467715820802], [-0.860991546767721, 51.61469406144679], [-0.860819513274215, 51.61470048511226], [-0.860591345418716, 51.61469917048917], [-0.860366335624517, 51.61468709604235], [-0.860199196800327, 51.61467108707321], [-0.860140174693704, 51.6146633207896], [-0.859842784619867, 51.61460018922178], [-0.85969929013584, 51.61456282905675], [-0.859501466379857, 51.61450336097874], [-0.859306643699259, 51.614439425872085], [-0.859175017225196, 51.614389591981386], [-0.858977780895874, 51.61430675031806], [-0.858172868778381, 51.61392127488393], [-0.856305510909038, 51.61299763777437], [-0.855879431428414, 51.61282624136621], [-0.855413827571698, 51.612676038205095], [-0.855073660630441, 51.61259179657028], [-0.854915624510577, 51.612558784566126], [-0.854688372582268, 51.61252150056368], [-0.854459541396129, 51.6124895957323], [-0.854208848612115, 51.61246556965946], [-0.853413812340721, 51.612436228916096], [-0.851724243907319, 51.61242871018406], [-0.851450292115, 51.612410744947404], [-0.850998615679464, 51.61233888823236], [-0.850653274334699, 51.61223120468302], [-0.850372939737194, 51.61235164666859], [-0.850315593337778, 51.61233490012849], [-0.850193999216673, 51.612288751000705], [-0.850146601119627, 51.612278395984944], [-0.849926028861458, 51.61226274823948], [-0.849854084982468, 51.61225215268858], [-0.849714847013531, 51.612218418620564], [-0.849473435162227, 51.61217019573735], [-0.849372523204365, 51.61216291272777], [-0.849235958321253, 51.61219484371945], [-0.849170915863905, 51.6121969037703], [-0.849112126238191, 51.61218014249445], [-0.8487984760956, 51.61201881385575], [-0.848813983178796, 51.61186251023449], [-0.848805967905994, 51.611779707971536], [-0.848777693193183, 51.61169850541887], [-0.848751669639592, 51.61164250170296], [-0.848740414389996, 51.61163070213332], [-0.848685616135578, 51.61162746733029], [-0.848598109857592, 51.61148993537107], [-0.848561752293423, 51.61144282198033], [-0.848420551583887, 51.61131555337684], [-0.848346143135118, 51.61123120073643], [-0.848017978126262, 51.61073074025961], [-0.84803240586268, 51.61067423405594], [-0.848009203184881, 51.61062095534751], [-0.848010806265629, 51.61061467688053], [-0.848360723390725, 51.61054078070849], [-0.848731046077576, 51.61040234328455], [-0.848814480324059, 51.61035820278237], [-0.848820437461021, 51.610351067821576], [-0.848690278305866, 51.610072847084595], [-0.847947554822518, 51.60900543974003], [-0.847435103308081, 51.6083125448088], [-0.847167998407497, 51.60796823756615], [-0.846186886755928, 51.60662333116728], [-0.845549998419521, 51.605828497430636], [-0.845383680959569, 51.60566770865375], [-0.844840468159951, 51.60522267062485], [-0.84443530295085, 51.60497141150611], [-0.844232696249957, 51.60481835643492], [-0.843486943931864, 51.60416181103064], [-0.84332558359401, 51.60420428093958], [-0.842908147301968, 51.603868373383044], [-0.842663709069561, 51.603714004109015], [-0.842310199280505, 51.603533382087996], [-0.841471682375652, 51.60311958453644], [-0.841215384127901, 51.602977683579475], [-0.840873068217364, 51.60281155440105], [-0.840467421086961, 51.602637605395635], [-0.840268344470896, 51.602516948405764], [-0.840203154295604, 51.60246864832527], [-0.838474883614574, 51.601841924417336], [-0.838334815858368, 51.60178568911777], [-0.838125139250388, 51.60168470536249], [-0.837520083534699, 51.60134782062488], [-0.837365310402971, 51.60124558073874], [-0.837143016970701, 51.6010734356079], [-0.83702163004049, 51.600964332538595], [-0.836879440722268, 51.60082175386177], [-0.836733036616179, 51.60067463738169], [-0.836105420124444, 51.59992210370809], [-0.836001567218505, 51.59980508080317], [-0.835894758960057, 51.59969072601903], [-0.835646409012494, 51.5994652683849], [-0.835572705263831, 51.59941148620318], [-0.835355212679077, 51.599278049641256], [-0.835001490423373, 51.59910819321327], [-0.834666328550124, 51.59894661249016], [-0.834023851532118, 51.59860753956394], [-0.833813699592692, 51.59846967713012], [-0.832219972267628, 51.59727861587006], [-0.831975375091702, 51.59713321406168], [-0.83180286996819, 51.597047874561696], [-0.83156138306724, 51.59695015903964], [-0.831279067386554, 51.596868221715724], [-0.831119729288761, 51.59683246683902], [-0.830996129682144, 51.596810555210986], [-0.830798964246538, 51.59678611250204], [-0.829935838169309, 51.596720865686486], [-0.82967342169104, 51.596707460026586], [-0.829378950815281, 51.59670542343618], [-0.828672101908656, 51.596738836236966], [-0.828529092462618, 51.59674190522934], [-0.828241907711544, 51.596737240965595], [-0.828066024571149, 51.59672739285258], [-0.827854311754233, 51.596707295846045], [-0.827399248313258, 51.59666228882735], [-0.827164974703315, 51.59662128423301], [-0.827063074447412, 51.59659778687348], [-0.826830893268571, 51.59653162563389], [-0.826403126611598, 51.596379885757386], [-0.826320361645679, 51.596342192238744], [-0.826196596762853, 51.596270819297594], [-0.825930135887572, 51.596078429107884], [-0.825702044863314, 51.59590980062742], [-0.825239717878873, 51.595531118786504], [-0.824901250965003, 51.59522021379687], [-0.824412039116432, 51.59470908081712], [-0.8242790371805, 51.59460434384618], [-0.824162427084317, 51.59453573788591], [-0.823734544991122, 51.59433363318264], [-0.822923577534385, 51.59387232098135], [-0.82274220720895, 51.593740122024236], [-0.822758790294358, 51.59343366962803], [-0.822450529949737, 51.592123177421634], [-0.822408018987733, 51.591980681321466], [-0.82236394886053, 51.59184266543808], [-0.822242174035691, 51.59158338051977], [-0.821801765862476, 51.5908065697487], [-0.821372709449585, 51.59009371260957], [-0.821171850754746, 51.58982284235581], [-0.820679968304875, 51.58936291919855], [-0.820417155492676, 51.58914357740762], [-0.82015811620844, 51.5888901042506], [-0.820045903377484, 51.58876399099103], [-0.81975498206002, 51.5884040936899], [-0.819793038416411, 51.58838379523831], [-0.819648800144719, 51.588268149727725], [-0.819147039514258, 51.58763368041164], [-0.818936357700162, 51.58740856531028], [-0.818746726401906, 51.58698404449756], [-0.818744261992127, 51.58691208559554], [-0.818786542624285, 51.586561832259704], [-0.818798419467402, 51.58638211648965], [-0.818772601288344, 51.58593047014409], [-0.818622316220491, 51.585380460186784], [-0.818493730937228, 51.58471737211902], [-0.818460174123387, 51.58461992329734], [-0.818316632401033, 51.58436670899539], [-0.818092592164715, 51.58404524580265], [-0.817774082795079, 51.58341531231479], [-0.817553796530972, 51.58311636524129], [-0.817445537064436, 51.58300557512581], [-0.81689125274485, 51.582562990062094], [-0.816348587477007, 51.58217357091916], [-0.816214612729635, 51.58210837837547], [-0.816144330954904, 51.58209148442308], [-0.816059129697027, 51.58209332267878], [-0.815742672724781, 51.5820523651453], [-0.815217212787465, 51.58194545592985], [-0.815002344756643, 51.58188304223224], [-0.814826435408141, 51.5818210214772], [-0.814485295861823, 51.581730356582035], [-0.81444044205173, 51.581790148477246], [-0.813566956536122, 51.581635656767844], [-0.813282023122958, 51.58154825394594], [-0.813052037332166, 51.581456910143594], [-0.812870182657061, 51.581346270732034], [-0.812790810356639, 51.58129061819263], [-0.812604263086127, 51.581138568732094], [-0.812386509085548, 51.58085492331321], [-0.812249092317067, 51.58070067277682], [-0.812167619564544, 51.58055957666617], [-0.812051961231651, 51.58029045130041], [-0.812042798783181, 51.580254391465495], [-0.812034433182585, 51.580187767648724], [-0.812033188044369, 51.58012481260171], [-0.812058064730261, 51.580000977815104], [-0.81229781440549, 51.579440518478464], [-0.812247901650195, 51.57941753400863], [-0.812446355706805, 51.57916777205078], [-0.81277233113049, 51.578787120404634], [-0.813191367818544, 51.57821318632392], [-0.813476583358647, 51.57767926033569], [-0.81372993476285, 51.57714950751218], [-0.813894821439398, 51.57669169369027], [-0.813998634879093, 51.57614064720803], [-0.814138744624452, 51.57508193151095], [-0.814120940539715, 51.57493428638376], [-0.81419874804071, 51.57321943977239], [-0.814492542549023, 51.572575897898666], [-0.814547744449169, 51.57211787423915], [-0.814549364628156, 51.57200009817749], [-0.81449843948966, 51.57157247390041], [-0.81447275908744, 51.57022974030085], [-0.814470739157426, 51.56964165674743], [-0.814429823166273, 51.56938407823071], [-0.814416473674158, 51.5693425811485], [-0.814362577800679, 51.569251219648685], [-0.81406844007837, 51.5689659058573], [-0.813908308238922, 51.56874308971205], [-0.813853532979604, 51.56863013877188], [-0.81375715260415, 51.56839717647337], [-0.81371284208748, 51.56815934527622], [-0.813667666933597, 51.567788426746645], [-0.813915408556528, 51.567527470860746], [-0.814280993234198, 51.56684059466537], [-0.814704823511867, 51.56613272518902], [-0.814994772052415, 51.56569055892733], [-0.815202529336662, 51.56519091397622], [-0.815219131565213, 51.56505170869626], [-0.815351636137841, 51.564671793906264], [-0.815511116853932, 51.56436408558186], [-0.815565592175225, 51.5642108755608], [-0.815662011458114, 51.564053592855515], [-0.815731002538058, 51.56389693250399], [-0.815762954470268, 51.56377766396064], [-0.815882314039101, 51.56307031436626], [-0.815899206541573, 51.563030920866616], [-0.815918960262566, 51.5629924554096], [-0.816100387305838, 51.56272812828101], [-0.816239061970809, 51.562387838558415], [-0.816351227865814, 51.56217946080997], [-0.816402225233145, 51.562104443964415], [-0.816445731089239, 51.56204014171416], [-0.816755073070336, 51.56173843863565], [-0.81682883069147, 51.5615089920632], [-0.81709149295673, 51.56100450196165], [-0.817126546068515, 51.5610435199925], [-0.817036868291134, 51.56144185218239], [-0.817602599672938, 51.56148891511105], [-0.817650902097453, 51.56129517879352], [-0.81772376875861, 51.56109989153342], [-0.818544773098936, 51.56114952106405], [-0.818940645385275, 51.56112652991029], [-0.819286252234888, 51.56087194248433], [-0.820505192935939, 51.560762809232635], [-0.821152924392013, 51.56109751750433], [-0.821401734784996, 51.56112699167495], [-0.821468077854438, 51.561127657861135], [-0.821837057068471, 51.56108460493917], [-0.822551882107614, 51.56083281445182], [-0.822991148836609, 51.56069335159132], [-0.823298868990794, 51.56056425765945], [-0.823427756279142, 51.560489119484224], [-0.823816316952276, 51.56018999039105], [-0.823841530161624, 51.56016326766115], [-0.823879440321637, 51.5600917131651], [-0.823939663402364, 51.55926686943448], [-0.824000930577316, 51.55924050793579], [-0.823876052668265, 51.55798579953388], [-0.823797968341331, 51.557154174451156], [-0.823813910366727, 51.55698348995032], [-0.824268965579194, 51.556733581409404], [-0.824612742777356, 51.55649154853787], [-0.826344281900068, 51.55484359477631], [-0.826657025878971, 51.55457337099326], [-0.827233265990788, 51.554040521447654], [-0.827929376968602, 51.55344502444081], [-0.828029419518581, 51.553368693973354], [-0.828246668974642, 51.55322159923911], [-0.828485269800709, 51.5530855074047], [-0.828605105979095, 51.55302466009866], [-0.829372820563392, 51.55267264797847], [-0.830416538296143, 51.552300003050114], [-0.830341853307235, 51.55217517181714], [-0.830015969895102, 51.55217192349864], [-0.82991663595149, 51.55216463892005], [-0.829524156953837, 51.55211486704629], [-0.829282415323888, 51.552092673855796], [-0.828838545910614, 51.55207835426137], [-0.828599504055965, 51.55206338004898], [-0.828680519991051, 51.55199764928292], [-0.828534433277995, 51.55195752639793], [-0.828384829125967, 51.55188589688778], [-0.827987906418731, 51.55167242458396], [-0.827957477145366, 51.551621766572], [-0.827834232346298, 51.55159086272802], [-0.827633977763617, 51.551525919798664], [-0.827259642164726, 51.55144395104261], [-0.826879262755715, 51.5513727108443], [-0.826619197529414, 51.551334143723224], [-0.825020961294276, 51.55117248609027], [-0.825087548806697, 51.55099511486544], [-0.825080332863119, 51.55093929339289], [-0.825041927300218, 51.55086247849746], [-0.82502361605882, 51.55078946149474], [-0.825044884876699, 51.55069166368164], [-0.825058487270179, 51.550667521970404], [-0.82509857658956, 51.550622964257876], [-0.825145597538488, 51.55058926609727], [-0.825325151596322, 51.5505056412203], [-0.824909915146001, 51.550164291306395], [-0.82525013660448, 51.550002248032946], [-0.825332063085088, 51.549957209837], [-0.825638185418255, 51.54977504214384], [-0.82578350044032, 51.54967668704559], [-0.825923116734683, 51.54957557721289], [-0.826170603160388, 51.54937393870707], [-0.826371785812396, 51.54917813090106], [-0.826492161334072, 51.549039961540565], [-0.826611394860751, 51.548890091280356], [-0.82670116630089, 51.54876420424681], [-0.826782355507479, 51.54863553380353], [-0.826823019292071, 51.54856850170786], [-0.827062757600335, 51.548106920435835], [-0.827101368877001, 51.54800749719491], [-0.827194201898492, 51.54770629998806], [-0.827307057244965, 51.54741159704493], [-0.827582602426052, 51.54684696658141], [-0.827901482950928, 51.54639156924703], [-0.828226190833503, 51.54604592938406], [-0.828636291311094, 51.545744301711125], [-0.82879259021163, 51.54566673370386], [-0.828904643767125, 51.545627388779295], [-0.829074413403866, 51.54558682127211], [-0.829642313890905, 51.54554213206049], [-0.831137752395514, 51.5457125947128], [-0.831296230672639, 51.545718668970665], [-0.831381409559054, 51.545715021306385], [-0.831520416985355, 51.54569302674314], [-0.831658465956176, 51.54565213966273], [-0.832162223002951, 51.54540897973132], [-0.832259763552867, 51.545373083913695], [-0.832342495362879, 51.54535232675641], [-0.832449690786029, 51.545333611293344], [-0.832560958333776, 51.54532482723805], [-0.832748224427793, 51.54533298427906], [-0.833594396864807, 51.5455158387706], [-0.833803468208608, 51.5455736658201], [-0.834066591719905, 51.54566080332341], [-0.834319302360527, 51.54576042533909], [-0.834632701147966, 51.545911902800114], [-0.834743597643834, 51.54597414830218], [-0.834972095381443, 51.546118487532766], [-0.835101437527799, 51.546192605160904], [-0.835308853525451, 51.54642845092972], [-0.835597379030446, 51.546650714213946], [-0.835675530378703, 51.54669644865621], [-0.835765285050956, 51.54673960061442], [-0.835946924814448, 51.54679895002405], [-0.836738145066418, 51.54693268079673], [-0.837616543696299, 51.54698454508781], [-0.837668585980954, 51.546979665457], [-0.837867989708348, 51.546964555807335], [-0.83797367625272, 51.54694851789646], [-0.838105566972017, 51.54692284834119], [-0.838233315283634, 51.54688994418392], [-0.838329229403341, 51.54686122067977], [-0.838482151664417, 51.546802489195365], [-0.839036827411148, 51.54642762424692], [-0.83955396219585, 51.54605418383688], [-0.840116011657223, 51.54567219327131], [-0.840736658187885, 51.54525391246058], [-0.840941426195899, 51.54514083988849], [-0.841049279937165, 51.54509604683764], [-0.841194847094701, 51.5450426342828], [-0.841299520083949, 51.545009498946165], [-0.841898633062652, 51.544870644649805], [-0.842282244574123, 51.54481328536381], [-0.842762474116396, 51.54475597844143], [-0.843565178344648, 51.54477737891959], [-0.844086979548171, 51.54484366398717], [-0.845732620874625, 51.545006428046236], [-0.847066038668597, 51.54519847249473], [-0.847735465249349, 51.545415455459946], [-0.84773690700669, 51.54541546961599], [-0.848634731053663, 51.54572550693968], [-0.849946581441456, 51.54620234699594], [-0.850255922443757, 51.54628810259981], [-0.850450510421732, 51.5463493547082], [-0.850677807173489, 51.54642891042725], [-0.850994850981171, 51.546552505063595], [-0.852786328510159, 51.547342426670774], [-0.85300310746802, 51.547496506935786], [-0.853571212311598, 51.54778799706584], [-0.854020445083318, 51.54798930492918], [-0.854581807452525, 51.548205193183556], [-0.85478620907829, 51.54827822314386], [-0.854963577157503, 51.54833660211785], [-0.855161244465997, 51.54839068294659], [-0.855663052553423, 51.5485088736389], [-0.856166529832507, 51.54867563412252], [-0.856279761006, 51.54870371304979], [-0.856530960852844, 51.54875111981111], [-0.856804082121709, 51.54878705024175], [-0.857112033920981, 51.54881432744164], [-0.857381573472553, 51.548820548731904], [-0.857549123049589, 51.54881049056259], [-0.857844479857821, 51.548764809719025], [-0.858057604662229, 51.54872012637499], [-0.858337617310588, 51.54865361386837], [-0.858552497890933, 51.54859635820055], [-0.859049392399301, 51.548450127924276], [-0.859439117962245, 51.5483792842905], [-0.859697682244768, 51.54836291412634], [-0.859779823131423, 51.54836551056866], [-0.860170027263243, 51.548390881318824], [-0.860456238387038, 51.54842243448379], [-0.861009536104037, 51.548500639150554], [-0.861158816462501, 51.54852906321894], [-0.861352413335375, 51.54857320311727], [-0.861544411683264, 51.54862362144007], [-0.861731905414109, 51.5486811891874], [-0.862073439754406, 51.548807688741114], [-0.86254414698236, 51.54901726458452], [-0.86282747298222, 51.54916477803516], [-0.863015068128655, 51.549276295417606], [-0.863120154717426, 51.549342054318615], [-0.863285809311142, 51.54946594721784], [-0.863418211576468, 51.54959311456195], [-0.863530092020445, 51.54973357070672], [-0.863653360363745, 51.549937978681236], [-0.863733641061499, 51.550131180181424], [-0.863790336700716, 51.5503448343906], [-0.863824973966162, 51.550691353426465], [-0.863841717303786, 51.55100353042492], [-0.863889686614544, 51.55116225019172], [-0.863971345177536, 51.55135816235228], [-0.864192531443895, 51.5518009005184], [-0.864636908176204, 51.552606367995786], [-0.864885616784935, 51.55304487507487], [-0.864984710926909, 51.55317801261536], [-0.865042267578469, 51.5532415116859], [-0.86524661818949, 51.553434113390985], [-0.866448255146234, 51.55464702695421], [-0.866553639357719, 51.55475954277147], [-0.86713929523259, 51.555454866418074], [-0.86728119491555, 51.55560729781788], [-0.867357192432134, 51.55568356216347], [-0.867846797612144, 51.55612348793147], [-0.867948777192819, 51.5561991033314], [-0.868039688780355, 51.55625572917072], [-0.868162193200772, 51.55631805467487], [-0.868334859667638, 51.55639345221028], [-0.868507816648064, 51.556457162985154], [-0.868686743286876, 51.556512838449954], [-0.868885971532242, 51.55656421341042], [-0.869870431325262, 51.55700170522159], [-0.870538382015661, 51.557289577406756], [-0.87065953954758, 51.55734829060127], [-0.870968323528286, 51.55751940747054], [-0.871084688448939, 51.55759695683154], [-0.871173919806704, 51.55766345498963], [-0.871421843971099, 51.55790412108149], [-0.871517352960249, 51.558008444760674], [-0.871560414081151, 51.55807539786269], [-0.871689483441928, 51.558339198343305], [-0.871715457861831, 51.558455441841], [-0.871819115572425, 51.558871857901316], [-0.872116688986198, 51.559438501590606], [-0.87224925001588, 51.559678057158926], [-0.872395481580982, 51.5598898694294], [-0.872503199025109, 51.56002578071336], [-0.872616797176149, 51.56015725249727], [-0.872767427555836, 51.560307962534345], [-0.873712440787397, 51.560887112412736], [-0.874019840047307, 51.56105730856152], [-0.874413245272104, 51.56124990894107], [-0.875159636577155, 51.56157807024888], [-0.875469862748955, 51.561692540724444], [-0.875618818634067, 51.561736229028845], [-0.87605776549836, 51.56183754414599], [-0.876366373823489, 51.56190074371407], [-0.87668521195865, 51.561958645316366], [-0.876968369886447, 51.56200091867397], [-0.877197163756339, 51.56202468778881], [-0.877516822654725, 51.5620493254706], [-0.878098847659676, 51.56208186543848], [-0.879220205739232, 51.56212315048378], [-0.879742407250114, 51.562124539056946], [-0.8803196812009, 51.56211566057546], [-0.88047709073344, 51.562109069498774], [-0.880781923890852, 51.5620912956137], [-0.881058065229737, 51.56206695318683], [-0.881262135404653, 51.56204012483733], [-0.881418631531618, 51.562011943580096], [-0.881649213834679, 51.56196288783239], [-0.882003250428868, 51.56187993977645], [-0.882376388095226, 51.56178278572967], [-0.882764299497775, 51.56167138432022], [-0.883194585739291, 51.561537905452155], [-0.883498576630078, 51.5614364931922], [-0.883756281221724, 51.56134003501421], [-0.884086956514705, 51.56120920221847], [-0.884407665982054, 51.56107287871968], [-0.885457870533961, 51.5606602434964], [-0.885606584631741, 51.56059601575753], [-0.88578613479336, 51.56050960117672], [-0.88595858283258, 51.56041862303493], [-0.886091760097573, 51.560340759581955], [-0.886521253482028, 51.56006159461465], [-0.886883345687433, 51.559824949307504], [-0.887389733197074, 51.559468282123994], [-0.887580604245187, 51.55927227271282], [-0.887708691217493, 51.559107139161064], [-0.888191015763102, 51.55861266662589], [-0.888192457957821, 51.55861268028735], [-0.888287760756616, 51.55849039596854], [-0.888562664893145, 51.558278995716826], [-0.888677108662246, 51.55814070717499], [-0.888887527216288, 51.55791161122132], [-0.889030158653071, 51.55774121885465], [-0.889203011709727, 51.557514464273005], [-0.88945350380216, 51.55717964382524], [-0.889600043815338, 51.556967026485395], [-0.889736358446423, 51.55670036168757], [-0.889858423154084, 51.55648571413559], [-0.889957478394766, 51.55626815130874], [-0.88999480235023, 51.556157006507235], [-0.890171676314085, 51.5555274577222], [-0.89040150985715, 51.554855248874496], [-0.891496918227321, 51.55316795557777], [-0.892148150167392, 51.55212836271704], [-0.892302414411729, 51.5517746441604], [-0.892679622502675, 51.55097074336506], [-0.892968782461996, 51.55046633574481], [-0.893655961353766, 51.54930928124159], [-0.894173495307085, 51.548604708475054], [-0.894625223197592, 51.54805597035748], [-0.895275002004698, 51.547308578527485], [-0.895581553072133, 51.54691762432374], [-0.89567259455686, 51.54679079793778], [-0.895853734572665, 51.54651645501248], [-0.896746527292651, 51.54508077321264], [-0.896901839906062, 51.544860136456265], [-0.897255891587921, 51.54494888564188], [-0.898115394177492, 51.545187148067974], [-0.89822539056202, 51.54523044209882], [-0.898280925208036, 51.54525973711452], [-0.898317695099433, 51.54528975512979], [-0.898473190139101, 51.54530020648797], [-0.899619101095523, 51.54544313546729], [-0.901006352145532, 51.54562517973134], [-0.901825064903737, 51.54570208025918], [-0.903152296119515, 51.54586195719927], [-0.903215411109321, 51.54587603470979], [-0.903297183099556, 51.545893883241035], [-0.903017403675823, 51.54655396139701], [-0.902616538461231, 51.54745118838641], [-0.902395351374664, 51.54801290343283], [-0.902224993241029, 51.54837997226972], [-0.902166365216381, 51.54859882282856], [-0.902146545476892, 51.54876318664974], [-0.902208891983797, 51.54892921824649], [-0.902230894835185, 51.549033728477525], [-0.902380735585514, 51.54999904656443], [-0.902673692529055, 51.551610411429984], [-0.902806620567669, 51.55250003963136], [-0.902816651036337, 51.55268266601908], [-0.902804979597758, 51.55292803179951], [-0.902756997764027, 51.55318384821566], [-0.902654701329301, 51.55353896524768], [-0.902427419928527, 51.55423280167036], [-0.901847751389036, 51.555843197130926], [-0.901770133963284, 51.556011515784924], [-0.90172081219273, 51.556082988265544], [-0.902203201151337, 51.55617741874876], [-0.906010818638152, 51.55679743475821], [-0.906204734572883, 51.556771367660915], [-0.906311884484255, 51.55675438267928], [-0.906358975073264, 51.55689599188705], [-0.90638590166065, 51.55691602462513], [-0.906615524939952, 51.55696492104195], [-0.907278267614382, 51.55705831304524], [-0.907858939004531, 51.55720578727805], [-0.908174621569804, 51.5572752632291], [-0.908339760107985, 51.55730647205926], [-0.908420198492941, 51.557320707807335], [-0.908923514869315, 51.557385632424236], [-0.909322889103033, 51.5574540848968], [-0.909506497855653, 51.557497152980005], [-0.909658336207082, 51.557541723987356], [-0.909754316957776, 51.55756959081508], [-0.909871264277585, 51.557625526703404], [-0.91002439519459, 51.55767640345812], [-0.91014009429463, 51.557724234915874], [-0.910363938659539, 51.55783421414451], [-0.910769828656022, 51.55805288423369], [-0.910899633150579, 51.55817457810929], [-0.911134211672749, 51.55843931338367], [-0.911191431662737, 51.558519870694006], [-0.911262279817118, 51.55863382382822], [-0.911345597527786, 51.558829717406], [-0.911347039740573, 51.55882973078292], [-0.911354152248679, 51.55895478193117], [-0.911501156990394, 51.55932300828838], [-0.911744284152759, 51.55977395051585], [-0.911784714781588, 51.55983277167005], [-0.911848028397377, 51.559899897522016], [-0.911951124589094, 51.55999256899618], [-0.912043240814804, 51.56006176008463], [-0.912343203354435, 51.560247072388215], [-0.91252735254784, 51.560389049785144], [-0.912663001694362, 51.56050809825428], [-0.913644040185922, 51.561715780647766], [-0.914729932802775, 51.56149024267299], [-0.915936249212879, 51.561720788632314], [-0.917099342153636, 51.56255696600573], [-0.917716153850379, 51.56209778262442], [-0.918510926061236, 51.561494569835055], [-0.919190082061234, 51.56187308324347], [-0.919265061021478, 51.56187467281339], [-0.919319677161742, 51.561883268238525], [-0.919395565855925, 51.56190734542486], [-0.919450182060758, 51.561915940789575], [-0.919451624375034, 51.56191595406745], [-0.919612764956992, 51.561873377936905], [-0.919684473323871, 51.562134798108005], [-0.919731696029427, 51.56227280618616], [-0.919795125391412, 51.562396576626476], [-0.919877773921036, 51.56250074208832], [-0.920024454979703, 51.56264236275641], [-0.920273793481437, 51.562835281288635], [-0.920455811890565, 51.56300779833283], [-0.92054707457537, 51.56311384087594], [-0.920622684574115, 51.56321074767881], [-0.920768557091237, 51.56344767224896], [-0.920815933327546, 51.56357938704838], [-0.92087756775181, 51.56365728255545], [-0.920897207761338, 51.56368084160506], [-0.920950783915168, 51.5637334861553], [-0.921113636188415, 51.563862665653886], [-0.921195103215065, 51.56395602921301], [-0.921351882125165, 51.56422002842434], [-0.921395592904906, 51.56432383493418], [-0.921420893006769, 51.56441308549212], [-0.921438619701684, 51.56451755238376], [-0.921413985191466, 51.56464410933019], [-0.92167481147157, 51.56453500840272], [-0.923479752756133, 51.56373602685831], [-0.924155377789785, 51.5634113259626], [-0.924873111301507, 51.56399247344971], [-0.924951149378637, 51.56404803772923], [-0.925274524870032, 51.56428388466152], [-0.92664770764064, 51.56515336065692], [-0.927393574791524, 51.56558368874587], [-0.927927453464337, 51.5659491340051], [-0.92835633038721, 51.56599441223158], [-0.928244524844939, 51.56725223174753], [-0.928125342518282, 51.56741209518939], [-0.9281054698832, 51.56745956981058], [-0.927839528670842, 51.568092855254655], [-0.93052584537502, 51.568532778436946], [-0.930434864440691, 51.56872077542371], [-0.930290537945866, 51.568968530677175], [-0.93032458943141, 51.568993118606556], [-0.930407160146686, 51.56904062792432], [-0.930494248489543, 51.56908008580425], [-0.93056005729139, 51.5691040638391], [-0.930644619283805, 51.56912821268005], [-0.930755210497826, 51.569149901051155], [-0.931002865082897, 51.56917193845677], [-0.931506345671459, 51.5692367670135], [-0.9319179887186, 51.56928007686346], [-0.93222706378822, 51.569328746497334], [-0.932389335623021, 51.56936169347699], [-0.932508352034028, 51.56939334769875], [-0.932608510110525, 51.56942932617174], [-0.932871163025979, 51.56955040480943], [-0.933086053531851, 51.569616199317096], [-0.933414865356232, 51.569684826955594], [-0.93386895042082, 51.56976448240679], [-0.934635570791928, 51.5700537823344], [-0.934785550106084, 51.57011898456062], [-0.934985327167408, 51.57021431104797], [-0.935122135234023, 51.5702874858722], [-0.935333952219633, 51.570423383659445], [-0.935683954424458, 51.570697207984594], [-0.935948857561102, 51.57084617434456], [-0.936321009353978, 51.57109861741231], [-0.936776166293208, 51.57138058458356], [-0.936874033955222, 51.57139136186155], [-0.937185388877335, 51.57140497135624], [-0.937358713203379, 51.57139754881963], [-0.937474500211682, 51.571382411871916], [-0.937604964789291, 51.57135661760672], [-0.938082770631526, 51.571224267138255], [-0.938303744516349, 51.57115343316592], [-0.938622419406116, 51.57103852370375], [-0.938583754985448, 51.57127375671787], [-0.938615426417796, 51.5714008261012], [-0.938651384040882, 51.57152973256723], [-0.938810396393867, 51.572013125409214], [-0.938917102284257, 51.5723881447753], [-0.938977920287056, 51.572564931845086], [-0.939147081147104, 51.57298457478389], [-0.93921529881351, 51.57340150695511], [-0.939295227462625, 51.57374930879435], [-0.939359853061118, 51.57401065198471]]]}}
benchmarks/json-data/integers.jsonnew file+1
@@ -0,0 +1 @@
1+[1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 2, 2, 2, 2, 2, 2, 2, 3, 3, 3, 3, 3, 4, 4, 4, 4, 5, 5, 5, 6, 6, 7, 7, 7, 8, 9, 9, 10, 10, 11, 12, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 23, 24, 26, 27, 29, 31, 33, 35, 37, 39, 42, 44, 47, 50, 53, 56, 60, 63, 67, 72, 76, 81, 86, 91, 96, 102, 109, 115, 122, 130, 138, 146, 155, 165, 175, 186, 197, 209, 222, 236, 250, 266, 282, 299, 318, 337, 358, 380, 403, 428, 454, 482, 511, 543, 576, 611, 649, 688, 730, 775, 823, 873, 926, 983, 1043, 1107, 1175, 1247, 1323, 1404, 1490, 1582, 1679, 1781, 1890, 2006, 2129, 2259, 2398, 2544, 2700, 2865, 3041, 3227, 3425, 3634, 3857, 4093, 4343, 4609, 4891, 5191, 5509, 5846, 6204, 6583, 6986, 7414, 7868, 8349, 8860, 9403, 9978, 10589, 11237, 11925, 12655, 13430, 14252, 15124, 16050, 17032, 18075, 19181, 20355, 21601, 22923, 24326, 25815, 27396, 29072, 30852, 32740, 34744, 36871, 39128, 41523, 44064, 46762, 49624, 52661, 55884, 59305, 62935, 66787, 70875, 75213, 79817, 84702, 89887, 95389, 101227, 107423, 113998, 120976, 128381, 136239, 144578, 153427, 162818, 172784, 183360, 194583, 206493, 219132, 232545, 246778, 261883, 277912, 294923, 312975, 332131, 352460, 374034, 396928, 421223, 447005, 474365, 503400, 534212, 566911, 601610, 638433, 677511, 718980, 762987, 809688, 859247, 911840, 967652, 1026880, 1089734, 1156434, 1227217, 1302333, 1382046, 1466638, 1556408, 1651673, 1752769, 1860052, 1973902, 2094721, 2222934, 2358996, 2503385, 2656613, 2819219, 2991777, 3174898, 3369227, 3575451, 3794297, 4026539, 4272995, 4534536, 4812086, 5106625, 5419191, 5750889, 6102889, 6476435, 6872845, 7293518, 7739939, 8213686, 8716429, 9249944, 9816115, 10416939, 11054539, 11731166, 12449207, 13211198, 14019829, 14877955, 15788605, 16754994, 17780533, 18868844, 20023768, 21249383, 22550016, 23930257, 25394980, 26949356, 28598872, 30349352, 32206975, 34178300, 36270285, 38490317, 40846232, 43346349, 45999492, 48815029, 51802899, 54973651, 58338478, 61909260, 65698602, 69719882, 73987297, 78515911, 83321713, 88421668, 93833782, 99577160, 105672079, 112140056, 119003924, 126287916, 134017747, 142220706, 150925751, 160163614, 169966908, 180370243, 191410345, 203126189, 215559137, 228753081, 242754599, 257613123, 273381107, 290114218, 307871529, 326715729, 346713346, 367934976, 390455540, 414354543, 439716356, 466630515, 495192035, 525501749, 557666661, 591800322, 628023236, 666463282, 707256166, 750545902, 796485316, 845236589, 896971830, 951873682, 1010135966, 1071964368, 1137577163, 1207205986, 1281096650, 1359510014, 1442722903, 1531029087, 1624740315, 1724187420, 1829721484, 1941715077, 2060563573, 2186686548, 2320529259, 2462564214, 2613292844, 2773247272, 2942992191, 3123126858, 3314287206, 3517148098, 3732425698, 3960880011, 4203317554, 4460594215, 4733618266, 5023353573, 5330822998, 5657112012, 6003372524, 6370826950, 6760772526, 7174585891, 7613727944, 8079749004, 8574294281, 9099109685, 9656047991, 10247075377, 10874278366, 11539871197, 12246203633, 12995769265, 13791214310, 14635346955, 15531147272, 16481777734, 17490594386, 18561158687, 19697250088, 20902879371, 22182302812, 23540037202, 24980875800, 26509905246, 28132523526, 29854459026, 31681790754, 33620969802, 35678842122, 37862672691, 40180171161, 42639519077, 45249398761, 48019023960, 50958172379, 54077220194, 57387178688, 60899733121, 64627283986, 68582990784, 72780818484, 77235586822, 81963022620, 86979815309, 92303675844, 97953399235, 103948930895, 110311437058, 117063379497, 124228594829, 131832378662, 139901574895, 148464670491, 157551896043, 167195332496, 177429024407, 188289100133, 199813899374, 212044108527, 225022904322, 238796106249, 253412338321, 268923200725, 285383451995, 302851202324, 321388118716, 341059642687, 361935221296, 384088552321, 407597844432, 432546093294, 459021374572, 487117154867, 516932621682, 548573033590, 582150091830, 617782334651, 655595555791, 695723248569, 738307077168, 783497376747, 831453684183, 882345301285, 936351892486, 993664119121, 1054484312524, 1119027188325, 1187520604468, 1260206365627, 1337341076854, 1419197049486, 1506063262491, 1598246382662, 1696071847252, 1799885012878, 1910052374747, 2026962860500, 2151029203266, 2282689398739, 2422408251457, 2570679015712, 2728025136906, 2895002099486, 3072199387991, 3260242568131, 3459795495242, 3671562657914, 3896291665080, 4134775885316, 4387857247705, 4656429214122, 4941439933460, 5243895588908, 5564863950114, 5905478142772, 6266940648935, 6650527552175, 7057593042589, 7489574197539, 7947996055022, 8434476997558, 8950734465625, 9498591020797, 10079980779998, 10696956243580, 11351695541337, 12046510122031, 12783852913581, 13566326982715, 14396694724673, 15277887615381, 16213016560543, 17205382878181, 18258489953389, 19376055606456, 20562025218016, 21820585657560, 23156180064488, 24573523533875, 26077619762337, 27673778712750, 29367635360200, 31165169585327, 33072727285306, 35097042776985, 37245262571278, 39524970602741, 41944215003394, 44511536515321, 47235998642351, 50127219647252, 53195406507421, 56451390948928, 59906667686130, 63573435001862, 67464637811456, 71594013362620, 75976139732519, 80626487293267, 85561473327514, 90798519986944, 96356115798305, 102253880934088, 108512636478302, 115154477931865, 122202853217119, 129682645456833, 137620260819954, 146043721744222, 154982765864743, 164468950997792, 174535766550465, 185218751749486, 196555621106568, 208586397563259, 221353553785311, 234902162105402, 249280053643550, 264537987166964, 280729828285480, 297912739615178, 316147382581544, 335498131574595, 356033301212013, 377825387512598, 400951323831468, 425492752460545, 451536312853150, 479173947490266, 508503226468250, 539627691953919, 572657223723034, 607708427072674, 644905044476938, 684378392439283, 726267825083707, 770721226121430, 817895530929871, 867957280587026, 921083209817197, 977460870923688, 1037289295911185, 1100779699135317, 1168156222959992, 1239656729054927, 1315533638126921, 1396054821049394, 1481504544536185, 1572184474698156, 1668414742025481, 1770535071555377, 1878905982215138, 1993910059574563, 2115953306501003, 2245466576485316, 2382907094698829, 2528760072151156, 2683540418647385, 2847794560591953]
benchmarks/json-data/jp10.jsonnew file+1
@@ -0,0 +1 @@
1+{"results":[{"from_user_id_str":"2458313","profile_image_url":"http://a2.twimg.com/profile_images/1203653060/fure091226_normal.png","created_at":"Thu, 27 Jan 2011 20:30:04 +0000","from_user":"19princess","id_str":"30724239224995840","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6d77\u6674\u300c\u672c\u65e5\u306e\u6771\u4eac\u306e\u304a\u5929\u6c17\u306f\u6674\u6642\u3005\u66c7\u3067\u3057\u3087\u3046\u3002\u6700\u9ad8\u6c17\u6e29\u306f8\u5ea6\u3001\u6700\u4f4e\u6c17\u6e29\u306f1\u5ea6\u3067\u3059\u3002\u3042\u306a\u305f\u306e\u4eca\u65e5\u306e\u4eba\u751f\u306b\u3068\u3073\u3063\u304d\u308a\u306e\u304a\u5929\u6c17\u3092\u2665\u300d","id":30724239224995840,"from_user_id":2458313,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://babyprincess.sakura.ne.jp/about/&quot; rel=&quot;nofollow&quot;&gt;\u5929\u4f7f\u5bb6\u306e\u88cf\u5c71&lt;/a&gt;"},{"from_user_id_str":"66578965","profile_image_url":"http://a0.twimg.com/profile_images/1183763267/fossetta_normal.png","created_at":"Thu, 27 Jan 2011 20:00:04 +0000","from_user":"Fossetta_Tokyo","id_str":"30716689779785729","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u304a\u306f\u3088\u3046\u3054\u3056\u3044\u307e\u3059!!\u6771\u4eac\u90fd\u3001\u672c\u65e5\u306e\u304a\u5929\u6c17\u306f\u6674\u6642\u3005\u66c7\u3002\u6700\u9ad8\u6c17\u6e298\u5ea6\u3001\u6700\u4f4e\u6c17\u6e291\u5ea6\u3002\u6771\u4eac\u5730\u65b9\u3067\u306f\u3001\u7a7a\u6c17\u306e\u4e7e\u71e5\u3057\u305f\u72b6\u614b\u304c\u7d9a\u3044\u3066\u3044\u307e\u3059\u3002\u706b\u306e\u53d6\u308a\u6271\u3044\u306b\u6ce8\u610f\u3057\u3066\u4e0b\u3055\u3044\u3002\u4f0a\u8c46\u8af8\u5cf6\u3068\u5c0f\u7b20\u539f\u8af8\u5cf6\u306b\u306f\u3001\u5f37\u98a8\u3001\u6ce2\u6d6a\u3001\u4e7e\u71e5\u3001\u971c\u306e\u6ce8\u610f\u5831\u3092\u767a\u8868\u4e2d\u3067\u3059\u3002","id":30716689779785729,"from_user_id":66578965,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://bit.ly/Fossetta&quot; rel=&quot;nofollow&quot;&gt;\u30d5\u30a9\u30bb\u30c3\u30bf ver.3.1.1&lt;/a&gt;"},{"from_user_id_str":"104041146","profile_image_url":"http://a2.twimg.com/profile_images/863965118/001jwatokyo_normal.jpg","created_at":"Thu, 27 Jan 2011 19:44:33 +0000","from_user":"jwa_tokyo","id_str":"30712787537756160","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6c17\u8c61\u5e81\u304b\u3089\u6771\u4eac\u306e\u5929\u6c17\u4e88\u5831\u304c\u767a\u8868\u3055\u308c\u307e\u3057\u305f\u3000\u305d\u306e\u5929\u6c17\u4e88\u5831\u3092\u3053\u3053\u3067\u3064\u3076\u3084\u3053\u3046\u304b\u306a\u3041\uff5e\uff1f\u3000\u8003\u3048\u4e2d\u3000\u307e\u3066\u6b21\u53f7\uff08\u7b11","id":30712787537756160,"from_user_id":104041146,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.docodemo.jp/twil/&quot; rel=&quot;nofollow&quot;&gt;Twil2 (Tweet Anytime, Anywhere by Mail)&lt;/a&gt;"},{"from_user_id_str":"144500192","profile_image_url":"http://a3.twimg.com/a/1294874399/images/default_profile_3_normal.png","created_at":"Thu, 27 Jan 2011 18:59:33 +0000","from_user":"kyo4to4","id_str":"30701462774358016","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u90fd \u516b\u4e08\u5cf6 - \u4eca\u65e5\u306e\u5929\u6c17\u306f\u30fb\u30fb\u30fb\u66c7\u306e\u3061\u6674\u3067\u3059\u306e\uff01","id":30701462774358016,"from_user_id":144500192,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/kyo4to4&quot; rel=&quot;nofollow&quot;&gt;lost-sheep-bot&lt;/a&gt;"},{"from_user_id_str":"165724582","profile_image_url":"http://a0.twimg.com/profile_images/1222842347/163087_1256281064506_1753997852_484926_2761052_n_normal.jpg","created_at":"Thu, 27 Jan 2011 17:39:06 +0000","from_user":"Rifqi_19931020","id_str":"30681213748387840","metadata":{"result_type":"recent"},"to_user_id":113796067,"text":"@CHLionRagbaby \u30b1\u30f3\u3061\u3083\u3093\u3001\u671d\u4eca\u307e\u3067\u306e\u81ea\u5206\u306e\u30db\u30fc\u30e0\u30a8\u30ea\u30a2\u304b\u3089\u307e\u3060\u975e\u5e38\u306b\u5bd2\u3044\u3068\u96e8\u304c\u964d\u3063\u3066\u3044\u305f..\u3069\u306e\u3088\u3046\u306b\u73fe\u5728\u306e\u6771\u4eac\u306e\u5929\u6c17\uff1f","id":30681213748387840,"from_user_id":165724582,"to_user":"CHLionRagbaby","geo":null,"iso_language_code":"ja","to_user_id_str":"113796067","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"120911929","profile_image_url":"http://a0.twimg.com/profile_images/772435076/20100312___capture2_normal.png","created_at":"Thu, 27 Jan 2011 17:28:30 +0000","from_user":"Cirno_fan","id_str":"30678546020040705","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u65e5\u306e\u6771\u4eac\u306e\u5929\u6c17\u306f\u3001\u66c7\u6642\u3005\u6674\u3067\u6700\u9ad8\u6c17\u6e29\u306f8\u2103\uff01 \u6700\u4f4e\u6c17\u6e29\u306f2\u2103\u3060\u3063\u305f\u3088\uff01 RT @mimi22999 \uff08\uff65\u2200\uff65\uff09\uff4c\u3001\u865a\u5f31\u306a\u8005\u306b\u3068\u3063\u3066\u3001\u6717\u3089\u304b\u306a\u9854\u306f\u4e0a\u5929\u6c17\u3068\u540c\u3058\u304f\u3089\u3044\u3046\u308c\u3057\u3044\u3082\u306e\u3060\u3002\u30d5\u30e9\u30f3\u30af\u30ea\u30f3 #tenki #bot","id":30678546020040705,"from_user_id":120911929,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://blog.livedoor.jp/fairycirno/archives/34686.html&quot; rel=&quot;nofollow&quot;&gt;\u5e7b\u60f3\u90f7 \u9727\u306e\u6e56&lt;/a&gt;"},{"from_user_id_str":"65976527","profile_image_url":"http://a0.twimg.com/profile_images/452810990/little_italies_____normal.jpg","created_at":"Thu, 27 Jan 2011 17:00:03 +0000","from_user":"heta_weather01","id_str":"30671388754845696","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u30d8\u30bf\u5929\u3011Tere hommikust.\u30a8\u30b9\u30c8\u30cb\u30a2\u3067\u3059\u3002\u4eca\u65e5\u306e\u6771\u4eac\u306e\u5929\u6c17\u306f\u6674\u6642\u3005\u66c7\u3067\u660e\u65e5\u306f\u66c7\u308a\u3067\u3059\u3002\u3061\u306a\u307f\u306b\u50d5\u306e\u3068\u3053\u308d\u3067\u306f\u66c7\u308a\u3067\u6c17\u6e29-7\u2103\u3067\u3059\u3002\u3061\u306a\u307f\u306b\u30b9\u30ab\u30a4\u30d7\u306e\u958b\u767a\u672c\u90e8\u306f\u50d5\u306e\u5bb6\u306b\u3042\u308b\u3093\u3067\u3059\u3002","id":30671388754845696,"from_user_id":65976527,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www15.atpages.jp/~kageyanma/&quot; rel=&quot;nofollow&quot;&gt;\u5730\u7403\u306e\u4e2d&lt;/a&gt;"},{"from_user_id_str":"7278433","profile_image_url":"http://a3.twimg.com/profile_images/1218965303/michael-1_normal.png","created_at":"Thu, 27 Jan 2011 16:50:16 +0000","from_user":"shimohiko","id_str":"30668926035689472","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3042\u308a\u3002\n\u3010\u7f8e\u4eba\u5929\u6c17/\u6771\u4eac\u3011\u7f8e\u4eba\u5929\u6c17\u30ad\u30e3\u30b9\u30bf\u30fc\u306e&quot;\u3055\u3042\u3084\u3093\u3055\u3093&quot;\u306b\u3088\u308b\u3068\u300c1/29(\u571f)\u306f\u304f\u3082\u308a\u3067\u3001\u964d\u6c34\u78ba\u738740%\u3001\u6700\u9ad8\u6c17\u6e29\u306f6\u2103\u3067\u6700\u4f4e\u6c17\u6e29\u306f1\u2103\u3067\u3059\u300d\u7f8e\u4eba\u5929\u6c17\u21d2http://bit.ly/djB8th http://twitpic.com/3twnl0 #bt_tenki","id":30668926035689472,"from_user_id":7278433,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://bijintenki.jp&quot; rel=&quot;nofollow&quot;&gt;bijintenki.jp&lt;/a&gt;"},{"from_user_id_str":"61770","profile_image_url":"http://a3.twimg.com/profile_images/1206955079/tw172a_normal.png","created_at":"Thu, 27 Jan 2011 16:40:52 +0000","from_user":"rsky","id_str":"30666561853333504","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3075\u3068\u591c\u7a7a\u3092\u898b\u4e0a\u3052\u3066\u30aa\u30ea\u30aa\u30f3\u304c\u898b\u3048\u306a\u304f\u3066\u300c\u6771\u4eac\u306b\u306f\u7a7a\u304c\u306a\u3044\u300d\u3068\u667a\u6075\u5b50\u306e\u3088\u3046\u306a\u3053\u3068\u3092\u601d\u3063\u305f\u308f\u3051\u3060\u304c\u3001\u305f\u3076\u3093\u534a\u5206\u3050\u3089\u3044\u306f\u5929\u6c17\u306e\u305b\u3044\u3067\u3059","id":30666561853333504,"from_user_id":61770,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.hootsuite.com&quot; rel=&quot;nofollow&quot;&gt;HootSuite&lt;/a&gt;"},{"from_user_id_str":"103259265","profile_image_url":"http://a0.twimg.com/profile_images/767857973/anime_icon_normal.gif","created_at":"Thu, 27 Jan 2011 16:37:42 +0000","from_user":"liveshowonly","id_str":"30665765698928640","metadata":{"result_type":"recent"},"to_user_id":null,"text":"iPhone\u5929\u6c17\u3002\u6771\u4eac4\u2103\u3063\u3066\u7d50\u69cb\u5bd2\u304f\u306a\u3044\u3058\u3083\u3093\u3002\uff08\u78ba\u304b\u306b\u3082\u306e\u51c4\u304f\u5bd2\u3044\u8a33\u3067\u306f\u7121\u3044\uff09\u3002\u798f\u5ca1\u5e02\u306f1\u2103\u3060\u3002\u52dd\u3061\u3060\u305c\u3002Rock'n'roll","id":30665765698928640,"from_user_id":103259265,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"165242761","profile_image_url":"http://a1.twimg.com/profile_images/1147334744/SN3E00600001_normal.jpg","created_at":"Thu, 27 Jan 2011 16:37:35 +0000","from_user":"deuxavril0502","id_str":"30665736556912640","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6b8b\u5ff5\u3001\u79c1\u306f\u6c96\u7e04\u3067\u3059(&gt;_&lt;)\u3067\u3082\u304a\u5929\u6c17\u826f\u3055\u305d\u3046\u3067\u826f\u304b\u3063\u305f\u306d\u3002\u3053\u3061\u3089\u306f\u96e8\u3088\uff5eRT @rinandy2010: \u305d\u3046\u3067\u3059\u3063\u266a\u51fa\u5f35\u3067(^^)\u304a\u306d\u3048\u3055\u307e\u306f\u6771\u4eac\u3067\u3059\u304b\uff1f\u3081\u3063\u3061\u3083\u5929\u6c17\u826f\u304f\u3066\u3073\u3063\u304f\u308a\u3067\u3059\u3002\u624b\u888b\u3068\u304b\u5168\u7136\u3044\u3089\u306a\u3044\u3067\u3059\u306d\u30fc RT @deuxavril0502 \u6771\u4eac\u306a\u306e\u30fc\uff1f","id":30665736556912640,"from_user_id":165242761,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.echofon.com/&quot; rel=&quot;nofollow&quot;&gt;Echofon&lt;/a&gt;"},{"from_user_id_str":"163900288","profile_image_url":"http://a1.twimg.com/profile_images/1210224823/icon12945064955238_normal.jpg","created_at":"Thu, 27 Jan 2011 16:24:37 +0000","from_user":"nyao_yurichan","id_str":"30662472734089216","metadata":{"result_type":"recent"},"to_user_id":100985873,"text":"@ray_ko302 \u767a\u898b\u3042\u308a\u304c\u3068\u3067\u3059\u3045\u3002\u3053\u3061\u3089\u3067\u3082\u3088\u308d\u3057\u304f\u306d\u3002\u6771\u4eac\u306f\u4eca\u65e5\u3082\u4e7e\u71e5\u3067\u5927\u5909\u3088\u3002\u305d\u3063\u3061\u3068\u771f\u9006\u306e\u5929\u6c17\u3060\u306d\u3002\u30a2\u30a4\u30b9\u30d0\u30fc\u30f3\u304d\u3092\u3064\u3051\u3066\u3088\u306d\u3002","id":30662472734089216,"from_user_id":163900288,"to_user":"ray_ko302","geo":null,"iso_language_code":"ja","to_user_id_str":"100985873","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"49227098","profile_image_url":"http://a3.twimg.com/profile_images/965007882/____normal.jpg","created_at":"Thu, 27 Jan 2011 15:52:26 +0000","from_user":"dosannko6","id_str":"30654371016478720","metadata":{"result_type":"recent"},"to_user_id":108570870,"text":"@peke_hajiP \u4ffa\u304c\u6771\u4eac \u6765\u3066\u6700\u521d\u306b\u9a5a\u3044\u305f\u306e\u304c\u3001\u5929\u6c17\u4e88\u5831\u3067\u82b1\u7c89\u60c5\u5831\u304c\u6d41\u308c\u308b\u3053\u3068\u3067\u3001\u6700\u521d\u306b\u8a66\u3057\u305f\u306e\u304c \u30b4\u30ad\u69d8 \u53ec\u559a\u306e\u5100\u5f0f\u3067\u3059\u304a\uff1f","id":30654371016478720,"from_user_id":49227098,"to_user":"peke_hajip","geo":null,"iso_language_code":"ja","to_user_id_str":"108570870","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"71148934","profile_image_url":"http://a0.twimg.com/profile_images/1209223630/image_normal.jpg","created_at":"Thu, 27 Jan 2011 15:46:49 +0000","from_user":"123keiko","id_str":"30652958311981058","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u9727\u5cf6\u306e\u964d\u7070\u306e\u30cb\u30e5\u30fc\u30b9\u3092\u898b\u3066\u601d\u3044\u51fa\u3057\u307e\u3057\u305f\u3002\u4e0a\u4eac\u3057\u305f\u59cb\u3081\u306e\u9803\u3001\u6771\u4eac\u306f1\u5e74\u4e2d\u3001\u7070\u304c\u964d\u3089\u306a\u3044\u304b\u3089\u7a7a\u6c17\u304c\u6f84\u3093\u3067\u3066\u904e\u3054\u3057\u3084\u3059\u3044\u306a\u3041\u3001\u3068\u601d\u3063\u305f\u306a\u3041\u3001\u3063\u3066\u3002\n\u5b9f\u5bb6\u306f\u51ac\u306e\u5b63\u7bc0\u98a8\u3067\u685c\u5cf6\u306e\u7070\u304c\u964d\u308b\u5730\u533a\u3067\u3057\u305f\u3002\u9e7f\u5150\u5cf6\u306e\u5929\u6c17\u4e88\u5831\u3067\u306f\u3001\u6bce\u65e5\u3001\u685c\u5cf6\u4e0a\u7a7a\u306e\u98a8\u5411\u304d\u4e88\u5831\u304c\u3067\u307e\u3059\u3002\u3053\u308c\u304b\u3089\u306f\u9727\u5cf6\u3082\u304b\u306a\uff1f","id":30652958311981058,"from_user_id":71148934,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"91124773","profile_image_url":"http://a3.twimg.com/profile_images/1139308356/prof101007_3-1_normal.jpg","created_at":"Thu, 27 Jan 2011 15:43:35 +0000","from_user":"sanposuruhito","id_str":"30652146277945345","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u5bb5\u306e\u90fd\u5fc3\u306f\u3001\u8eab\u3082\u5f15\u304d\u7de0\u307e\u308b\u3068\u3044\u3046\u3088\u308a\u306f\u51cd\u3048\u308b\u7a0b\u306e\u51b7\u6c17\u3092\u611f\u3058\u308b\u5bd2\u3044\u591c\u3067\u3059\u3002\u660e\u65e5\u65e5\u4e2d\u306e\u6771\u4eac\u306e\u5929\u6c17\u306f\u3001\u5915\u65b9\u306b\u591a\u5c11\u96f2\u304c\u51fa\u308b\u5834\u6240\u304c\u3042\u308a\u305d\u3046\u306a\u3082\u306e\u306e\u6982\u306d\u6674\u308c\u7a7a\u304c\u5e83\u304c\u308a\u7d9a\u3051\u305d\u3046\u3067\u3059\u3002\u6700\u9ad8\u6c17\u6e29\u306f\u30015-6\u5ea6\u4f4d\u3068\u306a\u308a\u305d\u3046\u3067\u3059\u3002#weather_tokyo","id":30652146277945345,"from_user_id":91124773,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://projects.playwell.jp/go/Saezuri&quot; rel=&quot;nofollow&quot;&gt;Saezuri&lt;/a&gt;"}],"max_id":30724239224995840,"since_id":28179956995457024,"refresh_url":"?since_id=30724239224995840&q=%E6%9D%B1%E4%BA%AC%E3%80%80%E5%A4%A9%E6%B0%97","next_page":"?page=2&max_id=30724239224995840&lang=ja&q=%E6%9D%B1%E4%BA%AC%E3%80%80%E5%A4%A9%E6%B0%97","results_per_page":15,"page":1,"completed_in":0.104827,"warning":"adjusted since_id to 28179956995457024 (), requested since_id was older than allowed -- since_id removed for pagination.","since_id_str":"28179956995457024","max_id_str":"30724239224995840","query":"%E6%9D%B1%E4%BA%AC%E3%80%80%E5%A4%A9%E6%B0%97"}
benchmarks/json-data/jp100.jsonnew file+1
@@ -0,0 +1 @@
1+{"results":[{"from_user_id_str":"178045354","profile_image_url":"http://a0.twimg.com/profile_images/1214479381/154722_10100141954893059_808622_55276626_7445050_n_normal.jpg","created_at":"Fri, 25 Feb 2011 17:40:04 +0000","from_user":"ChuriSta_gt","id_str":"41190705623732224","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3072\u3089\u304c\u306a\u306e\u300c\u3064\u300d\u306f\u3082\u3046Twitter\u306e\u300c\u3064\u300d\u3060\uff01","id":41190705623732224,"from_user_id":178045354,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twipple.jp/&quot; rel=&quot;nofollow&quot;&gt;\u3064\u3044\u3063\u3077\u308b for iPhone&lt;/a&gt;"},{"from_user_id_str":"71746558","profile_image_url":"http://a2.twimg.com/profile_images/591641547/wwd_normal.gif","created_at":"Fri, 25 Feb 2011 17:40:02 +0000","from_user":"fuckkilldiestar","id_str":"41190699571494912","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u306b\u3057\u3066\u3082Twitter\u3084pixiv\u96e2\u308c\u3092\u3069\u3046\u306b\u304b\u3057\u308d\u674f\u4ec1\u30d6\u30eb\u30de","id":41190699571494912,"from_user_id":71746558,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"131230176","profile_image_url":"http://a2.twimg.com/sticky/default_profile_images/default_profile_5_normal.png","created_at":"Fri, 25 Feb 2011 17:39:58 +0000","from_user":"proory_bot","id_str":"41190683922546688","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30ea\u30cd\u30f3\u30dd\u30fc\u30c1 http://bit.ly/btjqlH","id":41190683922546688,"from_user_id":131230176,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://proory.com/&quot; rel=&quot;nofollow&quot;&gt;proory tems&lt;/a&gt;"},{"from_user_id_str":"120359038","profile_image_url":"http://a1.twimg.com/profile_images/946521484/200805161826000_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:58 +0000","from_user":"tukinosuke","id_str":"41190680835391488","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @fuefukioyasumi: \u3082\u3046\u3044\u3044\u3002\u300c\u671d\u751f\u300d\u306a\u3093\u304b\u3044\u3044\u3002BBC\u3082CNN\u3082\u82f1\u8a9e\u653e\u9001\u3060\u3002\u307f\u3093\u306a\u3001\u30c6\u30ec\u30d3\u3092\u3076\u3061\u3063\u3068\u5207\u3063\u3066Twitter\u3092\u898b\u3088\u3046\u3002\u3053\u3053\u306b\u300c\u751f\u304d\u305f\u60c5\u5831\u300d\u304c\u6d41\u308c\u3066\u3044\u308b\u3002\u300c\u751f\u304d\u305f\u53eb\u3073\u300d\u304c\u3042\u308b\u3002\u3053\u3053\u304b\u3089\u3067\u3082\u6b74\u53f2\u306e\u8ee2\u63db\u70b9\u3092\u611f\u3058\u308b\u4e8b\u304c\u3067\u304d\u308b\u306e\u3060\u3002 @gjmorley #libjp","id":41190680835391488,"from_user_id":120359038,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"166512109","profile_image_url":"http://a3.twimg.com/profile_images/1224583217/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:50 +0000","from_user":"yurii1129","id_str":"41190649839620096","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u6c17\u4ed8\u3044\u305f\u2026\u307f\u3043\u304f\u3093\u306eTwitter\u540d\u3001\u3084\u307e\u306d\u3084\u3093(\uffe3\u25c7\uffe3;)","id":41190649839620096,"from_user_id":166512109,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"228999619","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_6_normal.png","created_at":"Fri, 25 Feb 2011 17:39:49 +0000","from_user":"takami926","id_str":"41190644793745408","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u7530\u539f\u3055\u3093\u3001\u5fdc\u63f4\u3057\u3066\u307e\u3059\u3002WEB\u3082TWITTER\u3082\u62dd\u898b\u3057\u3066\u307e\u3059\u3002\u7530\u539f\u3055\u3093\u304c\u653f\u6cbb\u5bb6\u306b\u306a\u3063\u3066\u3001\u65e5\u672c\u3092\u5909\u3048\u3066\u304f\u3060\u3055\u3044\u3002\u5c16\u95a3\u3001\u5317\u65b9\u554f\u984c\u5171\u306b\u65e5\u672c\u306e\u653f\u6cbb\u306e\u5931\u6557\u3067\u3059\u3002\u8a55\u8ad6\u5bb6\u306f\u8272\u3005\u8a00\u3063\u3066\u307e\u3059\u304c\u3001\u4e2d\u6771\u307b\u3069\u56fd\u6c11\u306e\u71b1\u6c17\u304c\u7121\u304f\u3001\u683c\u5dee\u304c\u3042\u308a\u3001\u4f55\u3082\u5909\u308f\u3089\u306a\u3044\u666f\u6c17\u4f4e\u8ff7\u306e\u65e5\u672c\u306b\u56fd\u6c11\u306f\u8ae6\u3081\u3066\u308b\u3093\u3067\u3059\u3002","id":41190644793745408,"from_user_id":228999619,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"151773701","profile_image_url":"http://a0.twimg.com/profile_images/1213699753/obi_nao_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:44 +0000","from_user":"obi_nao","id_str":"41190622949941248","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3060\u3044\u3076\u5e74\u4e0b\u306e\u5f8c\u8f29\u306b\u3001\u30d3\u30b8\u30cd\u30b9\u3084\u308b\u306a\u3089\u771f\u5263\u306bTwitter\u3084\u308c\uff01\u3063\u3066\u6012\u3089\u308c\u305f\u3002\u306a\u306e\u3067\u4eca\u65e5\u304b\u3089\u771f\u5263\u306b\u3064\u3076\u3084\u304f\u3053\u3068\u306b\u3057\u307e\u3059\u3002\u3088\u308d\u3057\u304f\u3067\u3059\u3002","id":41190622949941248,"from_user_id":151773701,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.flight.co.jp/iPhone/TweetMe/&quot; rel=&quot;nofollow&quot;&gt;TweetMe for iPhone&lt;/a&gt;"},{"from_user_id_str":"20817229","profile_image_url":"http://a0.twimg.com/profile_images/1212012721/205_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:43 +0000","from_user":"allte","id_str":"41190619804082176","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u7206\u7b11\u3057\u3066\u547c\u5438\u56f0\u96e3\u3067\u75d9\u6523\u3059\u308b\u5618\u304f\u3093\u304c\u898b\u308c\u308b\u306e\u306fTwitter\u3060\u3051","id":41190619804082176,"from_user_id":20817229,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.movatwi.jp&quot; rel=&quot;nofollow&quot;&gt;www.movatwi.jp&lt;/a&gt;"},{"from_user_id_str":"166907967","profile_image_url":"http://a2.twimg.com/profile_images/1250526230/___normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:43 +0000","from_user":"NTTYAHOOOOOOOI","id_str":"41190618235412480","metadata":{"result_type":"recent"},"to_user_id":106469594,"text":"@takahirororo \u3066\u304b\u4f55\u3067twitter\u4e0a\u3067\u30a2\u30c9\u30d0\u30a4\u30b9\u3082\u3089\u3063\u3066\u3093\u306d\u3093\uff57","id":41190618235412480,"from_user_id":166907967,"to_user":"takahirororo","geo":null,"iso_language_code":"ja","to_user_id_str":"106469594","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"82581287","profile_image_url":"http://a0.twimg.com/profile_images/774721566/miyaru2_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:38 +0000","from_user":"kine_rahchaos","id_str":"41190598132244480","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30a2\u30aa\u30b7\u30de\u3055\u3093\u304cTwitter\u59cb\u3081\u305f\u3060\u3068\u2026","id":41190598132244480,"from_user_id":82581287,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://sourceforge.jp/projects/tween/wiki/FrontPage&quot; rel=&quot;nofollow&quot;&gt;Tween&lt;/a&gt;"},{"from_user_id_str":"136633905","profile_image_url":"http://a2.twimg.com/profile_images/1247161991/yama_normal.png","created_at":"Fri, 25 Feb 2011 17:39:35 +0000","from_user":"yamachi39","id_str":"41190584706285568","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3084\u3063\u3071\u308amixi\u3088\u308atwitter\u306e\u304c\u597d\u304d\u304b\u3082","id":41190584706285568,"from_user_id":136633905,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://jigtwi.jp/?p=1&quot; rel=&quot;nofollow&quot;&gt;jigtwi&lt;/a&gt;"},{"from_user_id_str":"44029295","profile_image_url":"http://a2.twimg.com/profile_images/1112965522/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:32 +0000","from_user":"no2yosee","id_str":"41190572769280000","metadata":{"result_type":"recent"},"to_user_id":97721124,"text":"@hn0345 \u3042\u3001\u500b\u4eba\u7684\u306b\u306f\u4eca\u306ftwitter\u306e\u30d7\u30ed\u30d5\u30a3\u30fc\u30eb\u306b\u66f8\u3044\u3066\u3042\u308b\u30d6\u30ed\u30b0\u306e\u30e6\u30cb\u30c3\u30c8\u3092\u306e\u3093\u3073\u308a\u3084\u3063\u3066\u307e\u3059w","id":41190572769280000,"from_user_id":44029295,"to_user":"hn0345","geo":null,"iso_language_code":"ja","to_user_id_str":"97721124","source":"&lt;a href=&quot;http://www.flight.co.jp/iPhone/TweetMe/&quot; rel=&quot;nofollow&quot;&gt;TweetMe for iPhone&lt;/a&gt;"},{"from_user_id_str":"149872179","profile_image_url":"http://a0.twimg.com/profile_images/1145770150/Winter11_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:31 +0000","from_user":"xmyyyxx","id_str":"41190566951653376","metadata":{"result_type":"recent"},"to_user_id":95069405,"text":"@rindofu \u653b\u7565\u672c\u3042\u308c\u3070\u3044\u3044\u306e\u306b\u3063\u3066\u601d\u3044\u307e\u3059(T\u03c9T)/~~~ \u79c1\u3082\u76f4\u3057\u305f\u3044\u3068\u3053\u3044\u3063\u3071\u3044\u3060\u3051\u3069\u3001\u3042\u306860\u5e74\u304f\u3089\u3044\u3044\u304d\u3089\u308c\u308b\u306f\u305a\u3060\u3057\u3001\u306e\u3093\u3073\u308a\u76f4\u308c\u3070\u3044\u3044\u306a\u3042 \u304a\u3084\u3059\u307f\u3067\u3059^^\uff01\u308a\u3093\u3055\u3093\u3068twitter\u3067\u4ef2\u826f\u304f\u306a\u308c\u3066\u3088\u304b\u3063\u305f\u3067\u3059\u3063","id":41190566951653376,"from_user_id":149872179,"to_user":"rindofu","geo":null,"iso_language_code":"ja","to_user_id_str":"95069405","source":"&lt;a href=&quot;http://twtr.jp&quot; rel=&quot;nofollow&quot;&gt;Keitai Web&lt;/a&gt;"},{"from_user_id_str":"105579892","profile_image_url":"http://a0.twimg.com/profile_images/1212950455/love_happy_pink_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:30 +0000","from_user":"love_happy_pink","id_str":"41190566494601216","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u305d\u308c\u898b\u305f\u3044\u306a\u266aRT @kazukt \u3046\u308b\u304a\u307c\u7d75\u3001\u4ed6\u306e\u4eba\u306e\u3082\u898b\u3066\u3044\u305f\u3089\u3084\u305f\u3089\u30de\u30f3\u30ac\u306e\u30ad\u30e3\u30e9\u30af\u30bf\u30fc\u3067\u3080\u3061\u3083\u304f\u3061\u3083\u4e0a\u624b\u3044\u4eba\u304c\uff01\u2026\u3068\u3001\u30d7\u30ed\u30d5\u30a3\u30fc\u30eb\u898b\u305f\u3089\u3001\u306a\u3093\u3068\u3054\u672c\u4eba\u304c\u66f8\u3044\u3066\u3044\u3089\u3063\u3057\u3083\u3063\u305f\u3002Twitter\u3063\u3066\u30b9\u30b4\u30a4\u308f\u3002","id":41190566494601216,"from_user_id":105579892,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.nibirutech.com/&quot; rel=&quot;nofollow&quot;&gt;TwitBird iPad&lt;/a&gt;"},{"from_user_id_str":"16996368","profile_image_url":"http://a0.twimg.com/profile_images/1198892387/pochi_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:30 +0000","from_user":"HyoYoshikawa","id_str":"41190564187611136","metadata":{"result_type":"recent"},"to_user_id":1800565,"text":"@shinichiro_beck \u73fe\u5730\u304b\u3089\u306a\u3089\u826f\u304f\u3066\u4ed6\u306e\u5730\u57df\u304b\u3089\u3060\u4f59\u8a08\u306a\u3089\u3001\u4f55\u306e\u305f\u3081\u306bTwitter\u304c\u3042\u308b\u306e\u304b\u308f\u304b\u3089\u306a\u3044\u3088\u3002\u3044\u307e\u8d77\u304d\u3066\u308b\u3053\u3068\u306e\u8aac\u660e\u3082\u3064\u304b\u306a\u3044\u3002\u30a2\u30eb\u30b8\u30e3\u30b8\u30fc\u30e9\u304c\u4f1d\u3048\u3066\u308b\u3053\u3068\u304c\u5168\u3066\u3058\u3083\u306a\u3044\u3057\u3001\u65e5\u672c\u306eTV\u306f\u4f1d\u3048\u306a\u3044\u3067\u3057\u3087\u3046\u3002\u77e5\u308a\u305f\u304c\u3063\u3066\u308b\u4eba\u3082\u305f\u304f\u3055\u3093\u3044\u308b\u3002","id":41190564187611136,"from_user_id":16996368,"to_user":"shinichiro_beck","geo":null,"iso_language_code":"ja","to_user_id_str":"1800565","source":"&lt;a href=&quot;http://www.hootsuite.com&quot; rel=&quot;nofollow&quot;&gt;HootSuite&lt;/a&gt;"},{"from_user_id_str":"119070802","profile_image_url":"http://a2.twimg.com/profile_images/1229773005/346d8435099798113a1326e1ba4949ee_normal.jpeg","created_at":"Fri, 25 Feb 2011 17:39:25 +0000","from_user":"takotako726","id_str":"41190545439207424","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u9b54\u6cd5\u5c11\u5973\u307e\u3069\u304b\u30de\u30ae\u30ab\u306e\u53cd\u97ff\u304ctwitter\u3067\u306f\u3093\u3071\u306d\u3048\u4ef6\u3002","id":41190545439207424,"from_user_id":119070802,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://z.twipple.jp/&quot; rel=&quot;nofollow&quot;&gt;\u3064\u3044\u3063\u3077\u308b/twipple&lt;/a&gt;"},{"from_user_id_str":"165695316","profile_image_url":"http://a1.twimg.com/profile_images/681748782/ring_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:21 +0000","from_user":"pandora_shotbar","id_str":"41190526447390720","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u300e\u30b7\u30e7\u30c3\u30c8\u30d0\u30fc\u3000\u30d1\u30f3\u30c9\u30e9\u3000\u30c4\u30a4\u30c3\u30bf\u30fc\u306e\u3064\u3076\u3084\u304d\u300f\u30b7\u30e7\u30c3\u30c8\u30d0\u30fc\u3000\u30d1\u30f3\u30c9\u30e9\u3000\u30c4\u30a4\u30c3\u30bf\u30fc\u306e\u3064\u2026\uff5chttp://pandora-twitter.seesaa.net/article/187809936.html","id":41190526447390720,"from_user_id":165695316,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://blog.seesaa.jp/&quot; rel=&quot;nofollow&quot;&gt;SeesaaBlog&lt;/a&gt;"},{"from_user_id_str":"88862311","profile_image_url":"http://a2.twimg.com/profile_images/1182243698/161113_100001897885617_169366_q_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:16 +0000","from_user":"amebaguide","id_str":"41190504926416896","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u300e\u30a2\u30e1\u30d6\u30ed\u653b\u7565\u30ac\u30a4\u30c9\u306e\u30c4\u30a4\u30c3\u30bf\u30fc\u306e\u3064\u3076\u3084\u304d\u300f\u30d6\u30ed\u30b0\u306e\u653b\u7565\u3000\u30c4\u30a4\u30c3\u30bf\u30fc\u306e\u3064\u3076\u3084\u304d\u96c6\uff5chttp://accessup-twitter.seesaa.net/article/187809931.html","id":41190504926416896,"from_user_id":88862311,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://blog.seesaa.jp/&quot; rel=&quot;nofollow&quot;&gt;SeesaaBlog&lt;/a&gt;"},{"from_user_id_str":"186895007","profile_image_url":"http://a2.twimg.com/profile_images/1229610799/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:11 +0000","from_user":"zizikt","id_str":"41190486123356161","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3053\u308c\u306f\u500b\u4eba\u7684\u306b\u306f\u91cd\u5b9d\u3067\u3059\u3002\n\u25c6iPhone&amp;iPad\u5411\u3051Twitter\u30a2\u30d7\u30ea\u300c\u3064\u3044\u3063\u3077\u308b\u300d\u306bEvernote\u3068\u306e\u9023\u643a\u6a5f\u80fd\u3092\u8ffd\u52a0 \nhttp://bit.ly/hPf44u","id":41190486123356161,"from_user_id":186895007,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"132320738","profile_image_url":"http://a3.twimg.com/profile_images/1229760475/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:04 +0000","from_user":"faina_","id_str":"41190453592334336","metadata":{"result_type":"recent"},"to_user_id":167894537,"text":"@gjmorley \u30e2\u30fc\u30ea\u30fc\u3055\u3093\u306e\u7ffb\u8a33\u306e\u8a00\u8449\u306e\u30bb\u30f3\u30b9\u304c\u3059\u304d\u3067\u3059\u3002\u305d\u3057\u3066\u3001Twitter\u3067\u77e5\u308b\u3001\u73fe\u5730\u306e\u4eba\u306e\u76ee\u306e\u529b\u3084\u3001\u60c5\u5831\u3092\u4f1d\u3048\u3066\u304f\u308c\u308b\u7686\u3055\u3093\u306e\u60c5\u71b1\u306b\u611f\u52d5\u3057\u3066\u3044\u307e\u3059\u3002\u611f\u52d5\u3059\u308b\u3063\u3066\u3059\u3054\u3044\u30a8\u30cd\u30eb\u30ae\u30fc\u3067\u3059\uff01\uff01","id":41190453592334336,"from_user_id":132320738,"to_user":"gjmorley","geo":null,"iso_language_code":"ja","to_user_id_str":"167894537","source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"24870552","profile_image_url":"http://a3.twimg.com/profile_images/907130634/4_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:03 +0000","from_user":"tana1192","id_str":"41190450480021504","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u500b\u4eba\u7684\u306b\u306f\u3001\u30bf\u30b0\u5f3e\u304d\u3059\u308c\u3070\u3044\u3044\uff08\u5f3e\u3051\u308b\u30c4\u30fc\u30eb\u3092\u4f7f\u3063\u3066Twitter\u3092\u3059\u308c\u3070\u3044\u3044\uff09\u3068\u601d\u3046\u3093\u3060\u3051\u3069\u306a\u3042\u3002\u307f\u3093\u306a\u305d\u308c\u306a\u308a\u306bTwitter\u3084\u308b\u4eba\u3060\u3057\u3001\u30c4\u30fc\u30eb\u9078\u3073\u304f\u3089\u3044\u5e45\u3092\u6301\u3063\u3066\u3084\u3063\u3066\u3082\u3002 \u307e\u3042\u3001\u4ffa\u30a2\u30cb\u30e1\u306f\u89b3\u308b\u89b3\u308b\u8a50\u6b3a\u3059\u308b\u3060\u3051\u306e\u4eba\u3060\u304b\u3089\u95a2\u4fc2\u306a\u3044\u3093\u3060\u3051\u3069\u3082\uff57\uff57\u5b9f\u6cc1\u306f\u697d\u3057\u305d\u3046\u306b\u898b\u3048\u308b\u3088\u3002","id":41190450480021504,"from_user_id":24870552,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://sourceforge.jp/projects/tween/wiki/FrontPage&quot; rel=&quot;nofollow&quot;&gt;Tween&lt;/a&gt;"},{"from_user_id_str":"58509646","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Fri, 25 Feb 2011 17:39:02 +0000","from_user":"kakuyas","id_str":"41190446663344128","metadata":{"result_type":"recent"},"to_user_id":107076877,"text":"@Dayspool \u6df1\u591c\uff12\uff19\u6642\u304f\u3089\u3044\u307e\u3067\u306f\u6bce\u65e5\u55b6\u696d\u3057\u3066\u308b\u306e\u3067\u3001twitter\u3001\u30e1\u30c3\u30bb\u3001PS3\u306a\u3069\u3067\u3088\u3093\u3067\u3051\u308c\u3002\u3053\u3063\u3061\u304b\u3089\u58f0\u304b\u3051\u308b\u3053\u3068\u3082\u3042\u308b\u304b\u3082\u3060\u304c\uff57","id":41190446663344128,"from_user_id":58509646,"to_user":"Dayspool","geo":null,"iso_language_code":"ja","to_user_id_str":"107076877","source":"&lt;a href=&quot;http://cheebow.info/chemt/archives/2007/04/twitterwindowst.html&quot; rel=&quot;nofollow&quot;&gt;Twit for Windows&lt;/a&gt;"},{"from_user_id_str":"149128527","profile_image_url":"http://a2.twimg.com/profile_images/1254922702/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:00 +0000","from_user":"uni13yoki","id_str":"41190437087748096","metadata":{"result_type":"recent"},"to_user_id":119468594,"text":"@kuro_wr84 \u304a\u308c\u3068\u304a\u524d\u3067Twitter\u3067\u4f1a\u8a71\u3057\u305f\u3089\u3001\u5927\u5909\u306a\u3053\u3068\u306b\u306a\u308b\u306a","id":41190437087748096,"from_user_id":149128527,"to_user":"kuro_wr84","geo":null,"iso_language_code":"ja","to_user_id_str":"119468594","source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"18670595","profile_image_url":"http://a2.twimg.com/profile_images/1250674062/ProfilePhoto_normal.png","created_at":"Fri, 25 Feb 2011 17:38:59 +0000","from_user":"nyuuuuun","id_str":"41190436450222080","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3078\u30fc\u3053\u3093\u306a\u306b\u3088\u304f\u4f3c\u308b\u3053\u3068\u3082\u3042\u308b\u3093\u3060\u30fc\nhttp://twitter.com/Re_44/status/35943233016168448\nhttp://twitter.com/3510_misaka/status/36122114821988352","id":41190436450222080,"from_user_id":18670595,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"96267603","profile_image_url":"http://a3.twimg.com/profile_images/1245253473/DSiLL3_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:59 +0000","from_user":"arivis","id_str":"41190433119940608","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://twitter.com/#!/arivis/status/40636755380142080 \u306a\u3093\u3064\u3046\u304b\u3053\u308c\u3067\u8d64\u3063\u3066\u306e\u3082\u3061\u3087\u3063\u3068\u3042\u308c\u3063\u3059\u306d\u3002\u305d\u3057\u3066\u4e88\u671f\u3057\u3066\u3044\u305f\u304b\u306e\u3088\u3046\u3060","id":41190433119940608,"from_user_id":96267603,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"148097776","profile_image_url":"http://a3.twimg.com/profile_images/1166904064/broken-heart_normal.png","created_at":"Fri, 25 Feb 2011 17:38:56 +0000","from_user":"ReajuBreaker_A","id_str":"41190422135058432","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u672c\u57a2\u30d5\u30a9\u30ed\u30fc\u3088\u308d\u3057\u304f\u3067\u3059\u2192 http://twitter.com/ReajuBreaker \uff08\uff20\u3060\u3068\u30ea\u30d7\u30e9\u30a4\u304c\u57cb\u307e\u308b\u305f\u3081\u3001URL\u306b\u3057\u3066\u3042\u308a\u307e\u3059\uff09","id":41190422135058432,"from_user_id":148097776,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.twitter.com/ReajuBreaker&quot; rel=&quot;nofollow&quot;&gt;\u73fe\u5145\u6bba\u3057\u306e\u7121\u4eba\u9023\u545f\uff1c\u30aa\u30fc\u30c8\u30c4\u30a4\u30fc\u30c8\uff1e&lt;/a&gt;"},{"from_user_id_str":"59711654","profile_image_url":"http://a2.twimg.com/profile_images/416212928/flowers-06-1_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:56 +0000","from_user":"agamo45","id_str":"41190421522546688","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @ebizo66: \u30ea\u30d3\u30a2\u30fb\u30c8\u30ea\u30dd\u30ea\u306eTw\uff1a\u6551\u6025\u8eca\u304c\u6765\u305f\u304c\u3001\u8ca0\u50b7\u8005\u3092\u8eca\u5185\u3067\u6bba\u5bb3\u3057\u3066\u3044\u305f\u3001\u3068\u3002\uff08\u6ec5\u8336\u82e6\u8336\u3060\uff01\uff09http://ow.ly/43pQ2 #libjp","id":41190421522546688,"from_user_id":59711654,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.hootsuite.com&quot; rel=&quot;nofollow&quot;&gt;HootSuite&lt;/a&gt;"},{"from_user_id_str":"145311373","profile_image_url":"http://a3.twimg.com/profile_images/1187802576/a_gam_02_normal.png","created_at":"Fri, 25 Feb 2011 17:38:55 +0000","from_user":"nogic1008","id_str":"41190418141937664","metadata":{"result_type":"recent"},"to_user_id":88117317,"text":"@runasoru \u307e\u3042\u5acc\u306a\u3089\u6df1\u591c\u5e2f\u306bTwitter\u898b\u306a\u304d\u3083\u3044\u3044\u3060\u3051\u3067\u3059\u304b\u3089\u306d\u30fc \u30103/19BDM\u30aa\u30d5http://twvt.us/bdoff_kansai\u3011","id":41190418141937664,"from_user_id":145311373,"to_user":"runasoru","geo":null,"iso_language_code":"ja","to_user_id_str":"88117317","source":"&lt;a href=&quot;http://sourceforge.jp/projects/tween/wiki/FrontPage&quot; rel=&quot;nofollow&quot;&gt;Tween&lt;/a&gt;"},{"from_user_id_str":"195851300","profile_image_url":"http://a2.twimg.com/profile_images/1124572815/be7b4c0a06cb60e8_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:49 +0000","from_user":"LoveLAscrewDoll","id_str":"41190391147540480","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @jp_mjp: SCREW TV SHOW Vol.6\u306e\u653e\u9001\u304c\u7121\u4e8b\u306b\u7d42\u4e86\u3044\u305f\u3057\u307e\u3057\u305f\u3002\u3054\u89a7\u9802\u304d\u3042\u308a\u304c\u3068\u3046\u3054\u3056\u3044\u307e\u3057\u305f\uff01\u6b21\u56de\u653e\u9001\u306f3\u670818\u65e5(\u91d1)\u3067\u3059\u3002\u8996\u8074\u8005\u30d7\u30ec\u30bc\u30f3\u30c8\u306e\u8a73\u7d30\u306f\u5f8c\u65e5MJP\u3067\u304a\u77e5\u3089\u305b\u3044\u305f\u3057\u307e\u3059\u3002\u305d\u306e\u969b\u306b\u306f\u3001\u3053\u306eTwitter\u3067\u3082\u304a\u77e5\u3089\u305b\u3044\u305f\u3057\u307e\u3059\u306e\u3067\u3001\u304a\u697d\u3057\u307f\u306b\uff01#SCREWTV","id":41190391147540480,"from_user_id":195851300,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://z.twipple.jp/&quot; rel=&quot;nofollow&quot;&gt;\u3064\u3044\u3063\u3077\u308b/twipple&lt;/a&gt;"},{"from_user_id_str":"178045354","profile_image_url":"http://a0.twimg.com/profile_images/1214479381/154722_10100141954893059_808622_55276626_7445050_n_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:48 +0000","from_user":"ChuriSta_gt","id_str":"41190389549510656","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3053\u3053\u4e00\u9031\u9593Twitter\u304c\u3084\u305f\u3089\u697d\u3057\u3044\u306e\u3067\u3059\u3051\u3069\u30fc\u30fc\u30fc\uff01\u306b\u3072\u3072\u3063\u7b11","id":41190389549510656,"from_user_id":178045354,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twipple.jp/&quot; rel=&quot;nofollow&quot;&gt;\u3064\u3044\u3063\u3077\u308b for iPhone&lt;/a&gt;"},{"from_user_id_str":"50592111","profile_image_url":"http://a0.twimg.com/profile_images/1252176582/lFjpi_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:48 +0000","from_user":"crowNeko","id_str":"41190387271864320","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30a8\u30ed\u30b2\u30d7\u30ec\u30a4\u3057\u306a\u304c\u3089\u307e\u3069\u30de\u30aeTL\u3092\u898b\u306a\u3044\u3088\u3046\u306b\u534a\u76ee\u306b\u306a\u308a\u306a\u304c\u3089Twitter\u3057\u3066\u308b\u6df1\u591c2\u6642\u534a\u3002","id":41190387271864320,"from_user_id":50592111,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://stone.com/Twittelator&quot; rel=&quot;nofollow&quot;&gt;Twittelator&lt;/a&gt;"},{"from_user_id_str":"7141467","profile_image_url":"http://a3.twimg.com/profile_images/1198540741/icon12912579345276_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:40 +0000","from_user":"hina_geshi","id_str":"41190355961380864","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u7d50\u5c40\u30cd\u30bf\u30d0\u30ec\u3059\u3093\u306a\u3063\u3066\u8a00\u3046\u65b9\u304c\u30a2\u30ec\u3060\u3088\u306d\u3001\u3057\u306a\u3044\u308f\u3051\u7121\u3044\u3058\u3083\u306a\u3044\u8133\u5185\u5782\u308c\u6d41\u3057\u304cTwitter\u306a\u3093\u3060\u304b\u3089\u3055","id":41190355961380864,"from_user_id":7141467,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://projects.playwell.jp/go/Saezuri&quot; rel=&quot;nofollow&quot;&gt;Saezuri&lt;/a&gt;"},{"from_user_id_str":"149608984","profile_image_url":"http://a0.twimg.com/profile_images/1205950885/090702_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:39 +0000","from_user":"Mr_Tsubaki","id_str":"41190349447774208","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u307e\u3069\u304b\u306fTwitter\u5408\u308f\u305b\u3066\uff11\u6642\u9593\u306f\u697d\u3057\u3044","id":41190349447774208,"from_user_id":149608984,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://z.twipple.jp/&quot; rel=&quot;nofollow&quot;&gt;\u3064\u3044\u3063\u3077\u308b/twipple&lt;/a&gt;"},{"from_user_id_str":"122271550","profile_image_url":"http://a0.twimg.com/profile_images/961936499/neoneko_bot5jpg_____normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:39 +0000","from_user":"neoneko_bot5","id_str":"41190348726345728","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u30c6\u30b9\u30c8\uff1a23\u3011\u4eca\u65e5\u304b\u3089\u5ba3\u4f1d\u958b\u59cb\u2606\u306d\u304a\u306d\u3053\u306eTwitter \u3067 EasyBottex\u3000\u3067\u304d\u308b\u307e\u3067\uff01\u2192http://neoneko.blog31.fc2.com/","id":41190348726345728,"from_user_id":122271550,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www20.atpages.jp/neoneko/&quot; rel=&quot;nofollow&quot;&gt;neoneko_bot5&lt;/a&gt;"},{"from_user_id_str":"127069188","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_6_normal.png","created_at":"Fri, 25 Feb 2011 17:38:37 +0000","from_user":"MYCHEBOT","id_str":"41190340908163074","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30eb\u30d5\u3055\u3093\u304c\u914d\u4fe1\u3092\u7d42\u4e86\u3057\u307e\u3057\u305f\uff01/ http://777labo.com/mychecker/view/745.php / \u30c8\u30d4\u30c3\u30af:XSplit\u30c6\u30b9\u30c8\u3000twitter\u2192http://twitter.com/rukh01","id":41190340908163074,"from_user_id":127069188,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://777labo.com/mychecker/&quot; rel=&quot;nofollow&quot;&gt;MYCHEBOT&lt;/a&gt;"},{"from_user_id_str":"107626142","profile_image_url":"http://a1.twimg.com/profile_images/1104968421/SuperMaika1_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:34 +0000","from_user":"MaikaPaPa","id_str":"41190328614666240","metadata":{"result_type":"recent"},"to_user_id":null,"text":"75\u5e74\u524d\u306e\u4eca\u65e52\u670826\u65e5\u672a\u660e\u3001\u82e5\u304d\u9752\u5e74\u5c06\u6821\u3089\u304c\u653f\u6cbb\u8150\u6557\u3068\u8fb2\u6751\u306e\u56f0\u7aae\u306b\u5bfe\u3057\u3066\u6c7a\u8d77\u3057\u307e\u3057\u305f\u3002\u3082\u3061\u308d\u3093\u5f53\u6642\u306fTwitter\u3082FB\u3082\u3001\u307e\u305f\u5f53\u7136\u306a\u304c\u3089Internet\u3082\u3042\u308a\u307e\u305b\u3093\u3067\u3057\u305f\u3002\u4e00\u65b9\u3001\u30c1\u30e5\u30cb\u30b8\u30a2\u3001\u30a8\u30b8\u30d7\u30c8\u3001\u4e2d\u6771\u306b\u5e83\u304c\u308b\u53cd\u653f\u5e9c\u30c7\u30e2\u3068\u5f37\u6a29\u4f53\u5236\u306e\u5d29\u58ca\u3002\u73fe\u5728\u306e\u65e5\u672c\u3067\u306f\u8003\u3048\u3089\u308c\u306a\u3044\u3053\u3068\u3067\u3059\u3002","id":41190328614666240,"from_user_id":107626142,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"11111695","profile_image_url":"http://a1.twimg.com/sticky/default_profile_images/default_profile_0_normal.png","created_at":"Fri, 25 Feb 2011 17:38:28 +0000","from_user":"kumatchipooh","id_str":"41190306145775617","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @inosenaoki: \u306a\u308b\u307b\u3069\u306d\u3002 RT @dansrmz @inosenaoki \u3053\u3061\u3089\u304c\u30bd\u30d5\u30c8\u30d0\u30f3\u30af\u526f\u793e\u9577\u306e\u677e\u672c\u5fb9\u4e09\u3055\u3093\u306e\u3001Twitter\u306b\u95a2\u3059\u308b\u8ad6\u8003\u3067\u3059\u3002 \u25b6 &quot;Twitter\u306e2\u30c1\u30e3\u30f3\u30cd\u30eb\u5316\u306f\u9632\u6b62\u51fa\u6765\u308b\u304b&quot; http://t.co/Mwzb8Zf","id":41190306145775617,"from_user_id":11111695,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"212161909","profile_image_url":"http://a1.twimg.com/profile_images/1252895790/natm01_normal.gif","created_at":"Fri, 25 Feb 2011 17:38:28 +0000","from_user":"n34hitman","id_str":"41190303830511616","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Twitter\u30fb\u30d6\u30ed\u30b0\u30a2\u30d5\u30a3\u30ea\u30a8\u30a4\u30c8\u81ea\u52d5\u6295.... http://goo.gl/a4RHB 4054","id":41190303830511616,"from_user_id":212161909,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twibow.net/&quot; rel=&quot;nofollow&quot;&gt;Twibow&lt;/a&gt;"},{"from_user_id_str":"105945593","profile_image_url":"http://a2.twimg.com/sticky/default_profile_images/default_profile_5_normal.png","created_at":"Fri, 25 Feb 2011 17:38:24 +0000","from_user":"nakano_bot","id_str":"41190285710983168","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3053\u306ebot\u306f\u4e0d\u52d5\u7523\u4f1a\u793e\u69d8\u5411\u3051\u306e\u4e0d\u52d5\u7523\u30dd\u30fc\u30bf\u30eb\u30b5\u30a4\u30c8\u3078\u306e\u4e00\u62ec\u8ee2\u9001\uff0bTwitter\u7121\u6599\u8ee2\u9001\u30b5\u30fc\u30d3\u30b9\u306b\u3088\u308a\u3064\u3076\u3084\u304d\u307e\u3059\u3002\u3054\u5229\u7528\u306b\u306a\u308a\u305f\u3044\u5834\u5408\u306f http://bit.ly/demey0 \u306b\u304a\u6c17\u8efd\u306b\u304a\u554f\u3044\u5408\u308f\u305b\u4e0b\u3055\u3044\u3002","id":41190285710983168,"from_user_id":105945593,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.teramax.jp/aboutus.html&quot; rel=&quot;nofollow&quot;&gt;tmxbot&lt;/a&gt;"},{"from_user_id_str":"170904226","profile_image_url":"http://a2.twimg.com/profile_images/1249020397/1789kb_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:21 +0000","from_user":"1789kb","id_str":"41190274428305408","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3068\u308a\u3042\u3048\u305a\u4eca\u56de\u521d\u3081\u3066\u30ea\u30a2\u30eb\u30bf\u30a4\u30e0\u3067\u898b\u3066\u308f\u304b\u3063\u305f\u306e\u306f\u3001QB\u306f\u5168\u8eab\u304c\u30a2\u30f3\u30d1\u30f3\u30bf\u30a4\u30d7\u3060\u3068\u3044\u3046\u3053\u3068\u3068\u3001\u307e\u3069\u30de\u30ae\u7d42\u4e86\u5f8c\u306eTwitter\u306e\u3056\u308f\u3064\u304d\u304c\u3059\u3054\u3044\u3068\u3044\u3046\u3053\u3068","id":41190274428305408,"from_user_id":170904226,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.echofon.com/&quot; rel=&quot;nofollow&quot;&gt;Echofon&lt;/a&gt;"},{"from_user_id_str":"166169644","profile_image_url":"http://a1.twimg.com/profile_images/1217017679/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:18 +0000","from_user":"Okkkkkkkkkkun","id_str":"41190262420017152","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3063\u3066Twitter\u3067\u3064\u3076\u3084\u304f\u81ea\u5206\u3082\u76f8\u5f53\u5c0f\u3055\u3044\u306a\u3002","id":41190262420017152,"from_user_id":166169644,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"196623456","profile_image_url":"http://a3.twimg.com/profile_images/1219076661/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:06 +0000","from_user":"NoMoneyClub","id_str":"41190213342601216","metadata":{"result_type":"recent"},"to_user_id":195462431,"text":"@yosal15 \nTwitter\u3084\u3063\u3066\u308b\u3089\u3057\u3044\u3002\u3051\u3069\u3001\u898b\u3064\u304b\u3089\u306a\u3044\u3002","id":41190213342601216,"from_user_id":196623456,"to_user":"yosal15","geo":null,"iso_language_code":"ja","to_user_id_str":"195462431","source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"126984048","profile_image_url":"http://a3.twimg.com/profile_images/1254579571/zipyaru-20090829-23-0012_normal.png","created_at":"Fri, 25 Feb 2011 17:38:02 +0000","from_user":"minaduki_naduki","id_str":"41190196418584576","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u203b\u30e1\u30fc\u30eb\u3067\u5973\u306e\u5b50\u53e3\u8aac\u304f\u306e\u306b\u5fd9\u3057\u3044\u3093\u3060\u305d\u3046\u3067\u3059\u3000\u307e\u3058\u3058\u3054\u308d RT @yowano_k: \u5fd9\u3057\u304f\u3066\u3082Twitter\u306b\u9854\u3092\u51fa\u3057\u305f\u304f\u306a\u308b\u50d5\u30a7\u2026\u2026","id":41190196418584576,"from_user_id":126984048,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://seesmic.com/seesmic_desktop/sd2&quot; rel=&quot;nofollow&quot;&gt;Seesmic Desktop&lt;/a&gt;"},{"from_user_id_str":"200568705","profile_image_url":"http://a3.twimg.com/profile_images/1242179765/101230_1355_01_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:01 +0000","from_user":"hammerstrap","id_str":"41190190428979200","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6628\u65e5\u91d1\u66dc\u65e5\u306f\u732e\u8840\u306b\u5f80\u304f\u3002\u4eca\u306e\u50d5\u306e\u4eba\u9593\u3068\u3057\u3066\u306e\u4fa1\u5024\u306f\u3001\u7cbe\u3005\u3053\u306e\u7a0b\u5ea6\u3002\u8179\u304c\u6e1b\u3063\u305f\u3002\u5374\u8aac\u3002twitter\u306e\u767e\u56db\u5341\u6587\u5b57\u306b\u82db\u3005\u3068\u3057\u3066\u3001\u4e00\u3064\u306e\u4eee\u8aac\u306b\u4fe1\u6191\u6027\u3092\u5f97\u308b\u3002\u6226\u6642\u4e0b\u306e\u7d19\u306e\u7d71\u5236\u3068\u3001\u4e2d\u5cf6\u6566\u306e\u6587\u7ae0\u306e\u95a2\u4fc2\u6027\u3002\u73fe\u5728\u30a6\u30a7\u30d6\u30ed\u30b0\u306b\u3001\u7e8f\u3081\u3066\u3044\u308b\u6700\u4e2d\u3002\u8fd1\u65e5\u516c\u958b\u4e88\u5b9a\u3002","id":41190190428979200,"from_user_id":200568705,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"164970427","profile_image_url":"http://a0.twimg.com/profile_images/1227176662/9192b021ef85ce9902c28955f86e604b_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:59 +0000","from_user":"syuigetsuIT","id_str":"41190184041197569","metadata":{"result_type":"recent"},"to_user_id":141926331,"text":"@iliad_tga \u30a4\u30ea\u30a2\u30b9\u3055\u3093\u304c\u305d\u306e\u8fba\u7406\u89e3\u306e\u3042\u308b\u3053\u3068\u306f\u5206\u304b\u3063\u3066\u307e\u3059\uff57\u3000\u30cd\u30bf\u30d0\u30ec\u4e91\u3005\u306ftwitter\u306e\u6c7a\u5b9a\u7684\u306a\u6b20\u70b9\u3060\u3068\u601d\u3044\u307e\u3059\u306d\u3047\u3002","id":41190184041197569,"from_user_id":164970427,"to_user":"iliad_tga","geo":null,"iso_language_code":"ja","to_user_id_str":"141926331","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"94526795","profile_image_url":"http://a0.twimg.com/profile_images/679411954/akb48_in_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:56 +0000","from_user":"akb48_in","id_str":"41190171248431104","metadata":{"result_type":"recent"},"to_user_id":null,"text":"AKB48\u67cf\u6728\u7531\u7d00 \u304a\u75b2\u308c\u69d8\u3002: \n\u3053\u3093\u3070\u3093\u306f(^O^)\uff0f\u266a\n\u3000\n\u3000\n\u3000\n\u4eca\u65e5\u306e\u516c\u6f14\u697d\u3057\u304b\u3063\u305f\u301c\n\u3000\n\u3000\n\u4e45\u3057\u3076\u308a\u3067\u7dca\u5f35\u3057\u305f\u3051\u3069\u3001\u306f\u3058\u3051\u307e\u304f\u3063\u305f\u305c\u3043\uff01\uff01\n\u3000\n\u3000\n\u3000\nMC\u306f\u565b\u307f\u307e\u304f\u308a\u306e\u30c6\u30f3\u30d1\u308a\u307e\u304f... http://bit.ly/ie8bEa akb48 twitter","id":41190171248431104,"from_user_id":94526795,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"222270374","profile_image_url":"http://a3.twimg.com/profile_images/1250946143/P1040062_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:53 +0000","from_user":"chrxpac","id_str":"41190158455943168","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u5b9a\u671f\u3011Twitter\u306f\uff8a\uff9f\uff7f\uff7a\uff9d\u304b\u3089\u3057\u304b\u3067\u304d\u306a\u3044\u306e\u3067\uff98\uff8c\uff9f\u8fd4\u3057\u304c\u9045\u304f\u306a\u308a\u307e\u3059(\u00b4\u30fb\u03c9\u30fb\uff40)\u3054\u4e86\u627f\u4e0b\u3055\u3044!!","id":41190158455943168,"from_user_id":222270374,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twittbot.net/&quot; rel=&quot;nofollow&quot;&gt;twittbot.net&lt;/a&gt;"},{"from_user_id_str":"64009258","profile_image_url":"http://a2.twimg.com/profile_images/1154025023/Mixi___normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:52 +0000","from_user":"Tatsuyuko","id_str":"41190153447944192","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4f01\u696d\u304c\u5c31\u6d3b\u751f\u306bFacebook\u3092\u4f7f\u3063\u3066\u7533\u8acb\u305b\u3088\u3068\u3044\u3044\u3001\u4f01\u696d\u304cFacebook\u3092\u4f7f\u3048\u3068\u4f01\u696d\u304c\u8a00\u3063\u3066\u304d\u305f\u308a\u3059\u308c\u3070\u305d\u308c\u3069\u3053\u308d\u3058\u3083\u306a\u3044\u304b\u3068\u3002\u5c11\u306a\u304f\u3068\u3082\u5c31\u6d3b\u3067Twitter\u306e\u8a00\u52d5\u3084\u30d5\u30a9\u30ed\u30ef\u30fc\u3092\u8abf\u67fb\u3059\u308b\u4f01\u696d\u306f\u304b\u306a\u308a\u591a\u3044\u3067\u3059 RT @Isshee: \u4f01\u696d\u3067\u3082\u540c\u3058\u3067\u3057\u3087 RT","id":41190153447944192,"from_user_id":64009258,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://sourceforge.jp/projects/tween/wiki/FrontPage&quot; rel=&quot;nofollow&quot;&gt;Tween&lt;/a&gt;"},{"from_user_id_str":"105145175","profile_image_url":"http://static.twitter.com/images/default_profile_normal.png","created_at":"Fri, 25 Feb 2011 17:37:49 +0000","from_user":"snao813","id_str":"41190141703753728","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @yumisaiki: \u795e\u69d8\u306f\u672c\u5f53\u306b\u4eba\u9593\u3092\u3059\u3070\u3089\u3057\u3044\u30d0\u30e9\u30f3\u30b9\u3067\u914d\u7f6e\u3057\u3066\u304a\u3089\u308c\u308b\u3002\u795d\u5cf6\u307f\u305f\u3044\u306a\u5c0f\u3055\u3044\u3068\u3053\u308d\u306b\u306a\u3093\u3067\u3053\u3093\u306a\u306b\u7acb\u6d3e\u306a\u4eba\u304c\u305f\u304f\u3055\u3093\u3044\u308b\u3093\u3060\u308d\u3046\u3002\u795e\u69d8\u3042\u308a\u304c\u3068\u3046\u3002\u672c\u5f53\u306b\u3042\u308a\u304c\u3068\u3046\u3002\u4eba\u9593\u3063\u3066\u3059\u3070\u3089\u3057\u3044\u3068\u601d\u3048\u305f\u3002twitter\u3082\u3042\u308a\u304c\u3068\u3046\u3002\u3000#kaminoseki","id":41190141703753728,"from_user_id":105145175,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://seesmic.com/seesmic_desktop/sd2&quot; rel=&quot;nofollow&quot;&gt;Seesmic Desktop&lt;/a&gt;"},{"from_user_id_str":"203667204","profile_image_url":"http://a2.twimg.com/profile_images/1254664000/eve_blackcat_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:46 +0000","from_user":"eve_blackcat","id_str":"41190129292943361","metadata":{"result_type":"recent"},"to_user_id":146894340,"text":"@kuroiso02 \u3057\u308a\u3068\u308a\u3068\u304b\uff1f\n\u2026\u3067\u3082Twitter\u3060\u3068\u7d42\u308f\u3089\u306a\u304f\u306a\u308b\u30b1\u30c9\u2026","id":41190129292943361,"from_user_id":203667204,"to_user":"kuroiso02","geo":null,"iso_language_code":"ja","to_user_id_str":"146894340","source":"&lt;a href=&quot;http://twipple.jp/&quot; rel=&quot;nofollow&quot;&gt;\u3064\u3044\u3063\u3077\u308b for iPhone&lt;/a&gt;"},{"from_user_id_str":"6528403","profile_image_url":"http://a0.twimg.com/profile_images/1240591244/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:45 +0000","from_user":"sortiee","id_str":"41190125924917248","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30a2\u30cb\u30e1\u5b9f\u6cc1\u306ftwitter\u306e\u764c","id":41190125924917248,"from_user_id":6528403,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://sites.google.com/site/peraperaprv/Home&quot; rel=&quot;nofollow&quot;&gt;P3:PeraPeraPrv&lt;/a&gt;"},{"from_user_id_str":"186058304","profile_image_url":"http://a0.twimg.com/profile_images/1250454564/IMG_0210_normal.JPG","created_at":"Fri, 25 Feb 2011 17:37:37 +0000","from_user":"00o8o00","id_str":"41190090386448384","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @fuefukioyasumi: \u3082\u3046\u3044\u3044\u3002\u300c\u671d\u751f\u300d\u306a\u3093\u304b\u3044\u3044\u3002BBC\u3082CNN\u3082\u82f1\u8a9e\u653e\u9001\u3060\u3002\u307f\u3093\u306a\u3001\u30c6\u30ec\u30d3\u3092\u3076\u3061\u3063\u3068\u5207\u3063\u3066Twitter\u3092\u898b\u3088\u3046\u3002\u3053\u3053\u306b\u300c\u751f\u304d\u305f\u60c5\u5831\u300d\u304c\u6d41\u308c\u3066\u3044\u308b\u3002\u300c\u751f\u304d\u305f\u53eb\u3073\u300d\u304c\u3042\u308b\u3002\u3053\u3053\u304b\u3089\u3067\u3082\u6b74\u53f2\u306e\u8ee2\u63db\u70b9\u3092\u611f\u3058\u308b\u4e8b\u304c\u3067\u304d\u308b\u306e\u3060\u3002 @gjmorley #libjp","id":41190090386448384,"from_user_id":186058304,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"49219631","profile_image_url":"http://a2.twimg.com/profile_images/1231873117/__2-colornow__2__normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:33 +0000","from_user":"irisgazer","id_str":"41190073227550720","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3067\u3059\u3088\u306d\u3047 RT @minamitaiheiyou: \u6545\u306b\u30cd\u30bf\u30d0\u30ec\u3092\u3059\u308b\u306e\u3082\u81ea\u7531\u3002\u30cd\u30bf\u3070\u308c\u3057\u305f\u4eba\u3092\u30c7\u30a3\u30b9\u308b\u306e\u3082\u81ea\u7531\u3002\u3042\u3068\u306f\u5404\u3005\u306e\u88c1\u91cf\u3067\u4e57\u308a\u5207\u3063\u3066\u304f\u3060\u3055\u3044\u3088\u3081\u3093\u3069\u304f\u3055\u3044\u306a RT @kihirokiro: Twitter\u3067\u30cd\u30bf\u30d0\u30ec\u4e91\u3005\u3044\u3063\u3066\u3082\u5143\u3005Twitter\u3063\u3066\u300c\u500b\u4eba\u306e\u72ec\u308a\u8a00\u300d\u3060\u308d","id":41190073227550720,"from_user_id":49219631,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://sourceforge.jp/projects/tween/wiki/FrontPage&quot; rel=&quot;nofollow&quot;&gt;Tween&lt;/a&gt;"},{"from_user_id_str":"98560114","profile_image_url":"http://a0.twimg.com/profile_images/1252332545/IMGP8170_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:32 +0000","from_user":"qess0093","id_str":"41190070706905088","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30b7\u30e5\u30fc\u30c6\u30a3\u304f\u305d\u3046\u305c\u3048\uff57 RT @syu_thi_bot: \u3044\u3064\u307e\u3067Twitter\u3084\u3063\u3066\u308b\u3093\u3060\u3044\uff1f\u3044\u3044\u52a0\u6e1b\u73fe\u5b9f\u306b\u623b\u308a\u306a\u3088\u3002\u3053\u3053\u306f\u30ad\u30df\u305f\u3061\u4e09\u6b21\u5143\u306e\u4eba\u9593\u304c\u3044\u308b\u3079\u304d\u5834\u6240\u3058\u3083\u306a\u3044\u3093\u3060\u3088\u3002\u305d\u3093\u306a\u306e\u57fa\u672c\u3060\u308d\uff01\uff01","id":41190070706905088,"from_user_id":98560114,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://sourceforge.jp/projects/tween/wiki/FrontPage&quot; rel=&quot;nofollow&quot;&gt;Tween&lt;/a&gt;"},{"from_user_id_str":"197459334","profile_image_url":"http://a3.twimg.com/profile_images/1210698414/shiratorishoko_normal.png","created_at":"Fri, 25 Feb 2011 17:37:31 +0000","from_user":"SyokoShiratori","id_str":"41190064243478528","metadata":{"result_type":"recent"},"to_user_id":null,"text":"+0.50kg \u540c\u3058\u304f\u30c0\u30a4\u30a8\u30c3\u30c8\u4e2d\u3067\u3059\u3002\u3088\u304f\u3053\u306e\u30b5\u30a4\u30c8\u3067\u4f53\u91cd\u5831\u544a\u3057\u3066\u307e\u3059\u266a http://bit.ly/fhN2fM RT @msophiah \u3046\u3046\u3046\u30fb\u30fb\u30fb\u304a\u8179\u3059\u3044\u305f\u301c\u30fb\u30fb\u30fb\u6211\u6162\u3001\u6211\u6162\u3001\u6211\u6162\u3002\u30c0\u30a4\u30a8\u30c3\u30c8\u3001\u30c0\u30a4\u30a8\u30c3\u30c8\u3001\u30c0\u30a4\u30a8\u30c3\u30c8\u3002","id":41190064243478528,"from_user_id":197459334,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://mob-mc.com&quot; rel=&quot;nofollow&quot;&gt;\uff08\u4eee\u79f0\uff09\u30c4\u30a4\u30af\u30ea\u30c3\u30af twiclick&lt;/a&gt;"},{"from_user_id_str":"180410237","profile_image_url":"http://a3.twimg.com/profile_images/1254473979/icon_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:30 +0000","from_user":"ka_ph","id_str":"41190062184079360","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u5b9a\u671fpost\u3011\u30d5\u30a7\u30eb\u30c7\u30a3\u30ca\u30f3\u30c8bot( http://twitter.com/ferdinand_bot )\u4f5c\u308a\u307e\u3057\u305f\u3002\u304a\u5b50\u69d8\u306e\u540d\u524d\u304a\u501f\u308a\u3055\u305b\u3066\u304f\u308c\u308b\u65b9\u3044\u307e\u3057\u305f\u3089@ka_ph\u307e\u3067\u304a\u9858\u3044\u3057\u307e\u3059\u3002","id":41190062184079360,"from_user_id":180410237,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twittbot.net/&quot; rel=&quot;nofollow&quot;&gt;twittbot.net&lt;/a&gt;"},{"from_user_id_str":"52283906","profile_image_url":"http://a3.twimg.com/profile_images/387644016/10100654519_s_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:26 +0000","from_user":"rolling_bean","id_str":"41190043313913856","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3081\u307e\u3044\u304c\u3057\u307e\u3059\u306d\u301cRT @yurikalin:\u30b3\u30a4\u30c4\u30e9\u5168\u54e1\u3044\u306a\u304f\u306a\u3063\u305f\u3089\u3001\u660e\u308b\u304f\u306a\u308b\u3060\u308d\u3046\u306a\u3041\uff5e\u266a\uff1e\u65e5\u672c\u306e\u30d3\u30b8\u30e7\u30f3 RT roll \u65e5\u7d4c\uff06CSIS\u30b7\u30f3\u30dd\u30b8\u30a6\u30e0\u300c\u5b89\u4fdd\u6539\u5b9a50\u5468\u5e74\u3001\u3069\u3046\u306a\u308b\u65e5\u7c73\u95a2\u4fc2\u300d http://bit.ly/dES8PY\u3000http://bit.ly/ihg0GT","id":41190043313913856,"from_user_id":52283906,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://tabtter.jp&quot; rel=&quot;nofollow&quot;&gt;\u30bf\u30d6\u30c3\u30bf\u30fc&lt;/a&gt;"},{"from_user_id_str":"351896","profile_image_url":"http://a3.twimg.com/profile_images/1179865336/icon12911887173020_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:26 +0000","from_user":"cicada","id_str":"41190043292925952","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4e2d\u5b66\u53d7\u9a13\u7a0b\u5ea6\u306e\u7b97\u6570\u306e\u554f\u984c\u3092\u51fa\u3059BOT http://twitter.com/arithmetic_bot \u6c17\u306b\u306f\u306a\u308b\u304c\u3001\u3061\u3083\u3093\u3068\u898b\u308b\u65e5\u304c\u6765\u308b\u3060\u308d\u3046\u304b\u30fb\u30fb\u3000#tearai\uff1a\u30ed\u30b3\u30e9\u30dc\u5bae\u5d0e\u770c http://locolabo.com/mz/ #mzlf","id":41190043292925952,"from_user_id":351896,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://locolabo.com/mz/&quot; rel=&quot;nofollow&quot;&gt;\u30ed\u30b3\u30e9\u30dc\u5bae\u5d0e\u770c&lt;/a&gt;"},{"from_user_id_str":"744554","profile_image_url":"http://a1.twimg.com/profile_images/1088753125/11868894_normal.gif","created_at":"Fri, 25 Feb 2011 17:37:20 +0000","from_user":"Febreze","id_str":"41190019020505088","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30cd\u30bf\u30d0\u30ec\u3042\u307e\u308a\u6c17\u306b\u3057\u306a\u3044\u30bf\u30a4\u30d7\u3060\u3051\u3069\u306a\u3093\u304b\u3053\u3046Twitter\u958b\u304f\u3060\u3051\u3067\u30ac\u30f3\u30ac\u30f3\u30cd\u30bf\u30d0\u30ec\u5165\u3063\u3066\u304f\u308b\u306e\u306f\u306a\u3093\u3068\u3082\u8a00\u3048\u306a\u3044\u306a\u3002","id":41190019020505088,"from_user_id":744554,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"203371794","profile_image_url":"http://a1.twimg.com/profile_images/1226537594/___normal.png","created_at":"Fri, 25 Feb 2011 17:37:16 +0000","from_user":"himeko24","id_str":"41190004139114496","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6b21\u3044\u3063\u3066\u307f\u3088\u30fc\u3000\u306f\u3044\u3053\u308c\u3000 \u6fc0\u5b89\u26052010\u5e74\u590f\u65b0\u30c7\u30b6\u30a4\u30f3\u2605\u30bb\u30af\u30b7\u30fc\u306a\u9023\u4f53\u5f0f\u7121\u5730\u6c34\u7740 \u80f8\u30d1\u30c3\u30c9\u4ed8\u304dQ122 http://bit.ly/h72C4i","id":41190004139114496,"from_user_id":203371794,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.google.co.jp&quot; rel=&quot;nofollow&quot;&gt;himeko24&lt;/a&gt;"},{"from_user_id_str":"119988932","profile_image_url":"http://a3.twimg.com/profile_images/1214344633/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:16 +0000","from_user":"7na_love_6sa","id_str":"41190002000007169","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30d6\u30ed\u30b0\u66f4\u65b0\u3057\u307e\u3057\u305f\uff01Twitter\uff06mixi\u304b\u3089\u3082\u30b3\u30e1\u30f3\u30c8\u5b9c\u3057\u304f\u306d\u266a\n\u300c\u30cd\u30a4\u30eb\u30c1\u30a7\u30f3\u30b8\u266a\u300d http://amba.to/hy0Do2","id":41190002000007169,"from_user_id":119988932,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"217408835","profile_image_url":"http://a1.twimg.com/profile_images/1215428655/____4.0157_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:12 +0000","from_user":"nikubenki1123","id_str":"41189985424125952","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @x68k: \u57fa\u672c\u7684\u306bTwitter\u4e0a\u3067\u306f&quot;\u597d\u304d\u306b\u3084\u308c\u3070\u3044\u3044&quot;\u3060\u3051\u3069\u3001\u540d\u524d\u3082\u30a2\u30a4\u30b3\u30f3\u3082\u30a2\u30f3\u30bf\u3058\u3083\u306a\u3044\u305f\u304f\u3055\u3093\u306e\u4eba\u305f\u3061\u306e\u9b42\u304c\u3053\u3082\u3063\u305f\u3082\u306e\u306a\u306e\u3060\u304b\u3089\u3001\u305d\u308c\u3060\u3051\u306f&quot;\u80cc\u8ca0\u3048&quot;\u3068\u601d\u3046\uff1e\u30ad\u30e3\u30e9\u30af\u30bf\u30fc\u30a2\u30ab\u30a6\u30f3\u30c8","id":41189985424125952,"from_user_id":217408835,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://tweetlogix.com&quot; rel=&quot;nofollow&quot;&gt;Tweetlogix&lt;/a&gt;"},{"from_user_id_str":"139137996","profile_image_url":"http://a0.twimg.com/profile_images/1087408006/cut_work_18_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:12 +0000","from_user":"fujiokayouko","id_str":"41189984354566144","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u591c\u4e2d\u306bTwitter\u3092\u306a\u3093\u3068\u306a\u304f\u8997\u3044\u305f\u3089\u3082\u306e\u3059\u3054\u3044\u307e\u3069\u30de\u30aeTL\u3067","id":41189984354566144,"from_user_id":139137996,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://mobile.twitter.com&quot; rel=&quot;nofollow&quot;&gt;Mobile Web&lt;/a&gt;"},{"from_user_id_str":"61221002","profile_image_url":"http://a3.twimg.com/profile_images/554916301/_1259757374_61_normal.png","created_at":"Fri, 25 Feb 2011 17:37:08 +0000","from_user":"hiromk63","id_str":"41189970613903360","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @kenji_kohashi \u7121\u4e8b\u6620\u753b\u88fd\u4f5c\u306e\u5831\u544a\u306f\u3067\u304d\u305f\u3051\u3069\u4eca\u3060\u7de8\u96c6\u306f\u7d9a\u3044\u3066\u307e\u3059w \u305d\u3093\u306a\u3068\u3053\u3067 \u6620\u753b\u300cDON'T STOP!\u300d\u306eTwitter \u30a2\u30ab\u30a6\u30f3\u30c8 @DONTSTOPMOVIE \u3082\u958b\u59cb\u3001\u3082\u3057\u826f\u304b\u3063\u305f\u3089\u30d5\u30a9\u30ed\u30fc\u3057\u3066\u304f\u3060\u3055\u3044\uff01\u50d5\u3082\u542b\u3081\u6620\u753b\u88fd\u4f5c\u95a2\u4fc2\u8005\u304c\u6c17\u9577\u306b\u3064\u3076\u3084\u304d\u307e\u3059","id":41189970613903360,"from_user_id":61221002,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.hootsuite.com&quot; rel=&quot;nofollow&quot;&gt;HootSuite&lt;/a&gt;"},{"from_user_id_str":"147393812","profile_image_url":"http://a1.twimg.com/profile_images/1114001122/hana_10_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:07 +0000","from_user":"tubasa_uki","id_str":"41189965924667392","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\uff10\uff10\uff17\u3082\u3073\u3063\u304f\u308a\u3000\u5927\u56fd\u306e\u5927\u7d71\u9818\u9078\u304b\u3089\u3000\u5cf6\u56fd\u306e\u5730\u65b9\u9078\u306e\u9078\u6319\u307e\u3067\u306b\u3082\u3000\u6697\u8e8d\u3057\u3066\u3044\u308b\uff3e\uff3e\u3000\u3053\u306eTwitter \u30b9\u30ad\u30e3\u30f3\u30c0\u30eb\u3084\u60aa\u8cea\u306a\u4e8b\u4ef6\u306b\u3082\u7d61\u3080\u304c\u3000Twitter\u304b\u3089\u767a\u4fe1\u3055\u308c\u305f\u3000\u5e73\u548c\u3078\u306e\u8ca2\u732e\u306f\u3000\u307e\u3055\u306b\u30ce\u30fc\u3079\u30eb\u5e73\u548c\u8cde\u3082\u306e http://bit.ly/esjWDG #dotubo_ss","id":41189965924667392,"from_user_id":147393812,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twittbot.net/&quot; rel=&quot;nofollow&quot;&gt;twittbot.net&lt;/a&gt;"},{"from_user_id_str":"96081746","profile_image_url":"http://a0.twimg.com/profile_images/1244505419/illust832_normal.png","created_at":"Fri, 25 Feb 2011 17:37:07 +0000","from_user":"kazukt","id_str":"41189963131387904","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3046\u308b\u304a\u307c\u7d75\u3001\u4ed6\u306e\u4eba\u306e\u3082\u898b\u3066\u3044\u305f\u3089\u3084\u305f\u3089\u30de\u30f3\u30ac\u306e\u30ad\u30e3\u30e9\u30af\u30bf\u30fc\u3067\u3080\u3061\u3083\u304f\u3061\u3083\u4e0a\u624b\u3044\u4eba\u304c\uff01\u2026\u3068\u3001\u30d7\u30ed\u30d5\u30a3\u30fc\u30eb\u898b\u305f\u3089\u3001\u306a\u3093\u3068\u3054\u672c\u4eba\u304c\u66f8\u3044\u3066\u3044\u3089\u3063\u3057\u3083\u3063\u305f\u3002Twitter\u3063\u3066\u30b9\u30b4\u30a4\u308f\u3002","id":41189963131387904,"from_user_id":96081746,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://janetter.net/&quot; rel=&quot;nofollow&quot;&gt;Janetter&lt;/a&gt;"},{"from_user_id_str":"86306230","profile_image_url":"http://a1.twimg.com/profile_images/593004766/j2j_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:03 +0000","from_user":"excite_j2j","id_str":"41189949927596032","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u79c1\u306f\u3001\u65e9\u7a32\u7530\u5927\u5b66\u30aa\u30fc\u30d7\u30f3\u30ab\u30ec\u30c3\u30b8\u306e\u5b66\u751f\u306e\u8003\u3048\u3066\u3044\u308b\u3001\u5352\u696d\u751fSoudai /\u65e9\u7a32\u7530\u30ab\u30fc\u30c9\u4f1a\u54e1/ Soudai\u5b66\u751f\u89aa/\u3001\u8ab0\u304b\u304c\u30aa\u30fc\u30d7\u30f3\u30ab\u30ec\u30c3\u30b8\u65e9\u7a32\u7530\u5927\u5b662000\u5186\u306e\u5165\u5834\u6599\u306e\u30e1\u30f3\u30d0\u30fc\u3092\u7d39\u4ecb\u3057\u3066\u304f\u308c\u305f\u65b9\u304c\u305a\u3063\u3068\u5b89\u4e0a\u304c\u308a\u3060\u3002 (\u5143\u767a\u8a00 http://bit.ly/esxiwT )","id":41189949927596032,"from_user_id":86306230,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://d.hatena.ne.jp/fn7&quot; rel=&quot;nofollow&quot;&gt;\u65e5\u672c\u8a9e\u65e5\u672c\u8a9e\u7ffb\u8a33\u30b8\u30a7\u30cd\u30ec\u30fc\u30bf&lt;/a&gt;"},{"from_user_id_str":"120927161","profile_image_url":"http://a0.twimg.com/profile_images/1230006483/20110131_13022_26776_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:00 +0000","from_user":"FRISKFOSSILFANG","id_str":"41189933855158272","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @syu_thi_bot: \u3044\u3064\u307e\u3067Twitter\u3084\u3063\u3066\u308b\u3093\u3060\u3044\uff1f\u3044\u3044\u52a0\u6e1b\u73fe\u5b9f\u306b\u623b\u308a\u306a\u3088\u3002\u3053\u3053\u306f\u30ad\u30df\u305f\u3061\u4e09\u6b21\u5143\u306e\u4eba\u9593\u304c\u3044\u308b\u3079\u304d\u5834\u6240\u3058\u3083\u306a\u3044\u3093\u3060\u3088\u3002\u305d\u3093\u306a\u306e\u57fa\u672c\u3060\u308d\uff01\uff01","id":41189933855158272,"from_user_id":120927161,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twittbot.net/&quot; rel=&quot;nofollow&quot;&gt;twittbot.net&lt;/a&gt;"},{"from_user_id_str":"228973151","profile_image_url":"http://a1.twimg.com/sticky/default_profile_images/default_profile_0_normal.png","created_at":"Fri, 25 Feb 2011 17:36:59 +0000","from_user":"daisuke1589","id_str":"41189931887890432","metadata":{"result_type":"recent"},"to_user_id":null,"text":"twitter\u3063\u3066\u52dd\u624b\u306b\u30d5\u30a9\u30ed\u30fc\u3057\u3066\u3082\u3044\u3044\u3093\u3060\u3063\u3051\uff1f","id":41189931887890432,"from_user_id":228973151,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"54314110","profile_image_url":"http://a2.twimg.com/profile_images/1193541240/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:57 +0000","from_user":"Alohazuki","id_str":"41189922668953600","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Twitter\u306e\u5e83\u5cf6\u5f01\u3082\u3042\u3063\u305f\u3093\u3060\u306d\u3002","id":41189922668953600,"from_user_id":54314110,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.flight.co.jp/iPhone/TweetMe/&quot; rel=&quot;nofollow&quot;&gt;TweetMe for iPhone&lt;/a&gt;"},{"from_user_id_str":"72594681","profile_image_url":"http://a3.twimg.com/profile_images/1227240916/____normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:56 +0000","from_user":"uri4ichi","id_str":"41189916922744832","metadata":{"result_type":"recent"},"to_user_id":226852303,"text":"@7_fuka Twitter\u304b\u3076\u308c\u306f\u3001\u3059\u3050\u306bD\u306b\u8d70\u308b\u306e\u3067\u3002\u306a\u3093\u3060\u304b\u5fae\u7b11\u307e\u3057\u3044\u306e\u3067\u3059( \u2579\u25e1\u2579)","id":41189916922744832,"from_user_id":72594681,"to_user":"7_fuka","geo":null,"iso_language_code":"ja","to_user_id_str":"226852303","source":"&lt;a href=&quot;http://sites.google.com/site/yorufukurou/&quot; rel=&quot;nofollow&quot;&gt;YoruFukurou&lt;/a&gt;"},{"from_user_id_str":"168393854","profile_image_url":"http://a3.twimg.com/profile_images/1253554518/GuNp3xVS_normal","created_at":"Fri, 25 Feb 2011 17:36:55 +0000","from_user":"makonyanhime","id_str":"41189913701515264","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6589\u85e4\u3055\u3093\u3082\u30c0\u30e1\u3060...\u4eca\u591c\u306fTwitter\u5909\u3060\u306a\u3041(;_;)","id":41189913701515264,"from_user_id":168393854,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://mobile.twitter.com&quot; rel=&quot;nofollow&quot;&gt;Twitter for Android&lt;/a&gt;"},{"from_user_id_str":"122636787","profile_image_url":"http://a2.twimg.com/profile_images/1189607563/DSC01987_normal.JPG","created_at":"Fri, 25 Feb 2011 17:36:54 +0000","from_user":"enpy1217","id_str":"41189908500594688","metadata":{"result_type":"recent"},"to_user_id":null,"text":"twitter\u4e45\u3057\u3076\u308a\u306b\u958b\u3044\u305f\u3002\u3068\u3066\u3082\u591a\u5fd9\u3060\u3063\u305f\u3002\u75b2\u308c\u305f\u3002\u304a\u98a8\u5442\u306b\u3082\u5165\u308c\u306a\u304b\u3063\u305f\u3002\u30ad\u30bf\u30cd\u2026","id":41189908500594688,"from_user_id":122636787,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.flight.co.jp/iPhone/TweetMe/&quot; rel=&quot;nofollow&quot;&gt;TweetMe for iPhone&lt;/a&gt;"},{"from_user_id_str":"81663694","profile_image_url":"http://a3.twimg.com/profile_images/1177576126/__normal.png","created_at":"Fri, 25 Feb 2011 17:36:51 +0000","from_user":"progmiya","id_str":"41189895494049792","metadata":{"result_type":"recent"},"to_user_id":94050844,"text":"@hirasai_skyhigh \u6674\u308c\u541b\u3002\u30cd\u30bf\u30d0\u30ec\u306f\u898b\u305f\u304f\u306a\u3044\u3051\u3069\u30012ch\u3082twitter\u3082\u3084\u308a\u305f\u3044\u306e\u304c\u4eba\u3068\u8a00\u3046\u3082\u306e\u3088","id":41189895494049792,"from_user_id":81663694,"to_user":"hirasai_skyhigh","geo":null,"iso_language_code":"ja","to_user_id_str":"94050844","source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"159237469","profile_image_url":"http://a3.twimg.com/profile_images/1140433484/______2_normal.png","created_at":"Fri, 25 Feb 2011 17:36:50 +0000","from_user":"hikari_juku","id_str":"41189892096532480","metadata":{"result_type":"recent"},"to_user_id":135634241,"text":"@sssukimasuky \n\u4f55\u304b\u3042\u3063\u305f\u98a8\u3067\u3059\u306d\uff08\u7b11\uff09\u3000\u78ba\u304b\u306bTwitter\u306f\u6c17\u8efd\u3067\u3059\u3057\u306d\u3002\u30e1\u30fc\u30eb\u306b\u306a\u308b\u3068\u30d5\u30c3\u30c8\u30ef\u30fc\u30af\u304c\u91cd\u304f\u306a\u308b\u5834\u5408\u3082\u3042\u308b\u304b\u3082\u3057\u308c\u307e\u305b\u3093\u306d\u3002\u305d\u3046\u8003\u3048\u308b\u3068\u3059\u3054\u3044\u6642\u4ee3\u3060\u3002","id":41189892096532480,"from_user_id":159237469,"to_user":"sssukimasuky","geo":null,"iso_language_code":"ja","to_user_id_str":"135634241","source":"&lt;a href=&quot;http://www.hootsuite.com&quot; rel=&quot;nofollow&quot;&gt;HootSuite&lt;/a&gt;"},{"from_user_id_str":"141915990","profile_image_url":"http://a0.twimg.com/profile_images/1248969898/icon679566266564378764images_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:48 +0000","from_user":"adashino_","id_str":"41189886878949376","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @fuefukioyasumi: \u3082\u3046\u3044\u3044\u3002\u300c\u671d\u751f\u300d\u306a\u3093\u304b\u3044\u3044\u3002BBC\u3082CNN\u3082\u82f1\u8a9e\u653e\u9001\u3060\u3002\u307f\u3093\u306a\u3001\u30c6\u30ec\u30d3\u3092\u3076\u3061\u3063\u3068\u5207\u3063\u3066Twitter\u3092\u898b\u3088\u3046\u3002\u3053\u3053\u306b\u300c\u751f\u304d\u305f\u60c5\u5831\u300d\u304c\u6d41\u308c\u3066\u3044\u308b\u3002\u300c\u751f\u304d\u305f\u53eb\u3073\u300d\u304c\u3042\u308b\u3002\u3053\u3053\u304b\u3089\u3067\u3082\u6b74\u53f2\u306e\u8ee2\u63db\u70b9\u3092\u611f\u3058\u308b\u4e8b\u304c\u3067\u304d\u308b\u306e\u3060\u3002 @gjmorley #libjp","id":41189886878949376,"from_user_id":141915990,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"111308629","profile_image_url":"http://a1.twimg.com/profile_images/1137421845/mmooton_normal.png","created_at":"Fri, 25 Feb 2011 17:36:46 +0000","from_user":"mmooton","id_str":"41189877940748288","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @minponjp: \u3010\u3064\u3076\u3084\u304f\u3060\u3051\u306710000\u5186\u5546\u54c1\u5238GET\u3011&lt;&lt;visa\u30ae\u30d5\u30c8\u30ab\u30fc\u30c910000\u5186\u5206\u3092\u6bce\u6708\u62bd\u9078\u3067\u30d7\u30ec\u30bc\u30f3\u30c8&gt;&gt; \u21d2\u8a73\u3057\u304f\u306f\u4e0b\u306e\uff35\uff32\uff2c\u3088\u308a\u2193\u2193\u2193\u2193\u2193 http://minpon.jp/user_data/twitter_campaign.php","id":41189877940748288,"from_user_id":111308629,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twittbot.net/&quot; rel=&quot;nofollow&quot;&gt;twittbot.net&lt;/a&gt;"},{"from_user_id_str":"140945098","profile_image_url":"http://a0.twimg.com/profile_images/1198948281/b7664c71-87bc-4187-9d46-a61ab8d41b96_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:46 +0000","from_user":"waruimayuko","id_str":"41189877122867200","metadata":{"result_type":"recent"},"to_user_id":113371008,"text":"@toumeisyoujyo \u3042\u3053\u3061\u3083\u3093Twitter\u3084\u3063\u3066\u305f\u306e\u306d\u3002\u307e\u3060\u304a\u5e2d\u3042\u308b\u305d\u3046\u306a\u306e\u3067\u662f\u975e\uff01","id":41189877122867200,"from_user_id":140945098,"to_user":"toumeisyoujyo","geo":null,"iso_language_code":"ja","to_user_id_str":"113371008","source":"&lt;a href=&quot;http://twimi.jp/?r=via&quot; rel=&quot;nofollow&quot;&gt;twimi\u2606new&lt;/a&gt;"},{"from_user_id_str":"167512527","profile_image_url":"http://a1.twimg.com/profile_images/1172286365/newspaper_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:45 +0000","from_user":"KoranKaget","id_str":"41189871775252480","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://bit.ly/93Eeud RT @motocentrism \u30d6\u30ed\u30b0\u8a18\u4e8b\u66f8\u304d\u307e\u3057\u305f\u30fc\uff1a MotoGP\u3000\u30d6\u30c3\u30af\u30e1\u30fc\u30ab\u30fc\u306b\u898b\u308b\u5404\u30e9\u30a4\u30c0\u30fc\u306e\u4e0b\u99ac\u8a55 - http://goo.gl/xVe6... http://bit.ly/hDYxyx @motogpudpate","id":41189871775252480,"from_user_id":167512527,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"160251772","profile_image_url":"http://a3.twimg.com/profile_images/1150692471/_____normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:45 +0000","from_user":"keikochaki","id_str":"41189870781075456","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u300c\u305a\u3063\u3068twitter\u3084\u3063\u3066\u308b\u3088\u306d\u300d\u3068\u6012\u3089\u308c\u3066\u3057\u307e\u3063\u305f(\u82e6\u7b11)","id":41189870781075456,"from_user_id":160251772,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twtr.jp&quot; rel=&quot;nofollow&quot;&gt;Keitai Web&lt;/a&gt;"},{"from_user_id_str":"211565766","profile_image_url":"http://a2.twimg.com/sticky/default_profile_images/default_profile_5_normal.png","created_at":"Fri, 25 Feb 2011 17:36:42 +0000","from_user":"sayap1yo","id_str":"41189858236043264","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u304a\u98df\u4e8b\u4f1a\u884c\u304d\u305f\u304b\u3063\u305f\u3051\u3069\n\u53cb\u9054\u3068\u904a\u3093\u3067\u307e\u3093\u305f\ue056\ue326\n\nTwitter\u898b\u3066\u307e\u3057\u305f\u3051\u3069\n\u3064\u3076\u3084\u304f\u30bf\u30a4\u30df\u30f3\u30b0\n\u5931\u3063\u3066\u305f\u3060\u3051\u3067\u3059( \u00b4 \u25bd ` )\uff89\u7b11","id":41189858236043264,"from_user_id":211565766,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.nibirutech.com&quot; rel=&quot;nofollow&quot;&gt;TwitBird&lt;/a&gt;"},{"from_user_id_str":"19603191","profile_image_url":"http://a1.twimg.com/profile_images/1254077264/116_normal.gif","created_at":"Fri, 25 Feb 2011 17:36:40 +0000","from_user":"Purple_Flash","id_str":"41189851873157120","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @syu_thi_bot: \u3044\u3064\u307e\u3067Twitter\u3084\u3063\u3066\u308b\u3093\u3060\u3044\uff1f\u3044\u3044\u52a0\u6e1b\u73fe\u5b9f\u306b\u623b\u308a\u306a\u3088\u3002\u3053\u3053\u306f\u30ad\u30df\u305f\u3061\u4e09\u6b21\u5143\u306e\u4eba\u9593\u304c\u3044\u308b\u3079\u304d\u5834\u6240\u3058\u3083\u306a\u3044\u3093\u3060\u3088\u3002\u305d\u3093\u306a\u306e\u57fa\u672c\u3060\u308d\uff01\uff01","id":41189851873157120,"from_user_id":19603191,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twittbot.net/&quot; rel=&quot;nofollow&quot;&gt;twittbot.net&lt;/a&gt;"},{"from_user_id_str":"215930291","profile_image_url":"http://a0.twimg.com/profile_images/1247906106/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:30 +0000","from_user":"minori_millie","id_str":"41189810055938048","metadata":{"result_type":"recent"},"to_user_id":212972774,"text":"@c_c_chika \u7b11\u3063\u3066\u305d\u3046\u3060\u306a\u3063\u3066\u601d\u3063\u3066\u305f(o^^o)\u30c1\u30ab\u306e\u7b11\u3044\u58f0\u304c\u805e\u3053\u3048\u3066\u304d\u305f\u3082\u3093\u3002mail\u306bTwitter\u3067\u5927\u5fd9\u3057\u3084\u3002","id":41189810055938048,"from_user_id":215930291,"to_user":"c_c_chika","geo":null,"iso_language_code":"ja","to_user_id_str":"212972774","source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"197459334","profile_image_url":"http://a3.twimg.com/profile_images/1210698414/shiratorishoko_normal.png","created_at":"Fri, 25 Feb 2011 17:36:30 +0000","from_user":"SyokoShiratori","id_str":"41189809586311168","metadata":{"result_type":"recent"},"to_user_id":null,"text":"+0.90kg \u30c0\u30a4\u30a8\u30c3\u30c8\u5fdc\u63f4\u3057\u3066\u307e\u3059\u3002(*^^*)\u30c0\u30a4\u30a8\u30c3\u30c8\u4f53\u91cd\u5831\u544a\u306e\u3064\u3076\u3084\u304d\u3067\u3059\u3002 http://bit.ly/fhN2fM RT @hayayumi \u3053\u3093\u306a\u6642\u9593\u306b\u3084\u304d\u306b\u304f\u30fc\u266b\u30c0\u30a4\u30a8\u30c3\u30c8\u671f\u9593\u306a\u306e\u306b\u306d....","id":41189809586311168,"from_user_id":197459334,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://mob-mc.com&quot; rel=&quot;nofollow&quot;&gt;\uff08\u4eee\u79f0\uff09\u30c4\u30a4\u30af\u30ea\u30c3\u30af twiclick&lt;/a&gt;"},{"from_user_id_str":"12337665","profile_image_url":"http://a0.twimg.com/profile_images/1146194926/pixiv-icon_normal.png","created_at":"Fri, 25 Feb 2011 17:36:27 +0000","from_user":"t_a_k_i","id_str":"41189797364121600","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Google\u30ea\u30fc\u30c0\u30fc\u3067\u30b5\u30a4\u30c8\u306e\u66f4\u65b0\u30c1\u30a7\u30c3\u30af\u3059\u308b\u3088\u308a\u3001Twitter\u30a2\u30ab\u30a6\u30f3\u30c8\u3092\u30d5\u30a9\u30ed\u30fc\u3057\u3066\u66f4\u65b0\u3092\u77e5\u308b\u307b\u3046\u304c\u4fbf\u5229\u3060\u306a\u3053\u308c","id":41189797364121600,"from_user_id":12337665,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://sites.google.com/site/yorufukurou/&quot; rel=&quot;nofollow&quot;&gt;YoruFukurou&lt;/a&gt;"},{"from_user_id_str":"104862453","profile_image_url":"http://a3.twimg.com/profile_images/1248609864/Image014_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:25 +0000","from_user":"yuz_ume","id_str":"41189787943714816","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @fuefukioyasumi: \u3082\u3046\u3044\u3044\u3002\u300c\u671d\u751f\u300d\u306a\u3093\u304b\u3044\u3044\u3002BBC\u3082CNN\u3082\u82f1\u8a9e\u653e\u9001\u3060\u3002\u307f\u3093\u306a\u3001\u30c6\u30ec\u30d3\u3092\u3076\u3061\u3063\u3068\u5207\u3063\u3066Twitter\u3092\u898b\u3088\u3046\u3002\u3053\u3053\u306b\u300c\u751f\u304d\u305f\u60c5\u5831\u300d\u304c\u6d41\u308c\u3066\u3044\u308b\u3002\u300c\u751f\u304d\u305f\u53eb\u3073\u300d\u304c\u3042\u308b\u3002\u3053\u3053\u304b\u3089\u3067\u3082\u6b74\u53f2\u306e\u8ee2\u63db\u70b9\u3092\u611f\u3058\u308b\u4e8b\u304c\u3067\u304d\u308b\u306e\u3060\u3002 @gjmorley #libjp","id":41189787943714816,"from_user_id":104862453,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"213846746","profile_image_url":"http://a1.twimg.com/profile_images/1242263342/haruhi1_normal.png","created_at":"Fri, 25 Feb 2011 17:36:23 +0000","from_user":"sloth888jpgame","id_str":"41189778409922560","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u643a\u5e2f\u96fb\u8a71\u7528\u306eTwitter\u3092\u5229\u7528\u3057\u305f\u30b2\u30fc\u30e0\u3092\u77e5\u3063\u3066\u3044\u308b\u4eba\u306f\u3001\u7d39\u4ecb\u3057\u3066\u304f\u3060\u3055\u3044\u3002 #TwitterGame","id":41189778409922560,"from_user_id":213846746,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twittbot.net/&quot; rel=&quot;nofollow&quot;&gt;twittbot.net&lt;/a&gt;"},{"from_user_id_str":"17484724","profile_image_url":"http://a2.twimg.com/profile_images/1138677235/iconue_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:22 +0000","from_user":"tsutcho","id_str":"41189777831231490","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30a2\u30aa\u30b7\u30de\u3055\u3093twitter\u306b\u7acb\u3064\u30fb\u30fb\u30fb\u3060\u3068\u30fb\u30fb\u30fb\uff1f\uff12\u756a\u76ee\u306e\u30d5\u30a9\u30ed\u30ef\u30fc\u306e\u5ea7\u3092\u3044\u305f\u3060\u3044\u3066\u304a\u3053\u3046","id":41189777831231490,"from_user_id":17484724,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"220041064","profile_image_url":"http://a1.twimg.com/sticky/default_profile_images/default_profile_0_normal.png","created_at":"Fri, 25 Feb 2011 17:36:21 +0000","from_user":"sloth888jp_bot5","id_str":"41189772521254914","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6642\u3005\u3001TwiAll\uff08\u30c4\u30a4\u30aa\u30fc\u30eb\uff09\u3067Twitter\u306e\u81ea\u52d5\u30d5\u30a9\u30ed\u30fc\u30fb\u30d5\u30a9\u30ed\u30fc\u8fd4\u3057\u3092\u3057\u3066\u3044\u307e\u3059\u3002","id":41189772521254914,"from_user_id":220041064,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twittbot.net/&quot; rel=&quot;nofollow&quot;&gt;twittbot.net&lt;/a&gt;"},{"from_user_id_str":"177693537","profile_image_url":"http://a0.twimg.com/profile_images/1240130924/20110207213206_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:21 +0000","from_user":"Na_Okinawa","id_str":"41189769912397824","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @ebizo66: \u30ea\u30d3\u30a2\u30fb\u30c8\u30ea\u30dd\u30ea\u306eTw\uff1a\u6551\u6025\u8eca\u304c\u6765\u305f\u304c\u3001\u8ca0\u50b7\u8005\u3092\u8eca\u5185\u3067\u6bba\u5bb3\u3057\u3066\u3044\u305f\u3001\u3068\u3002\uff08\u6ec5\u8336\u82e6\u8336\u3060\uff01\uff09http://ow.ly/43pQ2 #libjp","id":41189769912397824,"from_user_id":177693537,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.hootsuite.com&quot; rel=&quot;nofollow&quot;&gt;HootSuite&lt;/a&gt;"},{"from_user_id_str":"147006592","profile_image_url":"http://a2.twimg.com/profile_images/1251306448/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:19 +0000","from_user":"takasu_rika","id_str":"41189763532865536","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @kihirokiro: Twitter\u3067\u30cd\u30bf\u30d0\u30ec\u4e91\u3005\u3044\u3063\u3066\u3082\u5143\u3005Twitter\u3063\u3066\u300c\u500b\u4eba\u306e\u72ec\u308a\u8a00\u300d\u3060\u308d","id":41189763532865536,"from_user_id":147006592,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"100239985","profile_image_url":"http://a1.twimg.com/profile_images/733461294/CIMG0207_normal.JPG","created_at":"Fri, 25 Feb 2011 17:36:19 +0000","from_user":"strangebarjun","id_str":"41189762182152192","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Twitter\u3092\u59cb\u3081\u3066\u3001\u305d\u308d\u305d\u308d\u4e00\u5e74\u306b\u306a\u308a\u307e\u3059\u3002\u632f\u308a\u8fd4\u308b\u3068\u3001\u307c\u304f\u306e\u4eba\u9593\u6027\u3092\u305d\u3063\u304f\u308a\u53cd\u6620\u3059\u308b\u304c\u5982\u304f\u3001\u534a\u7aef\u3067\u3059\u306d\u3002\u60c5\u5831\u53ce\u96c6\u30c4\u30fc\u30eb\u3001\u60c5\u5831\u767a\u4fe1\u30c4\u30fc\u30eb\u3001\u30b3\u30df\u30e5\u30cb\u30b1\u30fc\u30b7\u30e7\u30f3\u30c4\u30fc\u30eb\u3001\u3069\u308c\u3082\u6a5f\u80fd\u3057\u5207\u308c\u3066\u3044\u306a\u3044\u306a\u3042\u3001\u3068\u3002\u305d\u3057\u3066\u3042\u308b\u306e\u306f\u300c\u3069\u3053\u304b\u3089\u3082\u76f8\u624b\u306b\u3055\u308c\u3066\u3044\u306a\u3044\u300d\u3068\u3044\u3046\u3001\u65e2\u77e5\u306e\u73fe\u5b9f\u3067\u3059\u3002","id":41189762182152192,"from_user_id":100239985,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.echofon.com/&quot; rel=&quot;nofollow&quot;&gt;Echofon&lt;/a&gt;"},{"from_user_id_str":"126390384","profile_image_url":"http://a2.twimg.com/profile_images/1176065038/nemunemu_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:18 +0000","from_user":"gesukapper","id_str":"41189757476286464","metadata":{"result_type":"recent"},"to_user_id":80935865,"text":"@tatsugorou \u306a\u3093\u304b\u4e16\u306e\u4e2d\u306b\u306f\u611a\u75f4\u3082\u4e0b\u30cd\u30bf\u3082\u8a00\u3044\u653e\u984c\u306etwitter\u3068\u3044\u3046\u3082\u306e\u304c\u3042\u308b\u305d\u3046\u3067\u3059\u3002","id":41189757476286464,"from_user_id":126390384,"to_user":"tatsugorou","geo":null,"iso_language_code":"ja","to_user_id_str":"80935865","source":"&lt;a href=&quot;http://janetter.net/&quot; rel=&quot;nofollow&quot;&gt;Janetter&lt;/a&gt;"},{"from_user_id_str":"196059029","profile_image_url":"http://a1.twimg.com/profile_images/1208831726/ruka2_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:17 +0000","from_user":"luka_m_bot","id_str":"41189756666777600","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u308f\u305f\u3057\u3082twitter\u306f\u3058\u3081\u307e\u3057\u305f","id":41189756666777600,"from_user_id":196059029,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www24.atpages.jp/aoi2/bot.php&quot; rel=&quot;nofollow&quot;&gt;\u5de1\u308b\u97f3&lt;/a&gt;"},{"from_user_id_str":"88135613","profile_image_url":"http://a3.twimg.com/profile_images/1088552877/P9280150_normal.JPG","created_at":"Fri, 25 Feb 2011 17:36:14 +0000","from_user":"Roko38","id_str":"41189740321587200","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\uff46\uff42\u306b\u30ed\u30b0\u30a4\u30f3\u3059\u308b\u6a5f\u4f1a\u304c\u65e5\u306b\u65e5\u306b\u5897\u3048\u3066\u304d\u305f\uff3e\uff3e \u6163\u308c\u3066\u304f\u308b\u3068\u3042\u3063\u3061\u306e\u304c\u9762\u767d\u3044\uff06\u4f7f\u3044\u52dd\u624b\u304c\u3044\u3044\u3088\u3046\u306a\u6c17\u304c\u3059\u308b\u3002\u8907\u5408\u7684\u306b\u8272\u3005\u51fa\u6765\u307e\u3059\u3088\u306d\u2026\u3063\u3066\u3001\u601d\u3063\u305f\u3053\u3068\u3092\u545f\u304f\u306e\u306fTwitter\u3060\u3063\u305f\u308a\u3067\u3059\u304c\u2026(^_^; \u305d\u3057\u3066\u81ea\u5206\u306e\u5834\u5408\u306f\u30c4\u30a4\u3068\u9023\u52d5\u3057\u3065\u3089\u3044\u72b6\u6cc1\u3060\u3063\u305f\u308a\u3067\u2026\u3002","id":41189740321587200,"from_user_id":88135613,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"110825211","profile_image_url":"http://a2.twimg.com/profile_images/1108977866/o_t_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:12 +0000","from_user":"kou_nanjyo","id_str":"41189731941363712","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @x68k: \u57fa\u672c\u7684\u306bTwitter\u4e0a\u3067\u306f&quot;\u597d\u304d\u306b\u3084\u308c\u3070\u3044\u3044&quot;\u3060\u3051\u3069\u3001\u540d\u524d\u3082\u30a2\u30a4\u30b3\u30f3\u3082\u30a2\u30f3\u30bf\u3058\u3083\u306a\u3044\u305f\u304f\u3055\u3093\u306e\u4eba\u305f\u3061\u306e\u9b42\u304c\u3053\u3082\u3063\u305f\u3082\u306e\u306a\u306e\u3060\u304b\u3089\u3001\u305d\u308c\u3060\u3051\u306f&quot;\u80cc\u8ca0\u3048&quot;\u3068\u601d\u3046\uff1e\u30ad\u30e3\u30e9\u30af\u30bf\u30fc\u30a2\u30ab\u30a6\u30f3\u30c8","id":41189731941363712,"from_user_id":110825211,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://tweetlogix.com&quot; rel=&quot;nofollow&quot;&gt;Tweetlogix&lt;/a&gt;"},{"from_user_id_str":"2095960","profile_image_url":"http://a2.twimg.com/profile_images/1248999075/majiresu2_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:10 +0000","from_user":"guldeen","id_str":"41189726945947648","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3042\u308a\u3083\u307e\u3041\u3002\u25bchttp://bit.ly/et4vVa \uff3b\u89d2\u5ddd\u66f8\u5e97\uff3d\u300c\u30b6\u30fb\u30b9\u30cb\u30fc\u30ab\u30fc\u300d\u4f11\u520a\u3078\u3000\u300c\u6dbc\u5bae\u30cf\u30eb\u30d2\u300d\u751f\u3093\u3060\u30e9\u30ce\u30d9\u96d1\u8a8c18\u5e74\u3067\u5e55 via http://twitter.com/lkj777","id":41189726945947648,"from_user_id":2095960,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"164121549","profile_image_url":"http://a1.twimg.com/profile_images/1251758789/m_108-07ae3_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:09 +0000","from_user":"hachi_touhi","id_str":"41189719299727360","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30cd\u30bf\u30d0\u30ec\u6c17\u306b\u3057\u3066\u305f\u3089Twitter\u3084\u3063\u3066\u3089\u308c\u306a\u3044ww","id":41189719299727360,"from_user_id":164121549,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twicca.r246.jp/&quot; rel=&quot;nofollow&quot;&gt;twicca&lt;/a&gt;"},{"from_user_id_str":"194494659","profile_image_url":"http://a3.twimg.com/profile_images/1249717822/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:08 +0000","from_user":"tomonattomo","id_str":"41189715415801856","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3046\u308f\u3001\u660e\u65e5\u671d\u304b\u3089\u30d0\u30a4\u30c8\u3084\u306e\u306b\u306a\u3093\u3060\u3053\u306e\u306d\u3075\u304b\u3057\u3002\u3042\u3001\u591c\u66f4\u304b\u3057\u3002\u30d1\u30d4\u30eb\u30b9\u3068BUMP\u3001\u3048\u307f\u3068Twitter\u306eDM\u3057\u3059\u304e\u305f\u306a\u2026","id":41189715415801856,"from_user_id":194494659,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://mixi.jp/promotion.pl?id=voice_twitter&quot; rel=&quot;nofollow&quot;&gt; mixi \u30dc\u30a4\u30b9 &lt;/a&gt;"},{"from_user_id_str":"97224364","profile_image_url":"http://a3.twimg.com/profile_images/1150074355/fb8bcca60d340862c053a756377bfae8_normal.jpeg","created_at":"Fri, 25 Feb 2011 17:36:06 +0000","from_user":"xxxheat","id_str":"41189709174677504","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Twitter\u5b8c\u5168\u306b\u30d0\u30b0\u3063\u3066\u308borz","id":41189709174677504,"from_user_id":97224364,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"}],"max_id":41190705623732224,"since_id":38643906774044672,"refresh_url":"?since_id=41190705623732224&q=twitter","next_page":"?page=2&max_id=41190705623732224&rpp=100&lang=ja&q=twitter","results_per_page":100,"page":1,"completed_in":0.093336,"warning":"adjusted since_id to 38643906774044672 (), requested since_id was older than allowed -- since_id removed for pagination.","since_id_str":"38643906774044672","max_id_str":"41190705623732224","query":"twitter"}
benchmarks/json-data/jp50.jsonnew file+1
@@ -0,0 +1 @@
1+{"results":[{"from_user_id_str":"2458313","profile_image_url":"http://a2.twimg.com/profile_images/1203653060/fure091226_normal.png","created_at":"Thu, 27 Jan 2011 20:30:04 +0000","from_user":"19princess","id_str":"30724239224995840","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6d77\u6674\u300c\u672c\u65e5\u306e\u6771\u4eac\u306e\u304a\u5929\u6c17\u306f\u6674\u6642\u3005\u66c7\u3067\u3057\u3087\u3046\u3002\u6700\u9ad8\u6c17\u6e29\u306f8\u5ea6\u3001\u6700\u4f4e\u6c17\u6e29\u306f1\u5ea6\u3067\u3059\u3002\u3042\u306a\u305f\u306e\u4eca\u65e5\u306e\u4eba\u751f\u306b\u3068\u3073\u3063\u304d\u308a\u306e\u304a\u5929\u6c17\u3092\u2665\u300d","id":30724239224995840,"from_user_id":2458313,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://babyprincess.sakura.ne.jp/about/&quot; rel=&quot;nofollow&quot;&gt;\u5929\u4f7f\u5bb6\u306e\u88cf\u5c71&lt;/a&gt;"},{"from_user_id_str":"66578965","profile_image_url":"http://a0.twimg.com/profile_images/1183763267/fossetta_normal.png","created_at":"Thu, 27 Jan 2011 20:00:04 +0000","from_user":"Fossetta_Tokyo","id_str":"30716689779785729","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u304a\u306f\u3088\u3046\u3054\u3056\u3044\u307e\u3059!!\u6771\u4eac\u90fd\u3001\u672c\u65e5\u306e\u304a\u5929\u6c17\u306f\u6674\u6642\u3005\u66c7\u3002\u6700\u9ad8\u6c17\u6e298\u5ea6\u3001\u6700\u4f4e\u6c17\u6e291\u5ea6\u3002\u6771\u4eac\u5730\u65b9\u3067\u306f\u3001\u7a7a\u6c17\u306e\u4e7e\u71e5\u3057\u305f\u72b6\u614b\u304c\u7d9a\u3044\u3066\u3044\u307e\u3059\u3002\u706b\u306e\u53d6\u308a\u6271\u3044\u306b\u6ce8\u610f\u3057\u3066\u4e0b\u3055\u3044\u3002\u4f0a\u8c46\u8af8\u5cf6\u3068\u5c0f\u7b20\u539f\u8af8\u5cf6\u306b\u306f\u3001\u5f37\u98a8\u3001\u6ce2\u6d6a\u3001\u4e7e\u71e5\u3001\u971c\u306e\u6ce8\u610f\u5831\u3092\u767a\u8868\u4e2d\u3067\u3059\u3002","id":30716689779785729,"from_user_id":66578965,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://bit.ly/Fossetta&quot; rel=&quot;nofollow&quot;&gt;\u30d5\u30a9\u30bb\u30c3\u30bf ver.3.1.1&lt;/a&gt;"},{"from_user_id_str":"104041146","profile_image_url":"http://a2.twimg.com/profile_images/863965118/001jwatokyo_normal.jpg","created_at":"Thu, 27 Jan 2011 19:44:33 +0000","from_user":"jwa_tokyo","id_str":"30712787537756160","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6c17\u8c61\u5e81\u304b\u3089\u6771\u4eac\u306e\u5929\u6c17\u4e88\u5831\u304c\u767a\u8868\u3055\u308c\u307e\u3057\u305f\u3000\u305d\u306e\u5929\u6c17\u4e88\u5831\u3092\u3053\u3053\u3067\u3064\u3076\u3084\u3053\u3046\u304b\u306a\u3041\uff5e\uff1f\u3000\u8003\u3048\u4e2d\u3000\u307e\u3066\u6b21\u53f7\uff08\u7b11","id":30712787537756160,"from_user_id":104041146,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.docodemo.jp/twil/&quot; rel=&quot;nofollow&quot;&gt;Twil2 (Tweet Anytime, Anywhere by Mail)&lt;/a&gt;"},{"from_user_id_str":"144500192","profile_image_url":"http://a3.twimg.com/a/1294874399/images/default_profile_3_normal.png","created_at":"Thu, 27 Jan 2011 18:59:33 +0000","from_user":"kyo4to4","id_str":"30701462774358016","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u90fd \u516b\u4e08\u5cf6 - \u4eca\u65e5\u306e\u5929\u6c17\u306f\u30fb\u30fb\u30fb\u66c7\u306e\u3061\u6674\u3067\u3059\u306e\uff01","id":30701462774358016,"from_user_id":144500192,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/kyo4to4&quot; rel=&quot;nofollow&quot;&gt;lost-sheep-bot&lt;/a&gt;"},{"from_user_id_str":"165724582","profile_image_url":"http://a0.twimg.com/profile_images/1222842347/163087_1256281064506_1753997852_484926_2761052_n_normal.jpg","created_at":"Thu, 27 Jan 2011 17:39:06 +0000","from_user":"Rifqi_19931020","id_str":"30681213748387840","metadata":{"result_type":"recent"},"to_user_id":113796067,"text":"@CHLionRagbaby \u30b1\u30f3\u3061\u3083\u3093\u3001\u671d\u4eca\u307e\u3067\u306e\u81ea\u5206\u306e\u30db\u30fc\u30e0\u30a8\u30ea\u30a2\u304b\u3089\u307e\u3060\u975e\u5e38\u306b\u5bd2\u3044\u3068\u96e8\u304c\u964d\u3063\u3066\u3044\u305f..\u3069\u306e\u3088\u3046\u306b\u73fe\u5728\u306e\u6771\u4eac\u306e\u5929\u6c17\uff1f","id":30681213748387840,"from_user_id":165724582,"to_user":"CHLionRagbaby","geo":null,"iso_language_code":"ja","to_user_id_str":"113796067","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"120911929","profile_image_url":"http://a0.twimg.com/profile_images/772435076/20100312___capture2_normal.png","created_at":"Thu, 27 Jan 2011 17:28:30 +0000","from_user":"Cirno_fan","id_str":"30678546020040705","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u65e5\u306e\u6771\u4eac\u306e\u5929\u6c17\u306f\u3001\u66c7\u6642\u3005\u6674\u3067\u6700\u9ad8\u6c17\u6e29\u306f8\u2103\uff01 \u6700\u4f4e\u6c17\u6e29\u306f2\u2103\u3060\u3063\u305f\u3088\uff01 RT @mimi22999 \uff08\uff65\u2200\uff65\uff09\uff4c\u3001\u865a\u5f31\u306a\u8005\u306b\u3068\u3063\u3066\u3001\u6717\u3089\u304b\u306a\u9854\u306f\u4e0a\u5929\u6c17\u3068\u540c\u3058\u304f\u3089\u3044\u3046\u308c\u3057\u3044\u3082\u306e\u3060\u3002\u30d5\u30e9\u30f3\u30af\u30ea\u30f3 #tenki #bot","id":30678546020040705,"from_user_id":120911929,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://blog.livedoor.jp/fairycirno/archives/34686.html&quot; rel=&quot;nofollow&quot;&gt;\u5e7b\u60f3\u90f7 \u9727\u306e\u6e56&lt;/a&gt;"},{"from_user_id_str":"65976527","profile_image_url":"http://a0.twimg.com/profile_images/452810990/little_italies_____normal.jpg","created_at":"Thu, 27 Jan 2011 17:00:03 +0000","from_user":"heta_weather01","id_str":"30671388754845696","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u30d8\u30bf\u5929\u3011Tere hommikust.\u30a8\u30b9\u30c8\u30cb\u30a2\u3067\u3059\u3002\u4eca\u65e5\u306e\u6771\u4eac\u306e\u5929\u6c17\u306f\u6674\u6642\u3005\u66c7\u3067\u660e\u65e5\u306f\u66c7\u308a\u3067\u3059\u3002\u3061\u306a\u307f\u306b\u50d5\u306e\u3068\u3053\u308d\u3067\u306f\u66c7\u308a\u3067\u6c17\u6e29-7\u2103\u3067\u3059\u3002\u3061\u306a\u307f\u306b\u30b9\u30ab\u30a4\u30d7\u306e\u958b\u767a\u672c\u90e8\u306f\u50d5\u306e\u5bb6\u306b\u3042\u308b\u3093\u3067\u3059\u3002","id":30671388754845696,"from_user_id":65976527,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www15.atpages.jp/~kageyanma/&quot; rel=&quot;nofollow&quot;&gt;\u5730\u7403\u306e\u4e2d&lt;/a&gt;"},{"from_user_id_str":"7278433","profile_image_url":"http://a3.twimg.com/profile_images/1218965303/michael-1_normal.png","created_at":"Thu, 27 Jan 2011 16:50:16 +0000","from_user":"shimohiko","id_str":"30668926035689472","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3042\u308a\u3002\n\u3010\u7f8e\u4eba\u5929\u6c17/\u6771\u4eac\u3011\u7f8e\u4eba\u5929\u6c17\u30ad\u30e3\u30b9\u30bf\u30fc\u306e&quot;\u3055\u3042\u3084\u3093\u3055\u3093&quot;\u306b\u3088\u308b\u3068\u300c1/29(\u571f)\u306f\u304f\u3082\u308a\u3067\u3001\u964d\u6c34\u78ba\u738740%\u3001\u6700\u9ad8\u6c17\u6e29\u306f6\u2103\u3067\u6700\u4f4e\u6c17\u6e29\u306f1\u2103\u3067\u3059\u300d\u7f8e\u4eba\u5929\u6c17\u21d2http://bit.ly/djB8th http://twitpic.com/3twnl0 #bt_tenki","id":30668926035689472,"from_user_id":7278433,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://bijintenki.jp&quot; rel=&quot;nofollow&quot;&gt;bijintenki.jp&lt;/a&gt;"},{"from_user_id_str":"61770","profile_image_url":"http://a3.twimg.com/profile_images/1206955079/tw172a_normal.png","created_at":"Thu, 27 Jan 2011 16:40:52 +0000","from_user":"rsky","id_str":"30666561853333504","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3075\u3068\u591c\u7a7a\u3092\u898b\u4e0a\u3052\u3066\u30aa\u30ea\u30aa\u30f3\u304c\u898b\u3048\u306a\u304f\u3066\u300c\u6771\u4eac\u306b\u306f\u7a7a\u304c\u306a\u3044\u300d\u3068\u667a\u6075\u5b50\u306e\u3088\u3046\u306a\u3053\u3068\u3092\u601d\u3063\u305f\u308f\u3051\u3060\u304c\u3001\u305f\u3076\u3093\u534a\u5206\u3050\u3089\u3044\u306f\u5929\u6c17\u306e\u305b\u3044\u3067\u3059","id":30666561853333504,"from_user_id":61770,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.hootsuite.com&quot; rel=&quot;nofollow&quot;&gt;HootSuite&lt;/a&gt;"},{"from_user_id_str":"103259265","profile_image_url":"http://a0.twimg.com/profile_images/767857973/anime_icon_normal.gif","created_at":"Thu, 27 Jan 2011 16:37:42 +0000","from_user":"liveshowonly","id_str":"30665765698928640","metadata":{"result_type":"recent"},"to_user_id":null,"text":"iPhone\u5929\u6c17\u3002\u6771\u4eac4\u2103\u3063\u3066\u7d50\u69cb\u5bd2\u304f\u306a\u3044\u3058\u3083\u3093\u3002\uff08\u78ba\u304b\u306b\u3082\u306e\u51c4\u304f\u5bd2\u3044\u8a33\u3067\u306f\u7121\u3044\uff09\u3002\u798f\u5ca1\u5e02\u306f1\u2103\u3060\u3002\u52dd\u3061\u3060\u305c\u3002Rock'n'roll","id":30665765698928640,"from_user_id":103259265,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"165242761","profile_image_url":"http://a1.twimg.com/profile_images/1147334744/SN3E00600001_normal.jpg","created_at":"Thu, 27 Jan 2011 16:37:35 +0000","from_user":"deuxavril0502","id_str":"30665736556912640","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6b8b\u5ff5\u3001\u79c1\u306f\u6c96\u7e04\u3067\u3059(&gt;_&lt;)\u3067\u3082\u304a\u5929\u6c17\u826f\u3055\u305d\u3046\u3067\u826f\u304b\u3063\u305f\u306d\u3002\u3053\u3061\u3089\u306f\u96e8\u3088\uff5eRT @rinandy2010: \u305d\u3046\u3067\u3059\u3063\u266a\u51fa\u5f35\u3067(^^)\u304a\u306d\u3048\u3055\u307e\u306f\u6771\u4eac\u3067\u3059\u304b\uff1f\u3081\u3063\u3061\u3083\u5929\u6c17\u826f\u304f\u3066\u3073\u3063\u304f\u308a\u3067\u3059\u3002\u624b\u888b\u3068\u304b\u5168\u7136\u3044\u3089\u306a\u3044\u3067\u3059\u306d\u30fc RT @deuxavril0502 \u6771\u4eac\u306a\u306e\u30fc\uff1f","id":30665736556912640,"from_user_id":165242761,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.echofon.com/&quot; rel=&quot;nofollow&quot;&gt;Echofon&lt;/a&gt;"},{"from_user_id_str":"163900288","profile_image_url":"http://a1.twimg.com/profile_images/1210224823/icon12945064955238_normal.jpg","created_at":"Thu, 27 Jan 2011 16:24:37 +0000","from_user":"nyao_yurichan","id_str":"30662472734089216","metadata":{"result_type":"recent"},"to_user_id":100985873,"text":"@ray_ko302 \u767a\u898b\u3042\u308a\u304c\u3068\u3067\u3059\u3045\u3002\u3053\u3061\u3089\u3067\u3082\u3088\u308d\u3057\u304f\u306d\u3002\u6771\u4eac\u306f\u4eca\u65e5\u3082\u4e7e\u71e5\u3067\u5927\u5909\u3088\u3002\u305d\u3063\u3061\u3068\u771f\u9006\u306e\u5929\u6c17\u3060\u306d\u3002\u30a2\u30a4\u30b9\u30d0\u30fc\u30f3\u304d\u3092\u3064\u3051\u3066\u3088\u306d\u3002","id":30662472734089216,"from_user_id":163900288,"to_user":"ray_ko302","geo":null,"iso_language_code":"ja","to_user_id_str":"100985873","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"49227098","profile_image_url":"http://a3.twimg.com/profile_images/965007882/____normal.jpg","created_at":"Thu, 27 Jan 2011 15:52:26 +0000","from_user":"dosannko6","id_str":"30654371016478720","metadata":{"result_type":"recent"},"to_user_id":108570870,"text":"@peke_hajiP \u4ffa\u304c\u6771\u4eac \u6765\u3066\u6700\u521d\u306b\u9a5a\u3044\u305f\u306e\u304c\u3001\u5929\u6c17\u4e88\u5831\u3067\u82b1\u7c89\u60c5\u5831\u304c\u6d41\u308c\u308b\u3053\u3068\u3067\u3001\u6700\u521d\u306b\u8a66\u3057\u305f\u306e\u304c \u30b4\u30ad\u69d8 \u53ec\u559a\u306e\u5100\u5f0f\u3067\u3059\u304a\uff1f","id":30654371016478720,"from_user_id":49227098,"to_user":"peke_hajip","geo":null,"iso_language_code":"ja","to_user_id_str":"108570870","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"71148934","profile_image_url":"http://a0.twimg.com/profile_images/1209223630/image_normal.jpg","created_at":"Thu, 27 Jan 2011 15:46:49 +0000","from_user":"123keiko","id_str":"30652958311981058","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u9727\u5cf6\u306e\u964d\u7070\u306e\u30cb\u30e5\u30fc\u30b9\u3092\u898b\u3066\u601d\u3044\u51fa\u3057\u307e\u3057\u305f\u3002\u4e0a\u4eac\u3057\u305f\u59cb\u3081\u306e\u9803\u3001\u6771\u4eac\u306f1\u5e74\u4e2d\u3001\u7070\u304c\u964d\u3089\u306a\u3044\u304b\u3089\u7a7a\u6c17\u304c\u6f84\u3093\u3067\u3066\u904e\u3054\u3057\u3084\u3059\u3044\u306a\u3041\u3001\u3068\u601d\u3063\u305f\u306a\u3041\u3001\u3063\u3066\u3002\n\u5b9f\u5bb6\u306f\u51ac\u306e\u5b63\u7bc0\u98a8\u3067\u685c\u5cf6\u306e\u7070\u304c\u964d\u308b\u5730\u533a\u3067\u3057\u305f\u3002\u9e7f\u5150\u5cf6\u306e\u5929\u6c17\u4e88\u5831\u3067\u306f\u3001\u6bce\u65e5\u3001\u685c\u5cf6\u4e0a\u7a7a\u306e\u98a8\u5411\u304d\u4e88\u5831\u304c\u3067\u307e\u3059\u3002\u3053\u308c\u304b\u3089\u306f\u9727\u5cf6\u3082\u304b\u306a\uff1f","id":30652958311981058,"from_user_id":71148934,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"91124773","profile_image_url":"http://a3.twimg.com/profile_images/1139308356/prof101007_3-1_normal.jpg","created_at":"Thu, 27 Jan 2011 15:43:35 +0000","from_user":"sanposuruhito","id_str":"30652146277945345","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u5bb5\u306e\u90fd\u5fc3\u306f\u3001\u8eab\u3082\u5f15\u304d\u7de0\u307e\u308b\u3068\u3044\u3046\u3088\u308a\u306f\u51cd\u3048\u308b\u7a0b\u306e\u51b7\u6c17\u3092\u611f\u3058\u308b\u5bd2\u3044\u591c\u3067\u3059\u3002\u660e\u65e5\u65e5\u4e2d\u306e\u6771\u4eac\u306e\u5929\u6c17\u306f\u3001\u5915\u65b9\u306b\u591a\u5c11\u96f2\u304c\u51fa\u308b\u5834\u6240\u304c\u3042\u308a\u305d\u3046\u306a\u3082\u306e\u306e\u6982\u306d\u6674\u308c\u7a7a\u304c\u5e83\u304c\u308a\u7d9a\u3051\u305d\u3046\u3067\u3059\u3002\u6700\u9ad8\u6c17\u6e29\u306f\u30015-6\u5ea6\u4f4d\u3068\u306a\u308a\u305d\u3046\u3067\u3059\u3002#weather_tokyo","id":30652146277945345,"from_user_id":91124773,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://projects.playwell.jp/go/Saezuri&quot; rel=&quot;nofollow&quot;&gt;Saezuri&lt;/a&gt;"},{"from_user_id_str":"104712480","profile_image_url":"http://a3.twimg.com/profile_images/1204016928/icon5087697006727791368kuro2_normal.jpg","created_at":"Thu, 27 Jan 2011 15:31:51 +0000","from_user":"asongfor_xx","id_str":"30649192296751104","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u7f8e\u4eba\u5929\u6c17\u304b\u3089tweet\u3059\u308b\u3068\u3053\u3093\u306a\u611f\u3058\u306a\u3093\u3060\u306a\u3002 RT asongfor_xx: \u3010\u7f8e\u4eba\u5929\u6c17/\u6771\u4eac\u3011\u7f8e\u4eba\u5929\u6c17\u30ad\u30e3\u30b9\u30bf\u30fc\u306e&quot;\u304b\u306a\u3053\u3055\u3093&quot;\u306b\u3088\u308b\u3068\u300c1/28(\u91d1)\u306f\u6674\u6642\u3005\u304f\u3082\u308a\u3067\u3001\u964d\u6c34\u78ba\u73870%\u3001\u6700\u9ad8\u6c17\u6e29\u306f8\u2103\u3067\u6700\u4f4e\u6c17\u6e29\u306f1\u2103\u3067\u3059\u300d\u7f8e\u4eba\u5929\u6c17\u21d2http://bit.ly/djB8th","id":30649192296751104,"from_user_id":104712480,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twipple.jp/&quot; rel=&quot;nofollow&quot;&gt;\u3064\u3044\u3063\u3077\u308b for iPhone&lt;/a&gt;"},{"from_user_id_str":"165965113","profile_image_url":"http://a0.twimg.com/profile_images/1200885316/shogomeguro_normal.jpg","created_at":"Thu, 27 Jan 2011 15:24:35 +0000","from_user":"shogomeguro","id_str":"30647362477105152","metadata":{"result_type":"recent"},"to_user_id":null,"text":"2011.1.26 \u793e\u7a93\u304b\u3089\u3002\u4e0d\u601d\u8b70\u306a\u5929\u6c17\u3067\u3053\u306e\u5f8c\u96ea\u304c\u3061\u3089\u3064\u3044\u305f\u3093\u3060\u3088\u306d\u3002\u6771\u4eac\u306e\u521d\u96ea\u3067\u3057\u305f\u3002 http://instagr.am/p/BO_xn/","id":30647362477105152,"from_user_id":165965113,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://instagr.am&quot; rel=&quot;nofollow&quot;&gt;instagram&lt;/a&gt;"},{"from_user_id_str":"166018520","profile_image_url":"http://a0.twimg.com/profile_images/1207460953/100-40030_normal.jpg","created_at":"Thu, 27 Jan 2011 15:18:17 +0000","from_user":"115nayume","id_str":"30645776254238722","metadata":{"result_type":"recent"},"to_user_id":118384679,"text":"@dancinpea09 \u6771\u4eac\u3001\u660e\u65e5\u3082\u5929\u6c17\u826f\u3044\u307f\u305f\u3044\u3067\u3001\u3088\u304b\u3063\u305f\u3067\u3059\u306d\u30fc\u266a \u30ca\u30a4\u30b9\u30c8\u30ea\u30c3\u30d7\uff01\u304a\u3084\u3059\u307f\u306a\u3055\u3044\u3002 http://twitpic.com/3tvun3","id":30645776254238722,"from_user_id":166018520,"to_user":"dancinpea09","geo":null,"iso_language_code":"ja","to_user_id_str":"118384679","source":"&lt;a href=&quot;http://tweetli.st/&quot; rel=&quot;nofollow&quot;&gt;TweetList!&lt;/a&gt;"},{"from_user_id_str":"202937674","profile_image_url":"http://a1.twimg.com/profile_images/1218797578/______2_normal.jpg","created_at":"Thu, 27 Jan 2011 15:11:48 +0000","from_user":"ryuusisan","id_str":"30644146498699264","metadata":{"result_type":"recent"},"to_user_id":203058384,"text":"@manaasutakshi \u6771\u4eac\u306f\u964d\u3063\u3066\u306a\u3044\u3093\u3067\u3059\u304b\u30fb\u30fb\u30fb\u5929\u6c17\u4e88\u5831\u306b\u3088\u308b\u3068\u660e\u65e5\u3082\u6771\u4eac\u306f\u964d\u3089\u306a\u3044\u305d\u3046\u3067\u3059\u306d\uff01\uff01\u79c1\u306e\u4f4f\u3093\u3067\u3044\u308b\u3068\u3053\u308d\u306f\u5fae\u5999\u306b\u964d\u308a\u305d\u3046\u3067\u51fa\u52e4\u6642\u306b\u964d\u3063\u3066\u305f\u3089\u3061\u3087\u3063\u3068\u5acc\u3060\u306a\u3041\u3000\u306a\u3093\u3066\u601d\u3044\u307e\u3059","id":30644146498699264,"from_user_id":202937674,"to_user":"manaasutakshi","geo":null,"iso_language_code":"ja","to_user_id_str":"203058384","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"3222182","profile_image_url":"http://a0.twimg.com/profile_images/1199090957/ProfilePhoto_normal.png","created_at":"Thu, 27 Jan 2011 15:09:35 +0000","from_user":"44mune","id_str":"30643589545459713","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u7f8e\u4eba\u5929\u6c17/\u6771\u4eac\u3011\u7f8e\u4eba\u5929\u6c17\u30ad\u30e3\u30b9\u30bf\u30fc\u306e&quot;\u306e\u308a\u3055\u3093&quot;\u306b\u3088\u308b\u3068\u300c1/28(\u91d1)\u306f\u304f\u3082\u308a\u306e\u3061\u6674\u3067\u3001\u964d\u6c34\u78ba\u738710%\u3001\u6700\u9ad8\u6c17\u6e29\u306f9\u2103\u3067\u6700\u4f4e\u6c17\u6e29\u306f2\u2103\u3067\u3059\u300d http://twitpic.com/3tvruh","id":30643589545459713,"from_user_id":3222182,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://bijintenki.jp&quot; rel=&quot;nofollow&quot;&gt;bijintenki.jp&lt;/a&gt;"},{"from_user_id_str":"154341982","profile_image_url":"http://a0.twimg.com/profile_images/1155496864/_____normal.jpg","created_at":"Thu, 27 Jan 2011 15:02:39 +0000","from_user":"slave_420_bot","id_str":"30641845490946049","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u30f3\u3068\u3053\u899a\u3048\u3066\u308b\u306e\u306f\u300c\u672d\u5e4c\u300d\u300c\u4ed9\u53f0\u300d\u300c\u6771\u4eac\u300d\u300c\u5927\u962a\u300d\u300c\u540d\u53e4\u5c4b\u300d\u300c\u798f\u5ca1\u300d\u306e\u4eca\u65e5\u3068\u660e\u65e5\u306e\u5929\u6c17\u3060\u306a\u3002\u5929\u6c17\u304c\u77e5\u308a\u305f\u3044\u6642\u306f\u300c\u5834\u6240\u300d\u3068\u300c\u4eca\u65e5\u306e\u5929\u6c17\u300d\u304b\u300c\u660e\u65e5\u306e\u5929\u6c17\u300d\u3092\u304a\u7533\u3057\u4ed8\u3051\u304f\u3060\u3055\u3044\u3001\u304a\u5b22\u69d8\uff1f","id":30641845490946049,"from_user_id":154341982,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://bot.syoyu.net/&quot; rel=&quot;nofollow&quot;&gt;\u7adc\u30f6\u5cf0\u90b8\u306e\u3069\u3053\u304b&lt;/a&gt;"},{"from_user_id_str":"72042678","profile_image_url":"http://a3.twimg.com/profile_images/1198771027/larxene_normal.jpg","created_at":"Thu, 27 Jan 2011 15:01:57 +0000","from_user":"larxene_bot","id_str":"30641668772339712","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u65e5\u306e\u5929\u6c17\u306f \u672d\u5e4c\u304c\u6674\u308c \u4ed9\u53f0\u304c\u66c7\u6642\u3005\u96ea \u6771\u4eac\u304c\u6674\u306e\u3061\u66c7 \u540d\u53e4\u5c4b\u304c\u6674\u6642\u3005\u66c7 \u5927\u962a\u304c\u6674\u6642\u3005\u66c7 \u798f\u5ca1\u304c\u6674\u308c \u3089\u3057\u3044\u308f\u3088 \u6ce8\u610f\u3057\u306a\u3055\u3044","id":30641668772339712,"from_user_id":72042678,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www4.kiwi-us.com/~yuuna/larxene_bot_manual/index.html&quot; rel=&quot;nofollow&quot;&gt;\u5fd8\u5374\u306e\u57ce \u5730\u4e0a\u306e12\u968e&lt;/a&gt;"},{"from_user_id_str":"101331893","profile_image_url":"http://a1.twimg.com/sticky/default_profile_images/default_profile_0_normal.png","created_at":"Thu, 27 Jan 2011 15:01:34 +0000","from_user":"yoshiftan","id_str":"30641572240424961","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306e\u5929\u6c17\u4e88\u5831\u3092\u898b\u3066\u3073\u3063\u304f\u308a\uff01\u6691\u305d\u3046\u3060\u306a\u3053\u308a\u3083\u3002","id":30641572240424961,"from_user_id":101331893,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"Keitai Mail"},{"from_user_id_str":"65207550","profile_image_url":"http://a3.twimg.com/profile_images/448731969/_________R_normal.jpg","created_at":"Thu, 27 Jan 2011 15:01:33 +0000","from_user":"kabuyo","id_str":"30641566469066752","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u5929\u6c17\u4e88\u5831\u3067\u306f\u6771\u4eac\u3067\u306f\u4e7e\u71e5\u6ce8\u610f\u5831\u304c\u7d9a\u3044\u3066\u3044\u308b\u3089\u3057\u3044\u306e\u306b\u3001\u306a\u305c\u79c1\u304c\u5e72\u3057\u305f\u6d17\u6fef\u7269\u306f\u96e8\u306b\u6fe1\u308c\u3066\u3057\u307e\u3063\u305f\u306e\u3060\u308d\u3046\u304b\u2025\u3000\u3088\u3063\u307d\u3069\u904b\u304c\u60aa\u3044\u3089\u3057\u3044\u2025","id":30641566469066752,"from_user_id":65207550,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"80309352","profile_image_url":"http://a1.twimg.com/profile_images/1223620418/image_normal.jpg","created_at":"Thu, 27 Jan 2011 14:54:30 +0000","from_user":"mikutyan","id_str":"30639792026812416","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306e\u660e\u65e5\u306e\u5929\u6c17\u6559\u3048\u3066","id":30639792026812416,"from_user_id":80309352,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"80309352","profile_image_url":"http://a1.twimg.com/profile_images/1223620418/image_normal.jpg","created_at":"Thu, 27 Jan 2011 14:53:06 +0000","from_user":"mikutyan","id_str":"30639439847890944","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u660e\u65e5\u306e\u6771\u4eac\u306e\u5929\u6c17\u306a\u3093\u3060\u308d\u3046 \u96e8\u964d\u3063\u305f\u3089\u56f0\u308b\u3002","id":30639439847890944,"from_user_id":80309352,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"120911929","profile_image_url":"http://a0.twimg.com/profile_images/772435076/20100312___capture2_normal.png","created_at":"Thu, 27 Jan 2011 14:47:19 +0000","from_user":"Cirno_fan","id_str":"30637984684449792","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3042\u305f\u3044\u30c1\u30eb\u30ce\uff01\u30dc\u30c3\u30c8\u3060\u3051\u3069\u5929\u6c17\u4e88\u5831\u3082\u3067\u304d\u308b\u3088\uff01\u300c\u6771\u4eac\u306e\u4eca\u65e5\u306e\u5929\u6c17\u6559\u3048\u3066\u300d\u307f\u305f\u3044\u306bTL\u767a\u8a00\u3057\u3066\u304f\u308c\u308c\u3070\u8abf\u3079\u3066\u3042\u3052\u308b\uff01 #followme #followmejp #followmevip #tenki","id":30637984684449792,"from_user_id":120911929,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://blog.livedoor.jp/fairycirno/archives/34686.html&quot; rel=&quot;nofollow&quot;&gt;\u5e7b\u60f3\u90f7 \u9727\u306e\u6e56&lt;/a&gt;"},{"from_user_id_str":"33858777","profile_image_url":"http://a0.twimg.com/profile_images/352864695/muga_normal.jpg","created_at":"Thu, 27 Jan 2011 14:46:12 +0000","from_user":"collonist","id_str":"30637702105796610","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u3063\u3066\u51ac\u306f\u57fa\u672c\u7684\u306b\u6674\u308c\u3066\u308b\u304b\u3089\u3001\u5929\u6c17\u4e88\u5831\u898b\u306a\u304f\u3066\u3082\u5168\u7136\u554f\u984c\u306a\u3044\u3002\u5c71\u5f62\u3060\u3068\u660e\u65e5\u306f\u3069\u3093\u3060\u3051\u96ea\u304c\u964d\u308b\u306e\u304b\u3001\u3069\u3093\u3060\u3051\u5bd2\u3044\u306e\u304b\u628a\u63e1\u3057\u3066\u3068\u304d\u305f\u3044\u306e\u3067\u3001\u5929\u6c17\u4e88\u5831\u306f\u5fc5\u305a\u30c1\u30a7\u30c3\u30af\u3057\u3066\u305f\u306e\u3060\u304c\u3002","id":30637702105796610,"from_user_id":33858777,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.hootsuite.com&quot; rel=&quot;nofollow&quot;&gt;HootSuite&lt;/a&gt;"},{"from_user_id_str":"79336228","profile_image_url":"http://a0.twimg.com/profile_images/1130029876/zmanmu_normal.png","created_at":"Thu, 27 Jan 2011 14:30:23 +0000","from_user":"atsuki777","id_str":"30633725041573890","metadata":{"result_type":"recent"},"to_user_id":null,"text":"MXTV\u306e\u5929\u6c17\u4e88\u5831\u521d\u3081\u3066\u898b\u305f\u3051\u3069\u6771\u4eac\u753a\u7530\u516b\u738b\u5b50\u3063\u3066\u5730\u57df\u8868\u793a\u304c\u2026w\u516b\u738b\u5b50\u3068\u753a\u7530\u306f\u6771\u4eac\u3058\u3083\u306a\u3044\u306e\u304bwww","id":30633725041573890,"from_user_id":79336228,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.echofon.com/&quot; rel=&quot;nofollow&quot;&gt;Echofon&lt;/a&gt;"},{"from_user_id_str":"90576097","profile_image_url":"http://a0.twimg.com/profile_images/1203320254/nanami1_normal.png","created_at":"Thu, 27 Jan 2011 14:28:26 +0000","from_user":"dycroft","id_str":"30633234245099521","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306e\u660e\u65e5\u306e\u304a\u5929\u6c17\u3067\u3059","id":30633234245099521,"from_user_id":90576097,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://sourceforge.jp/projects/tween/wiki/FrontPage&quot; rel=&quot;nofollow&quot;&gt;Tween&lt;/a&gt;"},{"from_user_id_str":"147215268","profile_image_url":"http://a2.twimg.com/profile_images/1198555202/ichika-7.4.0-3P_normal.gif","created_at":"Thu, 27 Jan 2011 14:28:23 +0000","from_user":"kiaran5032","id_str":"30633222211637248","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306e\u660e\u65e5\u306e\u304a\u5929\u6c17\u3067\u3059\u3002\u6674\u308c\u6642\u3005\u304f\u3082\u308a #MX","id":30633222211637248,"from_user_id":147215268,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://sourceforge.jp/projects/tween/wiki/FrontPage&quot; rel=&quot;nofollow&quot;&gt;Tween&lt;/a&gt;"},{"from_user_id_str":"1741599","profile_image_url":"http://a0.twimg.com/profile_images/1205744888/950637_normal.jpg","created_at":"Thu, 27 Jan 2011 14:28:21 +0000","from_user":"dasaitama","id_str":"30633212535382016","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306e\u3001\u660e\u65e5\u306e\u304a\u5929\u6c17\u3067\u3059","id":30633212535382016,"from_user_id":1741599,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://sourceforge.jp/projects/tween/wiki/FrontPage&quot; rel=&quot;nofollow&quot;&gt;Tween&lt;/a&gt;"},{"from_user_id_str":"34140879","profile_image_url":"http://a3.twimg.com/profile_images/1186413535/__6_normal.jpg","created_at":"Thu, 27 Jan 2011 14:28:17 +0000","from_user":"ryuji_chaos","id_str":"30633197016449024","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306e\u660e\u65e5\u306e\u304a\u5929\u6c17\u3067\u3059\u3002","id":30633197016449024,"from_user_id":34140879,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"1400","profile_image_url":"http://a0.twimg.com/profile_images/1198556839/westerndog_20090104_320x320_normal.jpg","created_at":"Thu, 27 Jan 2011 14:28:16 +0000","from_user":"westerndog","id_str":"30633191232503808","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306e\u660e\u65e5\u306e\u304a\u5929\u6c17\u3067\u3059","id":30633191232503808,"from_user_id":1400,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://sourceforge.jp/projects/tween/wiki/FrontPage&quot; rel=&quot;nofollow&quot;&gt;Tween&lt;/a&gt;"},{"from_user_id_str":"89239832","profile_image_url":"http://a3.twimg.com/profile_images/519522846/noriko_normal.jpg","created_at":"Thu, 27 Jan 2011 14:15:01 +0000","from_user":"Noriko_Fujimoto","id_str":"30629857234788352","metadata":{"result_type":"recent"},"to_user_id":115645219,"text":"@nossa430402 \u5bcc\u5c71\u306f\u3059\u3054\u3044\u96ea\u307f\u305f\u3044\u3067\u3059\u306d\uff5e\uff08\u5bd2\u3063\uff09\u3000\u6771\u4eac\u306f\u305d\u306e\u5206\u6bce\u65e5\u826f\u3044\u5929\u6c17\u3067\u3059\u3002\u5bd2\u3044\u3051\u3069\u30fb\u30fb\u30fb\u3002","id":30629857234788352,"from_user_id":89239832,"to_user":"nossa430402","geo":null,"iso_language_code":"ja","to_user_id_str":"115645219","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"107265539","profile_image_url":"http://a0.twimg.com/sticky/default_profile_images/default_profile_3_normal.png","created_at":"Thu, 27 Jan 2011 14:01:10 +0000","from_user":"kurumasuki330","id_str":"30626371826884608","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u9031\u571f\u66dc\u65e5\u3001\u8eca\u3067\u6771\u4eac\u304b\u3089\u6771\u540d\u3001\u7c73\u539f\u7d4c\u7531\u3067\u91d1\u6ca2\u306e\u5b9f\u5bb6\u3078\u3002\u305d\u3057\u3066\u3001\u6708\u66dc\u65e5\u306b\u6771\u4eac\u3078\u5e30\u308b\u30b9\u30b1\u30b8\u30e5\u30fc\u30eb\u3002\u5929\u6c17\u4e88\u5831\u3060\u3068\u4eca\u9031\u672b\u3001\u5317\u9678\u5730\u65b9\u306f\u5927\u96ea\uff01\u5e30\u308c\u308b\u304b\u81ea\u4fe1\u304c\u306a\u304f\u306a\u3063\u3066\u304d\u305f\u3002\u307e\u305f\u3001\u305d\u306e\u6642\u5b9f\u6cc1\u4e2d\u7d99\u3057\u307e\u3059\u3002","id":30626371826884608,"from_user_id":107265539,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twtr.jp&quot; rel=&quot;nofollow&quot;&gt;Keitai Web&lt;/a&gt;"},{"from_user_id_str":"155313166","profile_image_url":"http://a3.twimg.com/profile_images/1167554721/73931_1408370184003_1674923704_920888_5686998_n_normal.jpg","created_at":"Thu, 27 Jan 2011 14:00:50 +0000","from_user":"takuya_aoki","id_str":"30626287127105536","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306f\u3081\u3063\u3061\u3083\u3044\u3044\u5929\u6c17\u3067\u904e\u3054\u3057\u3084\u3059\u3044\u3051\u3069\u30c9\u30e9\u30a4\u30a2\u30a4\u306b\u306f\u3061\u3087\u3063\u3068\u304d\u3064\u3044\u306a\u30fb\u30fb\u30fb\u76ee\u85ac\u304c\u624b\u653e\u305b\u306a\u3044","id":30626287127105536,"from_user_id":155313166,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"179984398","profile_image_url":"http://a1.twimg.com/profile_images/1182382310/g4350_normal.jpg","created_at":"Thu, 27 Jan 2011 13:52:50 +0000","from_user":"aiilabo","id_str":"30624271902449664","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30d6\u30ed\u30b0\u66f4\u65b0 \u25c6\u611f\u60c5\u3092\u307f\u3064\u3081\u308b\u65b9\u6cd5 - \u3053\u3053\u6570\u65e5\u3001\u6642\u6298\u96e8\u304c\u30d1\u30e9\u30d1\u30e9\u3000\u5fae\u5999\u306a\u5929\u6c17\u306e\u6771\u4eac\u304b\u3089\u3042\u308b\u304c\u307e\u307e\u3067\u3059\u3002 \n\n \u4eca\u65e5\u306f\u3001\u6628\u65e5\u306e\u300c\u30de\u30a4\u30ca\u30b9\u611f\u60c5\u306f\u60aa\u3067\u3059\u304b\uff1f\n.. \u27aa http://am6.jp/e3e9tS","id":30624271902449664,"from_user_id":179984398,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://feedtweet.am6.jp/&quot; rel=&quot;nofollow&quot;&gt;\u261e feedtweet.jp \u261c&lt;/a&gt;"},{"from_user_id_str":"185992391","profile_image_url":"http://a2.twimg.com/profile_images/1192695844/otenki_normal.png","created_at":"Thu, 27 Jan 2011 13:00:37 +0000","from_user":"otenki_luci_bot","id_str":"30611130938298368","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u767a\u58f2\u65e5\u304b\u2026\u2026\u541b\u305f\u3061\u306b\u3068\u3063\u3066\u306f\u591a\u5206\u300190\u65e5\u5f8c\u306e\u3053\u3068\u3060\u3002\u3055\u3066\u660e\u65e5\u306e\u6771\u4eac\u90fd\u306e\u5929\u6c17\u306f\u6674\u306e\u3061\u66c7\u3001\u6700\u9ad8\u6c17\u6e29\u306f8\u5ea6\u3060\u305d\u3046\u3060\u3002\u3055\u3059\u304c\u306b\u4f55\u304b\u7740\u305f\u65b9\u304c\u3044\u3044\u305e\u3001\u30a4\u30fc\u30ce\u30c3\u30af\u3002","id":30611130938298368,"from_user_id":185992391,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/otenki_luci_bot&quot; rel=&quot;nofollow&quot;&gt;\u304a\u3066\u3093\u304d\u308b\u3057\u3075\u3047\u308b&lt;/a&gt;"},{"from_user_id_str":"65976527","profile_image_url":"http://a0.twimg.com/profile_images/452810990/little_italies_____normal.jpg","created_at":"Thu, 27 Jan 2011 13:00:04 +0000","from_user":"heta_weather01","id_str":"30610995843964928","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u30d8\u30bf\u5929\u3011Jo napot.\u30cf\u30f3\u30ac\u30ea\u30fc\u3067\u3059\u3002\u6771\u4eac\u306e\u5929\u6c17\u306f\u6674\u306e\u3061\u66c7\u3067\u660e\u65e5\u306f\u6674\u6642\u3005\u66c7\u3001\u79c1\u306e\u3068\u3053\u308d\u3067\u306f\u66c7\u308a\u3067-2\u2103\u3067\u3059\u3002\u3048\u3001\u3053\u306e\u30d5\u30e9\u30a4\u30d1\u30f3\u3067\u3059\u304b\uff1f\u2026\u3061\u3087\u3063\u3068\u500b\u4eba\u7684\u306b\u6bb4\u308a\u305f\u3044\u4eba\u304c\u3044\u308b\u3093\u3067\u3059\u266a","id":30610995843964928,"from_user_id":65976527,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www15.atpages.jp/~kageyanma/&quot; rel=&quot;nofollow&quot;&gt;\u5730\u7403\u306e\u4e2d&lt;/a&gt;"},{"from_user_id_str":"109740077","profile_image_url":"http://a0.twimg.com/profile_images/1212763349/1d3d3821-6b3a-449f-a636-05b95ce3d5d8_normal.png","created_at":"Thu, 27 Jan 2011 12:59:41 +0000","from_user":"snow_arai","id_str":"30610896141156354","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306f\u3001\u30ab\u30e9\u30ab\u30e9\u9023\u7d9a\u3000\uff13\u4f4d\u30bf\u30a4 - \u65e9\u8d77\u304d\u2606\u304a\u5929\u6c17\u2606ONAIR\u65e5\u8a18\uff1a\u65e5\u7d4c\u30a6\u30fc\u30de\u30f3\u30aa\u30f3\u30e9\u30a4\u30f3 http://j.mp/hxP3Di","id":30610896141156354,"from_user_id":109740077,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"53407951","profile_image_url":"http://a1.twimg.com/profile_images/397960795/airman_normal.jpg","created_at":"Thu, 27 Jan 2011 12:57:32 +0000","from_user":"Airman2009","id_str":"30610355541508096","metadata":{"result_type":"recent"},"to_user_id":null,"text":". @04mmy22 @qsk1 \u98a8\u3068\u96f2\u30fb\u30fb\u30fb\u98db\u884c\u6a5f\u306e\u5927\u5c0f\u554f\u308f\u305a\u3001\u3053\u308c\u3070\u304b\u308a\u306f\u3069\u3046\u3057\u3088\u3046\u3082\u7121\u3044\u3067\u3059\u3088\u306d\u3002 \u6700\u8fd1\u306e\u5357\u6771\u4eac\u306e\u5929\u6c17\u306f\u5909\u3067\u3059\u306d\u3002\u3002\u3002","id":30610355541508096,"from_user_id":53407951,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://sourceforge.jp/projects/tween/wiki/FrontPage&quot; rel=&quot;nofollow&quot;&gt;Tween&lt;/a&gt;"},{"from_user_id_str":"111826019","profile_image_url":"http://a1.twimg.com/profile_images/1121742732/DVC00052_normal.jpg","created_at":"Thu, 27 Jan 2011 12:51:12 +0000","from_user":"nijiks","id_str":"30608762859421696","metadata":{"result_type":"recent"},"to_user_id":100014282,"text":"@sanaeru \u79c1\u3053\u3093\u306a\u5929\u6c17\u306e\u4e2d\uff64\u4e8c\u6cca\u4e09\u65e5\u3067\u660e\u65e5\u304b\u3089\u6771\u4eac\u884c\u304f\u3093\u3067\u3059\u3051\u3069\u2026\uff61\u65e5\u66dc\u65e5\u98db\u884c\u6a5f\u98db\u3076\u304b\u3057\u3089\u2026\uff1f","id":30608762859421696,"from_user_id":111826019,"to_user":"sanaeru","geo":null,"iso_language_code":"ja","to_user_id_str":"100014282","source":"&lt;a href=&quot;http://z.twipple.jp/&quot; rel=&quot;nofollow&quot;&gt;\u3064\u3044\u3063\u3077\u308b/twipple&lt;/a&gt;"},{"from_user_id_str":"164951488","profile_image_url":"http://a3.twimg.com/profile_images/799082230/twitter_normal.jpg","created_at":"Thu, 27 Jan 2011 12:47:49 +0000","from_user":"minorif_jp","id_str":"30607912309096448","metadata":{"result_type":"recent"},"to_user_id":105078670,"text":"@ecco_HIRADO \u5e73\u6238\u725b\u3063\u3066\u5143\u306f\u30aa\u30e9\u30f3\u30c0\u304b\u3089\u304d\u305f\u725b\u306a\u3093\u3060\u306d\u3002\u304a\u3044\u3057\u305d\u3046\u2026\u3002\u5e73\u6238\u306f\u3088\u304b\u6240\u305f\u3043\u3002\u3042\u305f\u3044\u3052\u3047\u3093\u5b9f\u5bb6\u3093\u65b9\u306f\u30c0\u30d6\u30eb\u706b\u5c71\u3084\u9ce5\u30a4\u30f3\u30d5\u30eb\u3067\u5927\u5909\u3084\u3063\u3069\u3002\u6771\u4eac\u3093\u826f\u304b\u3068\u3053\u306f\u5929\u6c17\u306e\u5fc3\u914d\u305b\u305a\u66ae\u3089\u305b\u308b\u3068\u3053\u3058\u3083\u3063\u3069\u3093\u3002","id":30607912309096448,"from_user_id":164951488,"to_user":"ecco_HIRADO","geo":null,"iso_language_code":"ja","to_user_id_str":"105078670","source":"&lt;a href=&quot;http://z.twipple.jp/&quot; rel=&quot;nofollow&quot;&gt;\u3064\u3044\u3063\u3077\u308b/twipple&lt;/a&gt;"},{"from_user_id_str":"10456803","profile_image_url":"http://a1.twimg.com/profile_images/145280215/vot_icon_normal.png","created_at":"Thu, 27 Jan 2011 12:43:37 +0000","from_user":"vot_","id_str":"30606853377363968","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3086\u3063\u304f\u308a\u5929\u6c17\u4e88\u5831\u3067\u3059\u3002\u6771\u4eac\u90fd,\u5927\u5cf6\u5730\u65b9\u300228\u65e5\uff08\u91d1\u66dc\u65e5\u306e\u5929\u6c17\u306f\u6674\u308c\u306e\u3061\u66c7\u308a\u3001\u6700\u9ad8\u6c17\u6e29\u306f7\u5ea6 \u6700\u4f4e\u6c17\u6e29\u306f1\u5ea6\u3067\u3057\u3087\u3046\u3002","id":30606853377363968,"from_user_id":10456803,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://voiceoftwitter.com&quot; rel=&quot;nofollow&quot;&gt;\uff56\uff4f\uff49\uff43\uff45 \uff4f\uff46 \uff54\uff57\uff49\uff54\uff54\uff45\uff52&lt;/a&gt;"},{"from_user_id_str":"23900716","profile_image_url":"http://a3.twimg.com/profile_images/1092646332/twitter_icon_normal.png","created_at":"Thu, 27 Jan 2011 12:38:00 +0000","from_user":"keiyama","id_str":"30605442639990784","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u7f8e\u4eba\u5929\u6c17/\u6771\u4eac\u3011\u7f8e\u4eba\u5929\u6c17\u30ad\u30e3\u30b9\u30bf\u30fc\u306e&quot;\u30c8\u30e2\u30b3\u3055\u3093&quot;\u306b\u3088\u308b\u3068\u300c1/27(\u6728)\u306f\u304f\u3082\u308a\u306e\u3061\u6674\u3067\u3001\u964d\u6c34\u78ba\u738710%\u3001\u6700\u9ad8\u6c17\u6e29\u306f9\u2103\u3067\u6700\u4f4e\u6c17\u6e29\u306f2\u2103\u3067\u3059\u300d\u7f8e\u4eba\u5929\u6c17\u21d2http://bit.ly/djB8th http://twitpic.com/3tuekm #bt_tenki","id":30605442639990784,"from_user_id":23900716,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://bijintenki.jp&quot; rel=&quot;nofollow&quot;&gt;bijintenki.jp&lt;/a&gt;"},{"from_user_id_str":"32018516","profile_image_url":"http://a0.twimg.com/profile_images/1089472069/237_normal.jpg","created_at":"Thu, 27 Jan 2011 12:36:28 +0000","from_user":"DigJandG","id_str":"30605057460281344","metadata":{"result_type":"recent"},"to_user_id":196050661,"text":"@kosumoworld55 \u5929\u6c17\u4e88\u5831\u3092\u898b\u3066\u3044\u3064\u3082\u601d\u3046\u3093\u3060\u3002\u4f55\u3067\u6a2a\u6d5c\u3042\u305f\u308a\u306f\u3044\u3064\u3082\u597d\u3044\u5929\u6c17\u306a\u3093\u3060\u3002\u6771\u4eac\u3082\u3002\u3061\u306a\u307f\u306b\u516c\u9b5a\u306f\u3042\u3093\u307e\u308a\u597d\u304d\u3067\u306f\u3042\u308a\u307e\u305b\u3093\u3002\u306a\u3093\u304b\u81ed\u304f\u3063\u3066\u3002\u3067\u3082\u3001\u7435\u7436\u6e56\u3067\u516c\u9b5a\u3063\u3066\u3042\u307e\u308a\u805e\u304b\u306a\u3044\u69d8\u306a\u30fb\u30fb\u30fb\u3002\u4ffa\u304c\u91e3\u308a\u3092\u3057\u306a\u3044\u304b\u3089\u304b\u306a\uff1f","id":30605057460281344,"from_user_id":32018516,"to_user":"kosumoworld55","geo":null,"iso_language_code":"ja","to_user_id_str":"196050661","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"90935348","profile_image_url":"http://a1.twimg.com/sticky/default_profile_images/default_profile_0_normal.png","created_at":"Thu, 27 Jan 2011 12:34:34 +0000","from_user":"sorakeiko","id_str":"30604575937396737","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u95a2\u6771\u5730\u65b9\u306e\u660e\u65e5\u306e\u5929\u6c17\u2015\u7d9a\u304d\u3002\u660e\u65e5\u671d\u6700\u4f4e\u6c17\u6e29\u30fb\u8ed2\u4e26\u307f\u6c37\u70b9\u4e0b\u30fb\u5b87\u90fd\u5bae\u3001\u6c34\u6238\u30de\u30a4\u30ca\u30b95\u5ea6\u30fb\u6771\u4eac\u3001\u6a2a\u6d5c1\u5ea6\u3002\u6700\u9ad8\u6c17\u6e29\u30fb\u4eca\u65e5\u3088\u308a3\u5ea6\u524d\u5f8c\u4f4e\u304f5\uff5e8\u5ea6\u30fb\u6771\u4eac\u3001\u5343\u84498\u5ea6\u3002\u5411\u3053\u3046\u4e00\u9031\u9593\u30fb\u4e7e\u71e5\u3057\u305f\u6674\u308c\u7d9a\u304f\u30fb\uff08\u571f\uff09\u4f0a\u8c46\u8af8\u5cf6\u306b\u51b7\u305f\u3044\u96e8\u3084\u96ea\u304c\u898b\u3089\u308c\u305d\u3046\u3060\u304c\u3001\u95a2\u6771\u306e\u4e7e\u3044\u305f\u72b6\u614b\u7d9a\u304f\u3002","id":30604575937396737,"from_user_id":90935348,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"6113557","profile_image_url":"http://a3.twimg.com/profile_images/1227080026/profile_red_herencia_normal.png","created_at":"Thu, 27 Jan 2011 12:33:57 +0000","from_user":"fmoto7","id_str":"30604423327653888","metadata":{"result_type":"recent"},"to_user_id":null,"text":"&quot;\u6771\u4eac\u6c34\u904b\u7528\u30bb\u30f3\u30bf\u30fc\u306f\u3001\u524d\u534a\u6226\u304c\u7d42\u308f\u3063\u305f\u3068\u3053\u308d\u3067\u4e00\u6c17\u306b\u6c34\u5727\u9ad8\u3081\u3001\u5f8c\u534a\u6226\u59cb\u307e\u308b\u3068\u6c34\u5727\u4e0b\u3052\u3001\u7d42\u308f\u308b\u3068\u307e\u305f\u3059\u3050\u4e0a\u3052\u308b\u3002\u30c6\u30ec\u30d3\u306e\u8996\u8074\u3001\u305d\u306e\u65e5\u306e\u5929\u6c17\u306a\u3069\u30e9\u30a4...&quot; http://tumblr.com/xjy1cwiwrm","id":30604423327653888,"from_user_id":6113557,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.tumblr.com/&quot; rel=&quot;nofollow&quot;&gt;Tumblr&lt;/a&gt;"},{"from_user_id_str":"118092912","profile_image_url":"http://a3.twimg.com/profile_images/1225330653/____normal.PNG","created_at":"Thu, 27 Jan 2011 12:29:13 +0000","from_user":"saechuchun","id_str":"30603231042207744","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3067\u3082\u5730\u9707\u306e\u8a71\u984c\u306e\u3068\u304d\u306e\u300c\u3082\u3057\u6771\u4eac\u3067\u76f4\u4e0b\u578b\u5730\u9707\u304c\u8d77\u304d\u305f\u3089\u300d\u3068\u304b\u5929\u6c17\u4e88\u5831\u306e\u3068\u304d\u306f\u897f\u3067\u96e8\u3060\u308d\u3046\u3068\u300c\u6771\u4eac\u3067\u306f\u301c\u65e5\u9593\u4e7e\u71e5\u3057\u3066\u307e\u3059\u306d\u30fc\u300d\u3068\u304b\u305d\u3046\u3044\u3046\u30ad\u30fc\u5c40\u306e\u95a2\u6771\u4e2d\u5fc3\u4e3b\u7fa9\u306f\u597d\u304d\u3067\u306f\u306a\u3044","id":30603231042207744,"from_user_id":118092912,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twtr.jp&quot; rel=&quot;nofollow&quot;&gt;Keitai Web&lt;/a&gt;"}],"max_id":30724239224995840,"since_id":28179956995457024,"refresh_url":"?since_id=30724239224995840&q=%E6%9D%B1%E4%BA%AC%E3%80%80%E5%A4%A9%E6%B0%97","next_page":"?page=2&max_id=30724239224995840&rpp=50&lang=ja&q=%E6%9D%B1%E4%BA%AC%E3%80%80%E5%A4%A9%E6%B0%97","results_per_page":50,"page":1,"completed_in":0.170202,"warning":"adjusted since_id to 28179956995457024 (), requested since_id was older than allowed -- since_id removed for pagination.","since_id_str":"28179956995457024","max_id_str":"30724239224995840","query":"%E6%9D%B1%E4%BA%AC%E3%80%80%E5%A4%A9%E6%B0%97"}
benchmarks/json-data/numbers.jsonnew file+1
@@ -0,0 +1 @@
1+[1.15, 1.3224999999999998, 1.5208749999999998, 1.7490062499999994, 2.0113571874999994, 2.313060765624999, 2.6600198804687487, 3.0590228625390607, 3.5178762919199196, 4.045557735707907, 4.652391396064092, 5.350250105473706, 6.152787621294761, 7.075705764488975, 8.137061629162321, 9.357620873536668, 10.761264004567169, 12.375453605252241, 14.231771646040077, 16.36653739294609, 18.821518001888, 21.644745702171196, 24.891457557496874, 28.625176191121405, 32.918952619789614, 37.856795512758055, 43.535314839671756, 50.06561206562252, 57.57545387546589, 66.21177195678577, 76.14353775030362, 87.56506841284916, 100.69982867477653, 115.804802975993, 133.17552342239193, 153.15185193575073, 176.1246297261133, 202.5433241850303, 232.9248228127848, 267.86354623470254, 308.04307816990786, 354.24953989539404, 407.3869708797031, 468.49501651165855, 538.7692689884072, 619.5846593366683, 712.5223582371685, 819.4007119727437, 942.3108187686552, 1083.6574415839534, 1246.2060578215462, 1433.136966494778, 1648.1075114689947, 1895.323638189344, 2179.622183917745, 2506.565511505407, 2882.5503382312177, 3314.9328889659, 3812.172822310785, 4383.998745657402, 5041.598557506012, 5797.838341131914, 6667.5140923017, 7667.641206146955, 8817.787387068996, 10140.455495129345, 11661.523819398746, 13410.752392308557, 15422.365251154839, 17735.720038828065, 20396.078044652273, 23455.489751350113, 26973.813214052625, 31019.885196160518, 35672.867975584595, 41023.79817192228, 47177.36789771062, 54253.97308236721, 62392.06904472228, 71750.87940143062, 82513.5113116452, 94890.53800839197, 109124.11870965076, 125492.73651609836, 144316.6469935131, 165964.14404254008, 190858.76564892105, 219487.5804962592, 252410.71757069806, 290272.32520630275, 333813.17398724816, 383885.1500853353, 441467.9225981356, 507688.1109878559, 583841.3276360342, 671417.5267814393, 772130.1557986551, 887949.6791684533, 1021142.1310437213, 1174313.4507002793, 1350460.4683053212, 1553029.5385511192, 1785983.969333787, 2053881.564733855, 2361963.7994439327, 2716258.369360523, 3123697.124764601, 3592251.6934792907, 4131089.447501184, 4750752.864626361, 5463365.794320315, 6282870.663468362, 7225301.262988616, 8309096.452436907, 9555460.920302443, 10988780.058347808, 12637097.067099977, 14532661.627164973, 16712560.871239718, 19219445.001925673, 22102361.752214525, 25417716.0150467, 29230373.417303704, 33614929.42989926, 38657168.84438414, 44455744.17104176, 51124105.79669802, 58792721.66620272, 67611629.91613312, 77753374.40355308, 89416380.56408603, 102828837.64869894, 118253163.29600377, 135991137.79040432, 156389808.45896497, 179848279.7278097, 206825521.68698114, 237849349.94002828, 273526752.4310325, 314555765.2956874, 361739130.09004045, 415999999.60354644, 478399999.5440784, 550159999.4756901, 632683999.3970436, 727586599.3066001, 836724589.20259, 962233277.5829784, 1106568269.2204251, 1272553509.6034887, 1463436536.044012, 1682952016.4506137, 1935394818.9182055, 2225704041.755936, 2559559648.019326, 2943493595.222225, 3385017634.5055585, 3892770279.681392, 4476685821.6336, 5148188694.87864, 5920416999.1104355, 6808479548.977001, 7829751481.32355, 9004214203.522081, 10354846334.050394, 11908073284.157951, 13694284276.781643, 15748426918.29889, 18110690956.04372, 20827294599.450275, 23951388789.367817, 27544097107.772987, 31675711673.938934, 36427068425.02977, 41891128688.78423, 48174797992.10186, 55401017690.91714, 63711170344.5547, 73267845896.2379, 84258022780.67358, 96896726197.77461, 111431235127.4408, 128145920396.5569, 147367808456.04044, 169472979724.44647, 194893926683.11343, 224128015685.58044, 257747218038.41748, 296409300744.1801, 340870695855.80707, 392001300234.1781, 450801495269.3048, 518421719559.70044, 596184977493.6555, 685612724117.7037, 788454632735.3593, 906722827645.6631, 1042731251792.5125, 1199140939561.3892, 1379012080495.5974, 1585863892569.937, 1823743476455.4275, 2097304997923.7415, 2411900747612.3022, 2773685859754.1475, 3189738738717.2695, 3668199549524.8594, 4218429481953.5884, 4851193904246.626, 5578872989883.619, 6415703938366.162, 7378059529121.086, 8484768458489.248, 9757483727262.635, 11221106286352.03, 12904272229304.832, 14839913063700.555, 17065900023255.637, 19625785026743.98, 22569652780755.58, 25955100697868.91, 29848365802549.246, 34325620672931.63, 39474463773871.375, 45395633339952.07, 52204978340944.88, 60035725092086.61, 69041083855899.59, 79397246434284.53, 91306833399427.2, 105002858409341.27, 120753287170742.45, 138866280246353.81, 159696222283306.88, 183650655625802.88, 211198253969673.3, 242877992065124.28, 279309690874892.9, 321206144506126.8, 369387066182045.8, 424795126109352.6, 488514395025755.5, 561791554279618.75, 646060287421561.5, 742969330534795.8, 854414730115015.0, 982576939632267.1, 1129963480577107.2, 1299458002663673.2, 1494376703063224.0, 1718533208522707.5, 1976313189801113.5, 2272760168271280.5, 2613674193511972.0, 3005725322538767.5, 3456584120919582.5, 3975071739057519.5, 4571332499916147.0, 5257032374903569.0, 6045587231139104.0, 6952425315809969.0, 7995289113181464.0, 9194582480158682.0, 1.0573769852182484e+16, 1.2159835330009856e+16, 1.3983810629511332e+16, 1.6081382223938032e+16, 1.8493589557528736e+16, 2.1267627991158044e+16, 2.4457772189831748e+16, 2.8126438018306508e+16, 3.234540372105248e+16, 3.719721427921035e+16, 4.27767964210919e+16, 4.919331588425568e+16, 5.657231326689403e+16, 6.505816025692813e+16, 7.481688429546734e+16, 8.603941693978744e+16, 9.894532948075555e+16, 1.1378712890286886e+17, 1.3085519823829918e+17, 1.5048347797404406e+17, 1.7305599967015066e+17, 1.9901439962067325e+17, 2.288665595637742e+17, 2.6319654349834032e+17, 3.026760250230913e+17, 3.48077428776555e+17, 4.002890430930382e+17, 4.603323995569939e+17, 5.29382259490543e+17, 6.087895984141244e+17, 7.00108038176243e+17, 8.051242439026793e+17, 9.258928804880812e+17, 1.0647768125612933e+18, 1.224493334445487e+18, 1.4081673346123103e+18, 1.6193924348041567e+18, 1.8623013000247798e+18, 2.1416464950284966e+18, 2.462893469282771e+18, 2.8323274896751867e+18, 3.257176613126464e+18, 3.7457531050954337e+18, 4.3076160708597484e+18, 4.95375848148871e+18, 5.696822253712016e+18, 6.551345591768818e+18, 7.53404743053414e+18, 8.66415454511426e+18, 9.963777726881399e+18, 1.1458344385913608e+19, 1.3177096043800648e+19, 1.5153660450370744e+19, 1.7426709517926355e+19, 2.0040715945615307e+19, 2.30468233374576e+19, 2.650384683807624e+19, 3.047942386378767e+19, 3.505133744335582e+19, 4.030903805985919e+19, 4.635539376883806e+19, 5.330870283416377e+19, 6.130500825928833e+19, 7.0500759498181575e+19, 8.10758734229088e+19, 9.323725443634512e+19, 1.0722284260179688e+20, 1.233062689920664e+20, 1.4180220934087634e+20, 1.6307254074200778e+20, 1.8753342185330894e+20, 2.1566343513130526e+20, 2.4801295040100103e+20, 2.8521489296115116e+20, 3.2799712690532385e+20, 3.7719669594112236e+20, 4.337762003322907e+20, 4.988426303821342e+20, 5.7366902493945437e+20, 6.597193786803724e+20, 7.586772854824282e+20, 8.724788783047925e+20, 1.0033507100505113e+21, 1.1538533165580878e+21, 1.326931314041801e+21, 1.5259710111480708e+21, 1.7548666628202813e+21, 2.0180966622433234e+21, 2.3208111615798217e+21, 2.668932835816795e+21, 3.0692727611893135e+21, 3.529663675367711e+21, 4.059113226672867e+21, 4.667980210673796e+21, 5.368177242274866e+21, 6.173403828616095e+21, 7.099414402908508e+21, 8.164326563344784e+21, 9.388975547846502e+21, 1.0797321880023475e+22, 1.2416920162026996e+22, 1.4279458186331043e+22, 1.64213769142807e+22, 1.8884583451422802e+22, 2.171727096913622e+22, 2.497486161450665e+22, 2.872109085668265e+22, 3.3029254485185042e+22, 3.798364265796279e+22, 4.368118905665721e+22, 5.0233367415155795e+22, 5.7768372527429155e+22, 6.643362840654352e+22, 7.639867266752504e+22, 8.78584735676538e+22, 1.0103724460280185e+23, 1.1619283129322213e+23, 1.3362175598720545e+23, 1.5366501938528623e+23, 1.7671477229307915e+23, 2.0322198813704103e+23, 2.3370528635759717e+23, 2.687610793112367e+23, 3.090752412079222e+23, 3.554365273891105e+23, 4.0875200649747705e+23, 4.700648074720986e+23, 5.405745285929133e+23, 6.216607078818502e+23, 7.149098140641278e+23, 8.221462861737468e+23, 9.454682290998088e+23, 1.0872884634647801e+24, 1.250381732984497e+24, 1.4379389929321714e+24, 1.653629841871997e+24, 1.9016743181527962e+24, 2.1869254658757156e+24, 2.5149642857570727e+24, 2.8922089286206334e+24, 3.326040267913728e+24, 3.824946308100787e+24, 4.3986882543159046e+24, 5.05849149246329e+24, 5.817265216332783e+24, 6.6898549987827e+24, 7.693333248600105e+24, 8.84733323589012e+24, 1.0174433221273637e+25, 1.1700598204464681e+25, 1.3455687935134384e+25, 1.547404112540454e+25, 1.779514729421522e+25, 2.04644193883475e+25, 2.353408229659962e+25, 2.7064194641089563e+25, 3.1123823837253e+25, 3.5792397412840944e+25, 4.116125702476708e+25, 4.733544557848214e+25, 5.443576241525446e+25, 6.260112677754262e+25, 7.199129579417401e+25, 8.27899901633001e+25, 9.52084886877951e+25, 1.0948976199096437e+26, 1.25913226289609e+26, 1.4480021023305035e+26, 1.665202417680079e+26, 1.9149827803320907e+26, 2.202230197381904e+26, 2.5325647269891895e+26, 2.9124494360375676e+26, 3.349316851443203e+26, 3.8517143791596826e+26, 4.429471536033635e+26, 5.09389226643868e+26, 5.857976106404481e+26, 6.736672522365153e+26, 7.747173400719924e+26, 8.909249410827912e+26, 1.0245636822452099e+27, 1.1782482345819913e+27, 1.35498546976929e+27, 1.5582332902346833e+27, 1.7919682837698857e+27, 2.0607635263353683e+27, 2.3698780552856732e+27, 2.725359763578524e+27, 3.1341637281153025e+27, 3.6042882873325974e+27, 4.1449315304324867e+27, 4.7666712599973594e+27, 5.481671948996963e+27, 6.303922741346507e+27, 7.249511152548482e+27, 8.336937825430755e+27, 9.587478499245366e+27, 1.102560027413217e+28, 1.2679440315251995e+28, 1.4581356362539794e+28, 1.6768559816920761e+28, 1.9283843789458875e+28, 2.2176420357877703e+28, 2.5502883411559357e+28, 2.932831592329326e+28, 3.3727563311787245e+28, 3.8786697808555327e+28, 4.460470247983863e+28, 5.129540785181441e+28, 5.8989719029586575e+28, 6.783817688402455e+28, 7.801390341662823e+28, 8.971598892912247e+28, 1.0317338726849081e+29, 1.1864939535876443e+29, 1.3644680466257909e+29, 1.5691382536196593e+29, 1.8045089916626083e+29, 2.0751853404119993e+29, 2.3864631414737988e+29, 2.7444326126948684e+29, 3.1560975045990984e+29, 3.629512130288963e+29, 4.173938949832307e+29, 4.800029792307153e+29, 5.520034261153225e+29, 6.348039400326208e+29, 7.300245310375139e+29, 8.39528210693141e+29, 9.65457442297112e+29, 1.1102760586416787e+30, 1.2768174674379305e+30, 1.46834008755362e+30, 1.6885911006866628e+30, 1.941879765789662e+30, 2.2331617306581113e+30, 2.568135990256828e+30, 2.9533563887953516e+30, 3.396359847114654e+30, 3.905813824181852e+30, 4.491685897809129e+30, 5.165438782480498e+30, 5.940254599852573e+30, 6.831292789830458e+30, 7.855986708305026e+30, 9.034384714550779e+30, 1.0389542421733396e+31, 1.1947973784993405e+31, 1.3740169852742412e+31, 1.5801195330653773e+31, 1.817137463025184e+31, 2.0897080824789613e+31, 2.4031642948508052e+31, 2.7636389390784257e+31, 3.1781847799401893e+31, 3.6549124969312175e+31, 4.2031493714709e+31, 4.833621777191535e+31, 5.558665043770264e+31, 6.392464800335803e+31, 7.3513345203861735e+31, 8.454034698444098e+31, 9.722139903210713e+31, 1.1180460888692319e+32, 1.2857530021996165e+32, 1.478615952529559e+32, 1.7004083454089925e+32, 1.9554695972203414e+32, 2.2487900368033926e+32, 2.586108542323901e+32, 2.974024823672486e+32, 3.420128547223359e+32, 3.933147829306862e+32, 4.523120003702891e+32, 5.2015880042583246e+32, 5.981826204897073e+32, 6.879100135631634e+32, 7.910965155976377e+32, 9.097609929372833e+32, 1.0462251418778757e+33, 1.2031589131595571e+33, 1.3836327501334904e+33, 1.591177662653514e+33, 1.8298543120515409e+33, 2.104332458859272e+33, 2.4199823276881623e+33, 2.7829796768413863e+33, 3.200426628367594e+33, 3.6804906226227334e+33, 4.232564216016143e+33, 4.867448848418564e+33, 5.597566175681348e+33, 6.437201102033549e+33, 7.402781267338582e+33, 8.513198457439368e+33, 9.790178226055273e+33, 1.1258704959963564e+34, 1.2947510703958096e+34, 1.488963730955181e+34, 1.712308290598458e+34, 1.9691545341882266e+34, 2.2645277143164603e+34, 2.604206871463929e+34, 2.994837902183518e+34, 3.4440635875110457e+34, 3.960673125637702e+34, 4.554774094483357e+34, 5.237990208655861e+34, 6.023688739954239e+34, 6.927242050947375e+34, 7.96632835858948e+34, 9.161277612377902e+34, 1.0535469254234585e+35, 1.2115789642369772e+35, 1.3933158088725236e+35, 1.6023131802034022e+35, 1.8426601572339122e+35, 2.119059180818999e+35, 2.4369180579418488e+35, 2.8024557666331258e+35, 3.2228241316280944e+35, 3.706247751372308e+35, 4.262184914078154e+35, 4.901512651189877e+35, 5.636739548868358e+35, 6.482250481198611e+35, 7.454588053378403e+35, 8.572776261385162e+35, 9.858692700592935e+35, 1.1337496605681875e+36, 1.3038121096534156e+36, 1.499383926101428e+36, 1.7242915150166418e+36, 1.982935242269138e+36, 2.2803755286095084e+36]
benchmarks/json-data/twitter1.jsonnew file+1
@@ -0,0 +1 @@
1+{"results":[{"from_user_id_str":"80430860","profile_image_url":"http://a2.twimg.com/profile_images/536455139/icon32_normal.png","created_at":"Wed, 26 Jan 2011 07:07:02 +0000","from_user":"kazu_yamamoto","id_str":"30159761706061824","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell Server Pages \u3063\u3066\u3001\u307e\u3060\u7d9a\u3044\u3066\u3044\u305f\u306e\u304b\uff01","id":30159761706061824,"from_user_id":80430860,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"}],"max_id":30159761706061824,"since_id":0,"refresh_url":"?since_id=30159761706061824&q=haskell","next_page":"?page=2&max_id=30159761706061824&rpp=1&q=haskell","results_per_page":1,"page":1,"completed_in":0.012606,"since_id_str":"0","max_id_str":"30159761706061824","query":"haskell"}
benchmarks/json-data/twitter10.jsonnew file+1
@@ -0,0 +1 @@
1+{"results":[{"from_user_id_str":"207858021","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Wed, 26 Jan 2011 04:30:38 +0000","from_user":"pboudarga","id_str":"30120402839666689","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I'm at Rolla Sushi Grill (27737 Bouquet Canyon Road, #106, Btw Haskell Canyon and Rosedell Drive, Saugus) http://4sq.com/gqqdhs","id":30120402839666689,"from_user_id":207858021,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://foursquare.com&quot; rel=&quot;nofollow&quot;&gt;foursquare&lt;/a&gt;"},{"from_user_id_str":"69988683","profile_image_url":"http://a0.twimg.com/profile_images/1211955817/avatar_7888_normal.gif","created_at":"Wed, 26 Jan 2011 04:25:23 +0000","from_user":"YNK33","id_str":"30119083059978240","metadata":{"result_type":"recent"},"to_user_id":null,"text":"hsndfile 0.5.0: Free and open source Haskell bindings for libsndfile http://bit.ly/gHaBWG Mac Os","id":30119083059978240,"from_user_id":69988683,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"81492","profile_image_url":"http://a1.twimg.com/profile_images/423894208/Picture_7_normal.jpg","created_at":"Wed, 26 Jan 2011 04:24:28 +0000","from_user":"satzz","id_str":"30118851488251904","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Emacs\u306e\u30e2\u30fc\u30c9\u8868\u793a\u304c\u4eca(Ruby Controller Outputz RoR Flymake REl hs)\u3068\u306a\u3063\u3066\u3066\u3088\u304f\u308f\u304b\u3089\u306a\u3044\u3093\u3060\u3051\u3069\u6700\u5f8c\u306eREl\u3068\u304bhs\u3063\u3066\u4f55\u3060\u308d\u3046\u2026haskell\u3068\u304b2\u5e74\u4ee5\u4e0a\u66f8\u3044\u3066\u306a\u3044\u3051\u3069\u2026","id":30118851488251904,"from_user_id":81492,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.hootsuite.com&quot; rel=&quot;nofollow&quot;&gt;HootSuite&lt;/a&gt;"},{"from_user_id_str":"9518356","profile_image_url":"http://a2.twimg.com/profile_images/119165723/ocaml-icon_normal.png","created_at":"Wed, 26 Jan 2011 04:19:19 +0000","from_user":"planet_ocaml","id_str":"30117557788741632","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I so miss #haskell type classes in #ocaml - i want to do something like refinement. Also why does ocaml not have... http://bit.ly/geYRwt","id":30117557788741632,"from_user_id":9518356,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"218059","profile_image_url":"http://a1.twimg.com/profile_images/1053837723/twitter-icon9_normal.jpg","created_at":"Wed, 26 Jan 2011 04:16:32 +0000","from_user":"aprikip","id_str":"30116854940835840","metadata":{"result_type":"recent"},"to_user_id":null,"text":"yatex-mode\u3084haskell-mode\u306e\u3053\u3068\u3067\u3059\u306d\u3001\u308f\u304b\u308a\u307e\u3059\u3002","id":30116854940835840,"from_user_id":218059,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://sites.google.com/site/yorufukurou/&quot; rel=&quot;nofollow&quot;&gt;YoruFukurou&lt;/a&gt;"},{"from_user_id_str":"216363","profile_image_url":"http://a1.twimg.com/profile_images/72454310/Tim-Avatar_normal.png","created_at":"Wed, 26 Jan 2011 04:15:30 +0000","from_user":"dysinger","id_str":"30116594684264448","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell in Hawaii tonight for me... #fun","id":30116594684264448,"from_user_id":216363,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.nambu.com/&quot; rel=&quot;nofollow&quot;&gt;Nambu&lt;/a&gt;"},{"from_user_id_str":"1774820","profile_image_url":"http://a2.twimg.com/profile_images/61169291/dan_desert_thumb_normal.jpg","created_at":"Wed, 26 Jan 2011 04:13:36 +0000","from_user":"DanMil","id_str":"30116117682851840","metadata":{"result_type":"recent"},"to_user_id":1594784,"text":"@ojrac @chewedwire @tomheon Haskell isn't a language, it's a belief system. A seductive one...","id":30116117682851840,"from_user_id":1774820,"to_user":"ojrac","geo":null,"iso_language_code":"en","to_user_id_str":"1594784","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"659256","profile_image_url":"http://a0.twimg.com/profile_images/746976711/angular-final_normal.jpg","created_at":"Wed, 26 Jan 2011 04:11:06 +0000","from_user":"djspiewak","id_str":"30115488931520512","metadata":{"result_type":"recent"},"to_user_id":null,"text":"One of the very nice things about Haskell as opposed to SML is the reduced proliferation of identifiers (e.g. andb, orb, etc). #typeclasses","id":30115488931520512,"from_user_id":659256,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://itunes.apple.com/us/app/twitter/id409789998?mt=12&quot; rel=&quot;nofollow&quot;&gt;Twitter for Mac&lt;/a&gt;"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Wed, 26 Jan 2011 04:06:12 +0000","from_user":"listwarenet","id_str":"30114255890026496","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-cafe/84752-re-haskell-cafe-gpl-license-of-h-matrix-and-prelude-numeric.html Re: Haskell-c","id":30114255890026496,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"&lt;a href=&quot;http://1e10.org/cloud/&quot; rel=&quot;nofollow&quot;&gt;1e10&lt;/a&gt;"},{"from_user_id_str":"1594784","profile_image_url":"http://a2.twimg.com/profile_images/378515773/square-profile_normal.jpg","created_at":"Wed, 26 Jan 2011 04:01:29 +0000","from_user":"ojrac","id_str":"30113067333324800","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @tomheon: @ojrac @chewedwire Don't worry, learning Haskell will not give you any clear idea what monad means.","id":30113067333324800,"from_user_id":1594784,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"}],"max_id":30120402839666689,"since_id":0,"refresh_url":"?since_id=30120402839666689&q=haskell","next_page":"?page=2&max_id=30120402839666689&rpp=10&q=haskell","results_per_page":10,"page":1,"completed_in":0.012714,"since_id_str":"0","max_id_str":"30120402839666689","query":"haskell"}
benchmarks/json-data/twitter100.jsonnew file+1
@@ -0,0 +1 @@
1+{"results":[{"from_user_id_str":"3646730","profile_image_url":"http://a3.twimg.com/profile_images/404973767/avatar_normal.jpg","created_at":"Wed, 26 Jan 2011 04:35:07 +0000","from_user":"nicolaslara","id_str":"30121530767708160","metadata":{"result_type":"recent"},"to_user_id":18616016,"text":"@josej30 Python y Clojure. Obviamente son diferentes, y cada uno tiene sus ventajas y desventajas. De Haskell faltar\u00eda pattern matching","id":30121530767708160,"from_user_id":3646730,"to_user":"josej30","geo":null,"iso_language_code":"es","to_user_id_str":"18616016","source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"207858021","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Wed, 26 Jan 2011 04:30:38 +0000","from_user":"pboudarga","id_str":"30120402839666689","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I'm at Rolla Sushi Grill (27737 Bouquet Canyon Road, #106, Btw Haskell Canyon and Rosedell Drive, Saugus) http://4sq.com/gqqdhs","id":30120402839666689,"from_user_id":207858021,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://foursquare.com&quot; rel=&quot;nofollow&quot;&gt;foursquare&lt;/a&gt;"},{"from_user_id_str":"69988683","profile_image_url":"http://a0.twimg.com/profile_images/1211955817/avatar_7888_normal.gif","created_at":"Wed, 26 Jan 2011 04:25:23 +0000","from_user":"YNK33","id_str":"30119083059978240","metadata":{"result_type":"recent"},"to_user_id":null,"text":"hsndfile 0.5.0: Free and open source Haskell bindings for libsndfile http://bit.ly/gHaBWG Mac Os","id":30119083059978240,"from_user_id":69988683,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"81492","profile_image_url":"http://a1.twimg.com/profile_images/423894208/Picture_7_normal.jpg","created_at":"Wed, 26 Jan 2011 04:24:28 +0000","from_user":"satzz","id_str":"30118851488251904","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Emacs\u306e\u30e2\u30fc\u30c9\u8868\u793a\u304c\u4eca(Ruby Controller Outputz RoR Flymake REl hs)\u3068\u306a\u3063\u3066\u3066\u3088\u304f\u308f\u304b\u3089\u306a\u3044\u3093\u3060\u3051\u3069\u6700\u5f8c\u306eREl\u3068\u304bhs\u3063\u3066\u4f55\u3060\u308d\u3046\u2026haskell\u3068\u304b2\u5e74\u4ee5\u4e0a\u66f8\u3044\u3066\u306a\u3044\u3051\u3069\u2026","id":30118851488251904,"from_user_id":81492,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.hootsuite.com&quot; rel=&quot;nofollow&quot;&gt;HootSuite&lt;/a&gt;"},{"from_user_id_str":"9518356","profile_image_url":"http://a2.twimg.com/profile_images/119165723/ocaml-icon_normal.png","created_at":"Wed, 26 Jan 2011 04:19:19 +0000","from_user":"planet_ocaml","id_str":"30117557788741632","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I so miss #haskell type classes in #ocaml - i want to do something like refinement. Also why does ocaml not have... http://bit.ly/geYRwt","id":30117557788741632,"from_user_id":9518356,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"218059","profile_image_url":"http://a1.twimg.com/profile_images/1053837723/twitter-icon9_normal.jpg","created_at":"Wed, 26 Jan 2011 04:16:32 +0000","from_user":"aprikip","id_str":"30116854940835840","metadata":{"result_type":"recent"},"to_user_id":null,"text":"yatex-mode\u3084haskell-mode\u306e\u3053\u3068\u3067\u3059\u306d\u3001\u308f\u304b\u308a\u307e\u3059\u3002","id":30116854940835840,"from_user_id":218059,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://sites.google.com/site/yorufukurou/&quot; rel=&quot;nofollow&quot;&gt;YoruFukurou&lt;/a&gt;"},{"from_user_id_str":"216363","profile_image_url":"http://a1.twimg.com/profile_images/72454310/Tim-Avatar_normal.png","created_at":"Wed, 26 Jan 2011 04:15:30 +0000","from_user":"dysinger","id_str":"30116594684264448","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell in Hawaii tonight for me... #fun","id":30116594684264448,"from_user_id":216363,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.nambu.com/&quot; rel=&quot;nofollow&quot;&gt;Nambu&lt;/a&gt;"},{"from_user_id_str":"1774820","profile_image_url":"http://a2.twimg.com/profile_images/61169291/dan_desert_thumb_normal.jpg","created_at":"Wed, 26 Jan 2011 04:13:36 +0000","from_user":"DanMil","id_str":"30116117682851840","metadata":{"result_type":"recent"},"to_user_id":1594784,"text":"@ojrac @chewedwire @tomheon Haskell isn't a language, it's a belief system. A seductive one...","id":30116117682851840,"from_user_id":1774820,"to_user":"ojrac","geo":null,"iso_language_code":"en","to_user_id_str":"1594784","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"659256","profile_image_url":"http://a0.twimg.com/profile_images/746976711/angular-final_normal.jpg","created_at":"Wed, 26 Jan 2011 04:11:06 +0000","from_user":"djspiewak","id_str":"30115488931520512","metadata":{"result_type":"recent"},"to_user_id":null,"text":"One of the very nice things about Haskell as opposed to SML is the reduced proliferation of identifiers (e.g. andb, orb, etc). #typeclasses","id":30115488931520512,"from_user_id":659256,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://itunes.apple.com/us/app/twitter/id409789998?mt=12&quot; rel=&quot;nofollow&quot;&gt;Twitter for Mac&lt;/a&gt;"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Wed, 26 Jan 2011 04:06:12 +0000","from_user":"listwarenet","id_str":"30114255890026496","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-cafe/84752-re-haskell-cafe-gpl-license-of-h-matrix-and-prelude-numeric.html Re: Haskell-c","id":30114255890026496,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"&lt;a href=&quot;http://1e10.org/cloud/&quot; rel=&quot;nofollow&quot;&gt;1e10&lt;/a&gt;"},{"from_user_id_str":"1594784","profile_image_url":"http://a2.twimg.com/profile_images/378515773/square-profile_normal.jpg","created_at":"Wed, 26 Jan 2011 04:01:29 +0000","from_user":"ojrac","id_str":"30113067333324800","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @tomheon: @ojrac @chewedwire Don't worry, learning Haskell will not give you any clear idea what monad means.","id":30113067333324800,"from_user_id":1594784,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"207589736","profile_image_url":"http://a3.twimg.com/profile_images/1225527428/headshot_1_normal.jpg","created_at":"Wed, 26 Jan 2011 04:00:13 +0000","from_user":"ashleevelazq101","id_str":"30112747555397632","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Federal investigation finds safety violations at The Acadia Hospital: By Meg Haskell, BDN Staff The investigatio... http://bit.ly/dONnpn","id":30112747555397632,"from_user_id":207589736,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"17671137","profile_image_url":"http://a2.twimg.com/profile_images/290264834/Haskell-logo-outer-glow_normal.png","created_at":"Wed, 26 Jan 2011 03:58:00 +0000","from_user":"Hackage","id_str":"30112192346984448","metadata":{"result_type":"recent"},"to_user_id":null,"text":"streams 0.4, added by EdwardKmett: Various Haskell 2010 stream comonads http://bit.ly/idBkPe","id":30112192346984448,"from_user_id":17671137,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"17489366","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Wed, 26 Jan 2011 03:58:00 +0000","from_user":"aapnoot","id_str":"30112191881420800","metadata":{"result_type":"recent"},"to_user_id":null,"text":"streams 0.4, added by EdwardKmett: Various Haskell 2010 stream comonads http://bit.ly/idBkPe","id":30112191881420800,"from_user_id":17489366,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"8530482","profile_image_url":"http://a2.twimg.com/profile_images/137867266/n608671563_7396_normal.jpg","created_at":"Wed, 26 Jan 2011 03:50:12 +0000","from_user":"jeffmclamb","id_str":"30110229207187456","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Angel - daemon to run and monitor processes like daemontools or god, written in Haskell http://ff.im/-wNyLk","id":30110229207187456,"from_user_id":8530482,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://friendfeed.com&quot; rel=&quot;nofollow&quot;&gt;FriendFeed&lt;/a&gt;"},{"from_user_id_str":"177539201","profile_image_url":"http://a0.twimg.com/profile_images/1178368800/img_normal.jpeg","created_at":"Wed, 26 Jan 2011 03:46:01 +0000","from_user":"tomheon","id_str":"30109174645919744","metadata":{"result_type":"recent"},"to_user_id":1594784,"text":"@ojrac @chewedwire Don't worry, learning Haskell will not give you any clear idea what monad means.","id":30109174645919744,"from_user_id":177539201,"to_user":"ojrac","geo":null,"iso_language_code":"en","to_user_id_str":"1594784","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"1594784","profile_image_url":"http://a2.twimg.com/profile_images/378515773/square-profile_normal.jpg","created_at":"Wed, 26 Jan 2011 03:44:34 +0000","from_user":"ojrac","id_str":"30108808684503040","metadata":{"result_type":"recent"},"to_user_id":128028225,"text":"@chewedwire @tomheon Why are you making me curious about Haskell? I LIKE not knowing what monad means!!","id":30108808684503040,"from_user_id":1594784,"to_user":"chewedwire","geo":null,"iso_language_code":"en","to_user_id_str":"128028225","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"23750094","profile_image_url":"http://a0.twimg.com/profile_images/951373780/Moeinthecar_normal.jpg","created_at":"Wed, 26 Jan 2011 03:41:54 +0000","from_user":"shokalshab","id_str":"30108140443795456","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I'm at Magnitude Cheer @ Gymnastics Olympica USA (7735 Haskell Ave., btw Saticoy &amp; Strathern, Van Nuys) http://4sq.com/gmXfaL","id":30108140443795456,"from_user_id":23750094,"geo":null,"iso_language_code":"en","place":{"id":"4e4a2a2f86cb2946","type":"poi","full_name":"Gymnastics Olympica USA, Van Nuys"},"to_user_id_str":null,"source":"&lt;a href=&quot;http://foursquare.com&quot; rel=&quot;nofollow&quot;&gt;foursquare&lt;/a&gt;"},{"from_user_id_str":"8135112","profile_image_url":"http://a0.twimg.com/profile_images/1165240350/LIMITED_normal.jpg","created_at":"Wed, 26 Jan 2011 03:41:35 +0000","from_user":"Claricei","id_str":"30108059208515584","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @kristenmchugh22: @KeithOlbermann Ryan looks like Jughead w/o the hat. And sounds as mealy-mouthed as Eddie Haskell.","id":30108059208515584,"from_user_id":8135112,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"128028225","profile_image_url":"http://a1.twimg.com/profile_images/1224994593/Coding_Drunk_normal.jpg","created_at":"Wed, 26 Jan 2011 03:40:02 +0000","from_user":"chewedwire","id_str":"30107670367182848","metadata":{"result_type":"recent"},"to_user_id":177539201,"text":"@tomheon Cool, I'll take a look. I feel like I should mention this: http://bit.ly/hVstDM","id":30107670367182848,"from_user_id":128028225,"to_user":"tomheon","geo":null,"iso_language_code":"en","to_user_id_str":"177539201","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"8679778","profile_image_url":"http://a3.twimg.com/profile_images/1195318056/me_nyc_12_18_10_icon_normal.jpg","created_at":"Wed, 26 Jan 2011 03:38:42 +0000","from_user":"kristenmchugh22","id_str":"30107332381777920","metadata":{"result_type":"recent"},"to_user_id":756269,"text":"@KeithOlbermann Ryan looks like Jughead w/o the hat. And sounds as mealy-mouthed as Eddie Haskell.","id":30107332381777920,"from_user_id":8679778,"to_user":"KeithOlbermann","geo":null,"iso_language_code":"en","to_user_id_str":"756269","source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"103316559","profile_image_url":"http://a1.twimg.com/profile_images/1179458751/bc3beab4-d59d-4e78-b13b-50747986cfa2_normal.png","created_at":"Wed, 26 Jan 2011 03:36:15 +0000","from_user":"cityslikr","id_str":"30106719153557504","metadata":{"result_type":"recent"},"to_user_id":null,"text":"&quot;Social safety net into a hammock.&quot; So says Eddie Haskell with the GOP response. #SOTU","id":30106719153557504,"from_user_id":103316559,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://blackberry.com/twitter&quot; rel=&quot;nofollow&quot;&gt;Twitter for BlackBerry\u00ae&lt;/a&gt;"},{"from_user_id_str":"169063143","profile_image_url":"http://a0.twimg.com/profile_images/1160506212/9697_1_normal.gif","created_at":"Wed, 26 Jan 2011 03:31:52 +0000","from_user":"wrkforce_safety","id_str":"30105614919143424","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Federal investigation finds safety violations at The Acadia Hospital: By Meg Haskell, BDN Staff The investigatio... http://bit.ly/gA60C1","id":30105614919143424,"from_user_id":169063143,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"177539201","profile_image_url":"http://a0.twimg.com/profile_images/1178368800/img_normal.jpeg","created_at":"Wed, 26 Jan 2011 03:29:40 +0000","from_user":"tomheon","id_str":"30105060960632832","metadata":{"result_type":"recent"},"to_user_id":128028225,"text":"@chewedwire Great book on Haskell: http://oreilly.com/catalog/9780596514983","id":30105060960632832,"from_user_id":177539201,"to_user":"chewedwire","geo":null,"iso_language_code":"en","to_user_id_str":"128028225","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"782692","profile_image_url":"http://a0.twimg.com/profile_images/1031304589/Profile.2007.1_normal.jpg","created_at":"Wed, 26 Jan 2011 03:29:19 +0000","from_user":"turnageb","id_str":"30104974591533057","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @ovillalon: Paul Ryan solves the mystery of whatever happened to Eddie Haskell. #sotu","id":30104974591533057,"from_user_id":782692,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"128028225","profile_image_url":"http://a1.twimg.com/profile_images/1224994593/Coding_Drunk_normal.jpg","created_at":"Wed, 26 Jan 2011 03:28:04 +0000","from_user":"chewedwire","id_str":"30104657267265536","metadata":{"result_type":"recent"},"to_user_id":177539201,"text":"@tomheon I always loved the pattern matching in SML and it looks like Haskell is MUCH better at it. I'm messing around now at tryhaskell.org","id":30104657267265536,"from_user_id":128028225,"to_user":"tomheon","geo":null,"iso_language_code":"en","to_user_id_str":"177539201","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"12834082","profile_image_url":"http://a3.twimg.com/profile_images/1083036140/mugshot_normal.png","created_at":"Wed, 26 Jan 2011 03:28:01 +0000","from_user":"ovillalon","id_str":"30104647213518848","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Paul Ryan solves the mystery of whatever happened to Eddie Haskell. #sotu","id":30104647213518848,"from_user_id":12834082,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"13540930","profile_image_url":"http://a1.twimg.com/profile_images/1205312219/23467_350321383101_821143101_5114147_3010041_n_normal.jpg","created_at":"Wed, 26 Jan 2011 03:26:02 +0000","from_user":"goodfox","id_str":"30104146455560192","metadata":{"result_type":"recent"},"to_user_id":10226179,"text":"@billykeene22 Bordeaux is one of my heroes. I was so excited when he accepted the invitation to campus. He's been a great friend to Haskell.","id":30104146455560192,"from_user_id":13540930,"to_user":"billykeene22","geo":null,"iso_language_code":"en","to_user_id_str":"10226179","source":"&lt;a href=&quot;http://www.ubertwitter.com/bb/download.php&quot; rel=&quot;nofollow&quot;&gt;\u00dcberTwitter&lt;/a&gt;"},{"from_user_id_str":"18616016","profile_image_url":"http://a2.twimg.com/profile_images/1173522726/214397343_normal.jpg","created_at":"Wed, 26 Jan 2011 03:25:18 +0000","from_user":"josej30","id_str":"30103962313031681","metadata":{"result_type":"recent"},"to_user_id":14870909,"text":"@cris7ian Ahh bueno multiparadigma ya es respetable :) Empezar\u00e9 a explotar la parte funcional de los lenguajes ahora #Haskell","id":30103962313031681,"from_user_id":18616016,"to_user":"Cris7ian","geo":null,"iso_language_code":"es","to_user_id_str":"14870909","source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"14870909","profile_image_url":"http://a2.twimg.com/profile_images/1176930429/oso_yo_normal.png","created_at":"Wed, 26 Jan 2011 03:23:43 +0000","from_user":"Cris7ian","id_str":"30103562360983553","metadata":{"result_type":"recent"},"to_user_id":18616016,"text":"@josej30 hahaha no, es multiparadigma y es bastante lazy. Nothing like haskell, pero s\u00ed, el de Flash","id":30103562360983553,"from_user_id":14870909,"to_user":"josej30","geo":null,"iso_language_code":"es","to_user_id_str":"18616016","source":"&lt;a href=&quot;http://www.echofon.com/&quot; rel=&quot;nofollow&quot;&gt;Echofon&lt;/a&gt;"},{"from_user_id_str":"2421643","profile_image_url":"http://a0.twimg.com/profile_images/1190361665/ernestgrumbles-17_normal.jpg","created_at":"Wed, 26 Jan 2011 03:20:24 +0000","from_user":"ernestgrumbles","id_str":"30102730756333568","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Wow... WolframAlpha did not know who Eddie Haskell is. Guess I'll never use that &quot;knowledge engine&quot; again.","id":30102730756333568,"from_user_id":2421643,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"128028225","profile_image_url":"http://a1.twimg.com/profile_images/1224994593/Coding_Drunk_normal.jpg","created_at":"Wed, 26 Jan 2011 03:14:21 +0000","from_user":"chewedwire","id_str":"30101204428132352","metadata":{"result_type":"recent"},"to_user_id":177539201,"text":"@tomheon How is Haskell better/different from CL or Scheme? I honestly don't know, although I'm becoming more curious.","id":30101204428132352,"from_user_id":128028225,"to_user":"tomheon","geo":null,"iso_language_code":"en","to_user_id_str":"177539201","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"13540930","profile_image_url":"http://a1.twimg.com/profile_images/1205312219/23467_350321383101_821143101_5114147_3010041_n_normal.jpg","created_at":"Wed, 26 Jan 2011 03:06:54 +0000","from_user":"goodfox","id_str":"30099329809129473","metadata":{"result_type":"recent"},"to_user_id":null,"text":"A day of vision &amp; speeches. #SOTU now. And a wonderful Haskell Convocation address earlier today by Sinte Gleske President Lionel Bordeaux.","id":30099329809129473,"from_user_id":13540930,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.ubertwitter.com/bb/download.php&quot; rel=&quot;nofollow&quot;&gt;\u00dcberTwitter&lt;/a&gt;"},{"from_user_id_str":"119185220","profile_image_url":"http://a0.twimg.com/profile_images/1089027228/dfg_normal.jpg","created_at":"Wed, 26 Jan 2011 03:03:38 +0000","from_user":"LaLiciouz_03","id_str":"30098510623805440","metadata":{"result_type":"recent"},"to_user_id":null,"text":"The Game with the girl room 330 Haskell follow us...","id":30098510623805440,"from_user_id":119185220,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"18616016","profile_image_url":"http://a2.twimg.com/profile_images/1173522726/214397343_normal.jpg","created_at":"Wed, 26 Jan 2011 02:57:25 +0000","from_user":"josej30","id_str":"30096946144215040","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Voy a extra\u00f1ar Haskell cuando regrese al mundo imperativo. Hay alg\u00fan lenguaje imperativo que tenga este poder funcional? #ci3661","id":30096946144215040,"from_user_id":18616016,"geo":null,"iso_language_code":"es","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"17671137","profile_image_url":"http://a2.twimg.com/profile_images/290264834/Haskell-logo-outer-glow_normal.png","created_at":"Wed, 26 Jan 2011 02:55:32 +0000","from_user":"Hackage","id_str":"30096471814574080","metadata":{"result_type":"recent"},"to_user_id":null,"text":"comonad-transformers 0.9.0, added by EdwardKmett: Haskell 98 comonad transformers http://bit.ly/h6xIsf","id":30096471814574080,"from_user_id":17671137,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"177539201","profile_image_url":"http://a0.twimg.com/profile_images/1178368800/img_normal.jpeg","created_at":"Wed, 26 Jan 2011 02:48:12 +0000","from_user":"tomheon","id_str":"30094626920603649","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Every time I look at Haskell I love it more.","id":30094626920603649,"from_user_id":177539201,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"60792568","profile_image_url":"http://a0.twimg.com/profile_images/1203647517/glenda-flash_normal.jpg","created_at":"Wed, 26 Jan 2011 02:40:42 +0000","from_user":"r_takaishi","id_str":"30092735935422464","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell\u3088\u308aD\u8a00\u8a9e\u304c\u4e0a\u3068\u306f\u601d\u308f\u306a\u304b\u3063\u305f\uff0e http://www.tiobe.com/index.php/content/paperinfo/tpci/index.html","id":30092735935422464,"from_user_id":60792568,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twmode.sf.net/&quot; rel=&quot;nofollow&quot;&gt;twmode&lt;/a&gt;"},{"from_user_id_str":"160145510","profile_image_url":"http://a0.twimg.com/profile_images/1218108166/going_galt_normal.jpg","created_at":"Wed, 26 Jan 2011 02:39:31 +0000","from_user":"wtp1787","id_str":"30092439653974018","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @KLSouth: Eddie Haskell Goes to Washington... &quot;You look really nice tonight, Ms Cleaver&quot;","id":30092439653974018,"from_user_id":160145510,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"96616016","profile_image_url":"http://a1.twimg.com/profile_images/1196978169/Picture0002_normal.jpg","created_at":"Wed, 26 Jan 2011 02:39:20 +0000","from_user":"MelissaRNMBA","id_str":"30092392203816960","metadata":{"result_type":"recent"},"to_user_id":14862975,"text":"@KLSouth At least Eddie Haskell was entertaining.","id":30092392203816960,"from_user_id":96616016,"to_user":"KLSouth","geo":null,"iso_language_code":"en","to_user_id_str":"14862975","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"14862975","profile_image_url":"http://a0.twimg.com/profile_images/421596393/kls_4_normal.JPG","created_at":"Wed, 26 Jan 2011 02:38:29 +0000","from_user":"KLSouth","id_str":"30092178327871489","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Eddie Haskell Goes to Washington... &quot;You look really nice tonight, Ms Cleaver&quot;","id":30092178327871489,"from_user_id":14862975,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Wed, 26 Jan 2011 02:36:17 +0000","from_user":"listwarenet","id_str":"30091626869161984","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-beginners/84641-haskell-beginners-wildcards-in-expressions.html Haskell-beginners - Wild","id":30091626869161984,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"&lt;a href=&quot;http://1e10.org/cloud/&quot; rel=&quot;nofollow&quot;&gt;1e10&lt;/a&gt;"},{"from_user_id_str":"24538048","profile_image_url":"http://a2.twimg.com/profile_images/1117267605/rope_normal.jpg","created_at":"Wed, 26 Jan 2011 02:23:14 +0000","from_user":"dbph","id_str":"30088341030440960","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @dnene: Skilled Calisthenics. Haskell code that outputs python which spits ruby which emits the haskell source. http://j.mp/YlQUL via @mfeathers","id":30088341030440960,"from_user_id":24538048,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"158951567","profile_image_url":"http://a3.twimg.com/profile_images/962721419/Logo_3_normal.jpg","created_at":"Wed, 26 Jan 2011 01:58:31 +0000","from_user":"YubaVetTech","id_str":"30082124207886336","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Dr. Haskell has just been awarded the prestigious Hayward Award for \u2018Excellence in Education\u2019. This award honors... http://fb.me/QgQCxd74","id":30082124207886336,"from_user_id":158951567,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.facebook.com/twitter&quot; rel=&quot;nofollow&quot;&gt;Facebook&lt;/a&gt;"},{"from_user_id_str":"158951567","profile_image_url":"http://a3.twimg.com/profile_images/962721419/Logo_3_normal.jpg","created_at":"Wed, 26 Jan 2011 01:56:04 +0000","from_user":"YubaVetTech","id_str":"30081505476743168","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Dr. Haskell has just been awarded the prestigous Haward Award for Excellence in Education. This award honors... http://fb.me/PC9mYmCR","id":30081505476743168,"from_user_id":158951567,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.facebook.com/twitter&quot; rel=&quot;nofollow&quot;&gt;Facebook&lt;/a&gt;"},{"from_user_id_str":"2331498","profile_image_url":"http://a3.twimg.com/profile_images/494632120/me_normal.jpg","created_at":"Wed, 26 Jan 2011 01:43:50 +0000","from_user":"Verus","id_str":"30078427155406848","metadata":{"result_type":"recent"},"to_user_id":79273052,"text":"@kami_joe \u3044\u3084\uff0c\u8ab2\u984c\u306f\u89e3\u6c7a\u5bfe\u8c61(\u30d1\u30ba\u30eb\u3068\u304b)\u3092\u4e0e\u3048\u3089\u308c\u3066\uff0c\u554f\u984c\u5b9a\u7fa9\u3068\u30d7\u30ed\u30b0\u30e9\u30df\u30f3\u30b0(\u6307\u5b9a\u8a00\u8a9e\u306fC++\u3082\u3057\u304f\u306fJava)\u3068\u3044\u3046\u3044\u308f\u3070\u666e\u901a\u306a\u8ab2\u984c\u3067\u306f\u3042\u308b\u3093\u3060\u3051\u3069\uff0e\u95a2\u6570\u578b\u8a00\u8a9e\u306fHaskell\u306e\u6388\u696d\u304c\u307e\u305f\u5225\u306b\u3042\u308b\u306e\uff0e","id":30078427155406848,"from_user_id":2331498,"to_user":"kami_joe","geo":null,"iso_language_code":"ja","to_user_id_str":"79273052","source":"&lt;a href=&quot;http://itunes.apple.com/us/app/twitter/id409789998?mt=12&quot; rel=&quot;nofollow&quot;&gt;Twitter for Mac&lt;/a&gt;"},{"from_user_id_str":"79151233","profile_image_url":"http://a2.twimg.com/a/1295051201/images/default_profile_2_normal.png","created_at":"Wed, 26 Jan 2011 01:40:37 +0000","from_user":"cz_newdrafts","id_str":"30077617361125376","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell programming language http://bit.ly/gpPAwB","id":30077617361125376,"from_user_id":79151233,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"&lt;a href=&quot;http://tommorris.org/&quot; rel=&quot;nofollow&quot;&gt;tommorris' hacksample&lt;/a&gt;"},{"from_user_id_str":"2331498","profile_image_url":"http://a3.twimg.com/profile_images/494632120/me_normal.jpg","created_at":"Wed, 26 Jan 2011 01:02:57 +0000","from_user":"Verus","id_str":"30068139416879104","metadata":{"result_type":"recent"},"to_user_id":9252720,"text":"@shukukei Java\u3068C\u306f\u3042\u308b\u7a0b\u5ea6\u66f8\u3051\u3066\u3042\u305f\u308a\u307e\u3048\u306a\u3068\u3053\u308d\u304c\u3042\u308b\u304b\u3089\u306a\u30fc\uff0ePython\u306f\u500b\u4eba\u7684\u306b\u611f\u899a\u304c\u5408\u308f\u306a\u3044\uff0e\u611f\u899a\u306a\u306e\u3067\uff0c\u3082\u3046\u3069\u3046\u3057\u3088\u3046\u3082\u306a\u3044\uff57 \u3044\u307e\u306fScala\u3068Haskell\u3092\u3082\u3063\u3068\u6975\u3081\u305f\u3044\u3068\u3053\u308d\uff0e","id":30068139416879104,"from_user_id":2331498,"to_user":"shukukei","geo":null,"iso_language_code":"ja","to_user_id_str":"9252720","source":"&lt;a href=&quot;http://itunes.apple.com/us/app/twitter/id409789998?mt=12&quot; rel=&quot;nofollow&quot;&gt;Twitter for Mac&lt;/a&gt;"},{"from_user_id_str":"2781460","profile_image_url":"http://a0.twimg.com/profile_images/82526625/.joeyicon_normal.jpg","created_at":"Wed, 26 Jan 2011 01:02:35 +0000","from_user":"joeyhess","id_str":"30068046538219520","metadata":{"result_type":"recent"},"to_user_id":null,"text":"just figured out that I can use parameterized types to remove a dependency loop in git-annex's type definitions. whee #haskell","id":30068046538219520,"from_user_id":2781460,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://identi.ca&quot; rel=&quot;nofollow&quot;&gt;identica&lt;/a&gt;"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Wed, 26 Jan 2011 00:54:22 +0000","from_user":"listwarenet","id_str":"30065977920061440","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-beginners/84466-haskell-beginners-bytestring-question.html Haskell-beginners - Bytestrin","id":30065977920061440,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"&lt;a href=&quot;http://1e10.org/cloud/&quot; rel=&quot;nofollow&quot;&gt;1e10&lt;/a&gt;"},{"from_user_id_str":"1291845","profile_image_url":"http://a0.twimg.com/profile_images/1225743404/ThinOxygen-small-opaque-solidarity_normal.png","created_at":"Wed, 26 Jan 2011 00:52:07 +0000","from_user":"_aaron_","id_str":"30065412242669568","metadata":{"result_type":"recent"},"to_user_id":null,"text":"wanted: librly licensed high level native compiled lang with min runtime (otherwise cobra/mono would be perfect) for win. lua? haskell? ooc?","id":30065412242669568,"from_user_id":1291845,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"5912444","profile_image_url":"http://a2.twimg.com/profile_images/546261026/ssf0xg11_normal.jpg","created_at":"Wed, 26 Jan 2011 00:45:45 +0000","from_user":"shelarcy","id_str":"30063810773516288","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @Hackage: download 0.3.1.1, added by MagnusTherning: High-level file download based on URLs http://bit.ly/eHfiJB","id":30063810773516288,"from_user_id":5912444,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"135993","profile_image_url":"http://a2.twimg.com/profile_images/1190667086/myface2010small_normal.jpg","created_at":"Wed, 26 Jan 2011 00:41:00 +0000","from_user":"kudzu_naoki","id_str":"30062613287141376","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @tanakh: \u9b54\u6cd5Haskell\u5c11\u5973\u5019\u88dc\u3092\u63a2\u3059\u306e\u3082\u5927\u5909\u306a\u3093\u3060","id":30062613287141376,"from_user_id":135993,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.hootsuite.com&quot; rel=&quot;nofollow&quot;&gt;HootSuite&lt;/a&gt;"},{"from_user_id_str":"52620546","profile_image_url":"http://a1.twimg.com/profile_images/434693356/twitter-icon_normal.png","created_at":"Wed, 26 Jan 2011 00:40:25 +0000","from_user":"omasanori","id_str":"30062465656033280","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u9b54\u6cd5Haskell\u5c11\u5973\u306e\u4e00\u65e5\u306fGHC HEAD\u306e\u30d3\u30eb\u30c9\u304b\u3089\u59cb\u307e\u308b","id":30062465656033280,"from_user_id":52620546,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.movatwi.jp&quot; rel=&quot;nofollow&quot;&gt;www.movatwi.jp&lt;/a&gt;"},{"from_user_id_str":"52620546","profile_image_url":"http://a1.twimg.com/profile_images/434693356/twitter-icon_normal.png","created_at":"Wed, 26 Jan 2011 00:37:12 +0000","from_user":"omasanori","id_str":"30061656331526144","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @tanakh: \u50d5\u3068\u5951\u7d04\u3057\u3066\u9b54\u6cd5Haskell\u5c11\u5973\u306b\u306a\u308d\u3046\u3088\uff01","id":30061656331526144,"from_user_id":52620546,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.hootsuite.com&quot; rel=&quot;nofollow&quot;&gt;HootSuite&lt;/a&gt;"},{"from_user_id_str":"135993","profile_image_url":"http://a2.twimg.com/profile_images/1190667086/myface2010small_normal.jpg","created_at":"Wed, 26 Jan 2011 00:35:42 +0000","from_user":"kudzu_naoki","id_str":"30061282665168896","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @tanakh: \u50d5\u3068\u5951\u7d04\u3057\u3066\u9b54\u6cd5Haskell\u5c11\u5973\u306b\u306a\u308d\u3046\u3088\uff01","id":30061282665168896,"from_user_id":135993,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.hootsuite.com&quot; rel=&quot;nofollow&quot;&gt;HootSuite&lt;/a&gt;"},{"from_user_id_str":"1631333","profile_image_url":"http://a1.twimg.com/profile_images/81268862/profile300_normal.jpg","created_at":"Wed, 26 Jan 2011 00:30:02 +0000","from_user":"qnighy","id_str":"30059855884582913","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @tanakh: \u50d5\u3068\u5951\u7d04\u3057\u3066\u9b54\u6cd5Haskell\u5c11\u5973\u306b\u306a\u308d\u3046\u3088\uff01","id":30059855884582913,"from_user_id":1631333,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.hootsuite.com&quot; rel=&quot;nofollow&quot;&gt;HootSuite&lt;/a&gt;"},{"from_user_id_str":"9093754","profile_image_url":"http://a1.twimg.com/profile_images/99435906/PHD_3d_col_blk_normal.jpg","created_at":"Wed, 26 Jan 2011 00:26:20 +0000","from_user":"phdwine","id_str":"30058925516656640","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Last weekend of Tri Nations Tasting with PHD wines at Haskell Vineyards. Hope you didn't miss the Pinot Noir tasting last week !","id":30058925516656640,"from_user_id":9093754,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"2119923","profile_image_url":"http://a2.twimg.com/profile_images/1096701078/djayprofile_normal.jpg","created_at":"Wed, 26 Jan 2011 00:21:14 +0000","from_user":"djay75","id_str":"30057639543050240","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @dnene: Skilled Calisthenics. Haskell code that outputs python which spits ruby which emits the haskell source. http://j.mp/YlQUL via @mfeathers","id":30057639543050240,"from_user_id":2119923,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"134323731","profile_image_url":"http://a2.twimg.com/profile_images/1225818824/IMG00518-20110125-1547_normal.jpg","created_at":"Wed, 26 Jan 2011 00:19:30 +0000","from_user":"PrinceOfBrkeley","id_str":"30057205554216960","metadata":{"result_type":"recent"},"to_user_id":167093027,"text":"@PayThaPrince go to haskell.","id":30057205554216960,"from_user_id":134323731,"to_user":"PayThaPrince","geo":null,"iso_language_code":"en","to_user_id_str":"167093027","source":"&lt;a href=&quot;http://blackberry.com/twitter&quot; rel=&quot;nofollow&quot;&gt;Twitter for BlackBerry\u00ae&lt;/a&gt;"},{"from_user_id_str":"705857","profile_image_url":"http://a1.twimg.com/profile_images/429483912/ben_twitter_normal.jpg","created_at":"Wed, 26 Jan 2011 00:03:28 +0000","from_user":"bennadel","id_str":"30053166972141569","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Using #Homebrew to install Haskell - the last of the Seven Languages (in Seven Weeks) http://bit.ly/eA9Cv1 This has been some journey.","id":30053166972141569,"from_user_id":705857,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"251466","profile_image_url":"http://a2.twimg.com/profile_images/1194100934/pass_normal.jpg","created_at":"Wed, 26 Jan 2011 00:02:54 +0000","from_user":"simonszu","id_str":"30053025502466048","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Ouh yeah! Ich werde doch produktiv sein, diese Semesterferien. Ich werde funktional Programmieren lernen. #haskell, Baby.","id":30053025502466048,"from_user_id":251466,"geo":null,"iso_language_code":"de","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.echofon.com/&quot; rel=&quot;nofollow&quot;&gt;Echofon&lt;/a&gt;"},{"from_user_id_str":"357786","profile_image_url":"http://a0.twimg.com/profile_images/612044841/FM_2010_normal.jpg","created_at":"Tue, 25 Jan 2011 23:59:13 +0000","from_user":"diligiant","id_str":"30052100973006848","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @paulrbrown: &quot;...we only discovered a single bug after compilation.&quot; (http://t.co/K0wlEYz) #haskell","id":30052100973006848,"from_user_id":357786,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://itunes.apple.com/us/app/twitter/id409789998?mt=12&quot; rel=&quot;nofollow&quot;&gt;Twitter for Mac&lt;/a&gt;"},{"from_user_id_str":"101597523","profile_image_url":"http://a1.twimg.com/profile_images/1206183256/2010-12-12-204902_normal.jpg","created_at":"Tue, 25 Jan 2011 23:54:46 +0000","from_user":"wlad_kent","id_str":"30050977964892160","metadata":{"result_type":"recent"},"to_user_id":86297184,"text":"@Nilson_Neto Isso eh bem basico. quando vc estiver estudando recurs\u00e3o em Haskell, ai vc vai ver oq eh papo de nerd - kkk - 1\u00ba periodo isso.","id":30050977964892160,"from_user_id":101597523,"to_user":"Nilson_Neto","geo":null,"iso_language_code":"pt","to_user_id_str":"86297184","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Tue, 25 Jan 2011 23:51:22 +0000","from_user":"listwarenet","id_str":"30050123383832577","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-cafe/84336-haskell-cafe-monomorphic-let-bindings-and-darcs.html Haskell-cafe - Monomorph","id":30050123383832577,"from_user_id":144546280,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://1e10.org/cloud/&quot; rel=&quot;nofollow&quot;&gt;1e10&lt;/a&gt;"},{"from_user_id_str":"5776901","profile_image_url":"http://a0.twimg.com/profile_images/472682157/lucabw_normal.JPG","created_at":"Tue, 25 Jan 2011 23:48:40 +0000","from_user":"lsbardel","id_str":"30049446469312512","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Very interesting technology stack these guys use http://bit.ly/ghAjS7 #python #redis #haskell","id":30049446469312512,"from_user_id":5776901,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"3005901","profile_image_url":"http://a0.twimg.com/profile_images/278943006/Lone_Pine_Peak_-_Peter_200x200_normal.jpg","created_at":"Tue, 25 Jan 2011 23:45:48 +0000","from_user":"pmonks","id_str":"30048721110573056","metadata":{"result_type":"recent"},"to_user_id":203834278,"text":"@techielicous Haskell: http://bit.ly/gy3oFi ;-)","id":30048721110573056,"from_user_id":3005901,"to_user":"techielicous","geo":null,"iso_language_code":"en","to_user_id_str":"203834278","source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"162697074","profile_image_url":"http://a2.twimg.com/profile_images/826205838/ryan3_normal.jpg","created_at":"Tue, 25 Jan 2011 23:44:47 +0000","from_user":"TheRonaldMCD","id_str":"30048468781244416","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I'm at Aldi Food Market (4122 Gaston Ave, Haskell, Dallas) http://4sq.com/ekqRY7","id":30048468781244416,"from_user_id":162697074,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"&lt;a href=&quot;http://foursquare.com&quot; rel=&quot;nofollow&quot;&gt;foursquare&lt;/a&gt;"},{"from_user_id_str":"203834278","profile_image_url":"http://a0.twimg.com/profile_images/1223375080/me_normal.jpg","created_at":"Tue, 25 Jan 2011 23:44:04 +0000","from_user":"techielicous","id_str":"30048286589067264","metadata":{"result_type":"recent"},"to_user_id":3005901,"text":"@pmonks I was thinking Haskell or Scheme","id":30048286589067264,"from_user_id":203834278,"to_user":"pmonks","geo":null,"iso_language_code":"en","to_user_id_str":"3005901","source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"537690","profile_image_url":"http://a3.twimg.com/profile_images/45665122/nushiostamp_normal.jpg","created_at":"Tue, 25 Jan 2011 23:38:14 +0000","from_user":"nushio","id_str":"30046818658164737","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u305d\u3046\u3044\u3084\u5951\u7d04\u306b\u3088\u308b\u30d7\u30ed\u30b0\u30e9\u30df\u30f3\u30b0\u3068\u304b\u3042\u3063\u305f\u306a\u3002Haskell\u306a\u3093\u304b\u3088\u308a\u3042\u3063\u3061\u306e\u65b9\u304c\u9b54\u6cd5\u5c11\u5973\u547c\u3070\u308f\u308a\u306b\u3075\u3055\u308f\u3057\u3044\u3002","id":30046818658164737,"from_user_id":537690,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"181192","profile_image_url":"http://a2.twimg.com/profile_images/1089890701/q530888600_9828_normal.jpg","created_at":"Tue, 25 Jan 2011 23:38:03 +0000","from_user":"aodag","id_str":"30046772223016960","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @omasanori: \u300c\u3082\u3046\u4f55\u5e74\u3082Haskell\u306e\u3053\u3068\u3057\u304b\u8003\u3048\u3066\u306a\u304b\u3063\u305f\u304b\u3089\u306a\u3001\u30eb\u30fc\u30d7\u306e\u4f7f\u3044\u65b9\u5fd8\u308c\u3066\u305f\u300d","id":30046772223016960,"from_user_id":181192,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.movatwi.jp&quot; rel=&quot;nofollow&quot;&gt;www.movatwi.jp&lt;/a&gt;"},{"from_user_id_str":"5886055","profile_image_url":"http://a3.twimg.com/profile_images/85531669/ichi_normal.jpg","created_at":"Tue, 25 Jan 2011 23:37:53 +0000","from_user":"kanaya","id_str":"30046729243983873","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u9e97\u3057\u3044\u3002\u201c@omasanori: \u300c\u3082\u3046\u4f55\u5e74\u3082Haskell\u306e\u3053\u3068\u3057\u304b\u8003\u3048\u3066\u306a\u304b\u3063\u305f\u304b\u3089\u306a\u3001\u30eb\u30fc\u30d7\u306e\u4f7f\u3044\u65b9\u5fd8\u308c\u3066\u305f\u300d\u201d","id":30046729243983873,"from_user_id":5886055,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://itunes.apple.com/app/twitter/id333903271?mt=8&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPad&lt;/a&gt;"},{"from_user_id_str":"52620546","profile_image_url":"http://a1.twimg.com/profile_images/434693356/twitter-icon_normal.png","created_at":"Tue, 25 Jan 2011 23:36:26 +0000","from_user":"omasanori","id_str":"30046367187476481","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u300c\u3082\u3046\u4f55\u5e74\u3082Haskell\u306e\u3053\u3068\u3057\u304b\u8003\u3048\u3066\u306a\u304b\u3063\u305f\u304b\u3089\u306a\u3001\u30eb\u30fc\u30d7\u306e\u4f7f\u3044\u65b9\u5fd8\u308c\u3066\u305f\u300d","id":30046367187476481,"from_user_id":52620546,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.movatwi.jp&quot; rel=&quot;nofollow&quot;&gt;www.movatwi.jp&lt;/a&gt;"},{"from_user_id_str":"1659992","profile_image_url":"http://a1.twimg.com/profile_images/504488750/1_normal.jpg","created_at":"Tue, 25 Jan 2011 23:16:13 +0000","from_user":"finalfusion","id_str":"30041278544609280","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @necocen: Haskell\u306e\u30df\u30b5\u30ef\u3001\u3068\u3044\u3046\u3082\u306e\u3092\u8003\u3048\u3066\u307f\u3066\u3071\u3063\u3068\u3057\u306a\u3044","id":30041278544609280,"from_user_id":1659992,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"272513","profile_image_url":"http://a2.twimg.com/profile_images/320244078/Mike_Painting2_normal.png","created_at":"Tue, 25 Jan 2011 23:05:09 +0000","from_user":"mikehadlow","id_str":"30038492373319680","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Just written the same simple program in C#, F# and Haskell: 18, 12 and 9 LoC respectively. And I'm much better at C# than F# or Haskell.","id":30038492373319680,"from_user_id":272513,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"89393264","profile_image_url":"http://a0.twimg.com/profile_images/1169486472/020_portland_me_normal.jpg","created_at":"Tue, 25 Jan 2011 23:01:28 +0000","from_user":"newsportlandme","id_str":"30037564589084673","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Governor's Choice to Run Maine DOC Under Scrutiny - MPBN: State Rep. Anne Haskell, a Portland Democrat, says Mai... http://bit.ly/fO30gC","id":30037564589084673,"from_user_id":89393264,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"38138","profile_image_url":"http://a3.twimg.com/profile_images/1212565885/Screen_shot_2011-01-11_at_5.28.47_PM_normal.png","created_at":"Tue, 25 Jan 2011 22:59:55 +0000","from_user":"michaelneale","id_str":"30037174615281664","metadata":{"result_type":"recent"},"to_user_id":null,"text":"The haskell EvilMangler http://t.co/P2Tls7J","id":30037174615281664,"from_user_id":38138,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"&lt;a href=&quot;http://itunes.apple.com/us/app/twitter/id409789998?mt=12&quot; rel=&quot;nofollow&quot;&gt;Twitter for Mac&lt;/a&gt;"},{"from_user_id_str":"45692","profile_image_url":"http://a3.twimg.com/profile_images/1177741507/dogkarno_r_normal.jpg","created_at":"Tue, 25 Jan 2011 22:45:06 +0000","from_user":"karno","id_str":"30033448286552064","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell\u3063\u3066\u95a2\u6570\u306b\u30ab\u30ec\u30fc\u7c89\u3076\u3061\u8fbc\u3080\u3068\u304b\u306a\u3093\u3068\u304b","id":30033448286552064,"from_user_id":45692,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://yubitter.com/&quot; rel=&quot;nofollow&quot;&gt;yubitter&lt;/a&gt;"},{"from_user_id_str":"27605","profile_image_url":"http://a2.twimg.com/profile_images/15826632/meron_normal.jpg","created_at":"Tue, 25 Jan 2011 22:44:23 +0000","from_user":"celeron1ghz","id_str":"30033268761956352","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @necocen: Haskell\u306e\u30df\u30b5\u30ef\u3001\u3068\u3044\u3046\u3082\u306e\u3092\u8003\u3048\u3066\u307f\u3066\u3071\u3063\u3068\u3057\u306a\u3044","id":30033268761956352,"from_user_id":27605,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"12901","profile_image_url":"http://a1.twimg.com/profile_images/56091349/haruhi_nagato-Y_normal.jpg","created_at":"Tue, 25 Jan 2011 22:43:30 +0000","from_user":"necocen","id_str":"30033044035346432","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u307e\u3042Haskell\u77e5\u3089\u3093\u3057\u306d","id":30033044035346432,"from_user_id":12901,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"12901","profile_image_url":"http://a1.twimg.com/profile_images/56091349/haruhi_nagato-Y_normal.jpg","created_at":"Tue, 25 Jan 2011 22:42:54 +0000","from_user":"necocen","id_str":"30032894856531968","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell\u306e\u30df\u30b5\u30ef\u3001\u3068\u3044\u3046\u3082\u306e\u3092\u8003\u3048\u3066\u307f\u3066\u3071\u3063\u3068\u3057\u306a\u3044","id":30032894856531968,"from_user_id":12901,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"10821270","profile_image_url":"http://a0.twimg.com/profile_images/1195474259/Salto_Marlon_normal.jpg","created_at":"Tue, 25 Jan 2011 22:35:09 +0000","from_user":"jjedMoriAnktah","id_str":"30030942106025984","metadata":{"result_type":"recent"},"to_user_id":null,"text":"&quot;A Haskell program that outputs a Python program that outputs a Ruby program that outputs the original Haskell program&quot; http://is.gd/E6Julu","id":30030942106025984,"from_user_id":10821270,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"7554762","profile_image_url":"http://a0.twimg.com/profile_images/100515212/ajay-photo_normal.jpg","created_at":"Tue, 25 Jan 2011 22:34:30 +0000","from_user":"comatose_kid","id_str":"30030780205899776","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @bumptech: Bump Dev Blog - Why we use Haskell at Bump http://devblog.bu.mp/haskell-at-bump","id":30030780205899776,"from_user_id":7554762,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"148474705","profile_image_url":"http://a0.twimg.com/profile_images/1119234716/fur_hat_-_gilbeys_vodka_-_life_-_11-30-1962_normal.JPG","created_at":"Tue, 25 Jan 2011 22:29:19 +0000","from_user":"landmvintage","id_str":"30029476003840000","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @faerymoongodess: Magnificent Miriam Haskell Baroque Pearl Necklace by @MercyMadge http://etsy.me/hqRl51","id":30029476003840000,"from_user_id":148474705,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"37715508","profile_image_url":"http://a1.twimg.com/profile_images/1207891411/ballerina_normal.jpg","created_at":"Tue, 25 Jan 2011 22:24:52 +0000","from_user":"faerymoongodess","id_str":"30028356326002688","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Magnificent Miriam Haskell Baroque Pearl Necklace by @MercyMadge http://etsy.me/hqRl51","id":30028356326002688,"from_user_id":37715508,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"17671137","profile_image_url":"http://a2.twimg.com/profile_images/290264834/Haskell-logo-outer-glow_normal.png","created_at":"Tue, 25 Jan 2011 22:17:16 +0000","from_user":"Hackage","id_str":"30026442456694784","metadata":{"result_type":"recent"},"to_user_id":null,"text":"base16-bytestring 0.1.0.0, added by BryanOSullivan: Fast base16 (hex) encoding and deconding for ByteStrings http://bit.ly/eu75TN","id":30026442456694784,"from_user_id":17671137,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"199750997","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Tue, 25 Jan 2011 22:12:07 +0000","from_user":"benreads","id_str":"30025146991382528","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Writing Systems Software in a Functional Language -- brief, but fun. I want to see how well they can make Systems Haskell perform at scale.","id":30025146991382528,"from_user_id":199750997,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"35359797","profile_image_url":"http://a1.twimg.com/profile_images/1173453785/48893_521140819_1896062_q_normal.jpg","created_at":"Tue, 25 Jan 2011 22:09:45 +0000","from_user":"jcawthorne1","id_str":"30024549265309696","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Just saw Jeff Haskell give the middle finger!! Lol awesome","id":30024549265309696,"from_user_id":35359797,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"13540930","profile_image_url":"http://a1.twimg.com/profile_images/1205312219/23467_350321383101_821143101_5114147_3010041_n_normal.jpg","created_at":"Tue, 25 Jan 2011 22:06:44 +0000","from_user":"goodfox","id_str":"30023790381498369","metadata":{"result_type":"recent"},"to_user_id":null,"text":"At the Haskell Convocation. (@ Haskell Indian Nations U Auditorium) http://4sq.com/eKKXyn","id":30023790381498369,"from_user_id":13540930,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://foursquare.com&quot; rel=&quot;nofollow&quot;&gt;foursquare&lt;/a&gt;"},{"from_user_id_str":"14674418","profile_image_url":"http://a2.twimg.com/profile_images/238230125/IMG_1030-1_normal.jpg","created_at":"Tue, 25 Jan 2011 22:02:31 +0000","from_user":"sanityinc","id_str":"30022731919523840","metadata":{"result_type":"recent"},"to_user_id":371289,"text":"@xshay Haskell's great, but Clojure's similarly lazy in all the ways that matter, and is more practical for day-to-day use.","id":30022731919523840,"from_user_id":14674418,"to_user":"xshay","geo":null,"iso_language_code":"en","to_user_id_str":"371289","source":"&lt;a href=&quot;http://www.echofon.com/&quot; rel=&quot;nofollow&quot;&gt;Echofon&lt;/a&gt;"},{"from_user_id_str":"371289","profile_image_url":"http://a2.twimg.com/profile_images/1113482439/me-brisbane_normal.jpg","created_at":"Tue, 25 Jan 2011 21:58:29 +0000","from_user":"xshay","id_str":"30021714444292096","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Just made a lazy sequence of prime numbers in haskell. I'm smitten.","id":30021714444292096,"from_user_id":371289,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://itunes.apple.com/us/app/twitter/id409789998?mt=12&quot; rel=&quot;nofollow&quot;&gt;Twitter for Mac&lt;/a&gt;"},{"from_user_id_str":"199453873","profile_image_url":"http://a3.twimg.com/a/1294785484/images/default_profile_3_normal.png","created_at":"Tue, 25 Jan 2011 21:48:40 +0000","from_user":"stackfeed","id_str":"30019243982454784","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Practical Scala reference manual, for searching things like method names: Hello, \n\nInspired by\nHaskell API Searc... http://bit.ly/g4zWZQ","id":30019243982454784,"from_user_id":199453873,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"17489366","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Tue, 25 Jan 2011 21:45:32 +0000","from_user":"aapnoot","id_str":"30018455189065728","metadata":{"result_type":"recent"},"to_user_id":null,"text":"download 0.3.1, added by MagnusTherning: High-level file download based on URLs http://bit.ly/i8mYvi","id":30018455189065728,"from_user_id":17489366,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"17489366","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Tue, 25 Jan 2011 21:45:31 +0000","from_user":"aapnoot","id_str":"30018452601180160","metadata":{"result_type":"recent"},"to_user_id":null,"text":"download 0.3.1.1, added by MagnusTherning: High-level file download based on URLs http://bit.ly/eHfiJB","id":30018452601180160,"from_user_id":17489366,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"17671137","profile_image_url":"http://a2.twimg.com/profile_images/290264834/Haskell-logo-outer-glow_normal.png","created_at":"Tue, 25 Jan 2011 21:45:31 +0000","from_user":"Hackage","id_str":"30018451867176960","metadata":{"result_type":"recent"},"to_user_id":null,"text":"download 0.3.1, added by MagnusTherning: High-level file download based on URLs http://bit.ly/i8mYvi","id":30018451867176960,"from_user_id":17671137,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"138502705","profile_image_url":"http://a1.twimg.com/profile_images/1083845614/yclogo_normal.gif","created_at":"Tue, 25 Jan 2011 21:45:04 +0000","from_user":"newsyc100","id_str":"30018340839755777","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell improves log processing 4x over Python http://devblog.bu.mp/haskell-at-bump (http://bit.ly/gQxxR8)","id":30018340839755777,"from_user_id":138502705,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://news.ycombinator.com&quot; rel=&quot;nofollow&quot;&gt;newsyc&lt;/a&gt;"},{"from_user_id_str":"1578246","profile_image_url":"http://a0.twimg.com/profile_images/59312315/avatar_simpson_small_normal.jpg","created_at":"Tue, 25 Jan 2011 21:43:32 +0000","from_user":"magthe","id_str":"30017953801969665","metadata":{"result_type":"recent"},"to_user_id":null,"text":"New version of download uploaded to #hackage #haskell","id":30017953801969665,"from_user_id":1578246,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://api.supertweet.net&quot; rel=&quot;nofollow&quot;&gt;MyAuth API Proxy&lt;/a&gt;"},{"from_user_id_str":"135838970","profile_image_url":"http://a2.twimg.com/profile_images/1079929891/logo_normal.png","created_at":"Tue, 25 Jan 2011 21:37:51 +0000","from_user":"reward999","id_str":"30016525180084224","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Found Great Dane (Main &amp; Haskell- Dallas): We found a great dane. 214-712-0000 http://bit.ly/fQ8iBw","id":30016525180084224,"from_user_id":135838970,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"137719265","profile_image_url":"http://a2.twimg.com/profile_images/1092224079/8__4__normal.jpg","created_at":"Tue, 25 Jan 2011 21:34:22 +0000","from_user":"WeiMatas","id_str":"30015646020411392","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Fourth day Rez party Eddie Haskell County in second life \u2013 which took place in cabaret Tadd","id":30015646020411392,"from_user_id":137719265,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://dlvr.it&quot; rel=&quot;nofollow&quot;&gt;dlvr.it&lt;/a&gt;"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Tue, 25 Jan 2011 21:33:21 +0000","from_user":"listwarenet","id_str":"30015392571195392","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-cafe/83889-haskell-cafe-gpl-license-of-h-matrix-and-prelude-numeric.html Haskell-cafe -","id":30015392571195392,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"&lt;a href=&quot;http://1e10.org/cloud/&quot; rel=&quot;nofollow&quot;&gt;1e10&lt;/a&gt;"}],"max_id":30121530767708160,"since_id":0,"refresh_url":"?since_id=30121530767708160&q=haskell","next_page":"?page=2&max_id=30121530767708160&rpp=100&q=haskell","results_per_page":100,"page":1,"completed_in":1.195569,"since_id_str":"0","max_id_str":"30121530767708160","query":"haskell"}
benchmarks/json-data/twitter20.jsonnew file+1
@@ -0,0 +1 @@
1+{"results":[{"from_user_id_str":"166199691","profile_image_url":"http://a2.twimg.com/profile_images/1252958188/38_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:26 +0000","from_user":"_classicc","id_str":"41191052790603776","metadata":{"result_type":"recent"},"to_user_id":null,"text":"my twitter is actin slow today.","id":41191052790603776,"from_user_id":166199691,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"138835410","profile_image_url":"http://a1.twimg.com/profile_images/1250985094/243321801_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:26 +0000","from_user":"amereronday","id_str":"41191050307567616","metadata":{"result_type":"recent"},"to_user_id":null,"text":"twitter jail, here i come.","id":41191050307567616,"from_user_id":138835410,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"359548","profile_image_url":"http://a2.twimg.com/profile_images/53612334/don_otvos_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:26 +0000","from_user":"donnyo","id_str":"41191050110451712","metadata":{"result_type":"recent"},"to_user_id":7074534,"text":"@stlsmallbiz I see there is currently a Twitter promo too....tempting....","id":41191050110451712,"from_user_id":359548,"to_user":"stlsmallbiz","geo":null,"iso_language_code":"en","place":{"id":"82b7b2f97b12261d","type":"poi","full_name":"Yammer Inc, San Francisco"},"to_user_id_str":"7074534","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"122523770","profile_image_url":"http://a0.twimg.com/profile_images/1073533262/11646_1076222405045_1810798478_156114_3663737_n_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:26 +0000","from_user":"msBreChan","id_str":"41191049720238080","metadata":{"result_type":"recent"},"to_user_id":null,"text":"so twitter gt spam now -_-","id":41191049720238080,"from_user_id":122523770,"geo":{"type":"Point","coordinates":[35.2213,-80.8276]},"iso_language_code":"en","place":{"id":"4d5ed95f830e9b41","type":"neighborhood","full_name":"Elizabeth, Charlotte"},"to_user_id_str":null,"source":"&lt;a href=&quot;http://mobile.twitter.com&quot; rel=&quot;nofollow&quot;&gt;Twitter for Android&lt;/a&gt;"},{"from_user_id_str":"229024950","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_6_normal.png","created_at":"Fri, 25 Feb 2011 17:41:25 +0000","from_user":"NinaMaechik","id_str":"41191047853912064","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Glad I can remember my twitter password! LOL! Hugs to Nick from his aunties...","id":41191047853912064,"from_user_id":229024950,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"215545822","profile_image_url":"http://a2.twimg.com/profile_images/1239909540/RTL_normal.png","created_at":"Fri, 25 Feb 2011 17:41:25 +0000","from_user":"RightToLaugh","id_str":"41191047371558912","metadata":{"result_type":"recent"},"to_user_id":null,"text":"#Bacon wrapped dates http://bit.ly/hUxVC9 Just like my grandma used to make http://twitter.com/#","id":41191047371558912,"from_user_id":215545822,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"217845526","profile_image_url":"http://a0.twimg.com/sticky/default_profile_images/default_profile_3_normal.png","created_at":"Fri, 25 Feb 2011 17:41:25 +0000","from_user":"TheShoeLooker","id_str":"41191047052804096","metadata":{"result_type":"recent"},"to_user_id":38033240,"text":"@ShoeDazzle love love love to twitter or blog about your deals and shoes!\ntheshoelooker.blogspot.com","id":41191047052804096,"from_user_id":217845526,"to_user":"shoedazzle","geo":null,"iso_language_code":"en","to_user_id_str":"38033240","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"24953438","profile_image_url":"http://a3.twimg.com/profile_images/1181252763/76820_10150100014748783_677998782_7386695_4377006_n_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:25 +0000","from_user":"liljermaine32","id_str":"41191046025056256","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Twitter fam I gotta question 4 ya is texas south or midwest #arguments","id":41191046025056256,"from_user_id":24953438,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://mobile.twitter.com&quot; rel=&quot;nofollow&quot;&gt;Twitter for Android&lt;/a&gt;"},{"from_user_id_str":"122451024","profile_image_url":"http://a2.twimg.com/profile_images/1143400129/100706-ETCanada_201134_1__normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:25 +0000","from_user":"Kim_DEon","id_str":"41191045161164801","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Help @CARE @EvaLongoria and ME use Twitter to change the lives of girls in poverty across the world! Ready? Go to http://TwitChange.com NOW!","id":41191045161164801,"from_user_id":122451024,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"128351479","profile_image_url":"http://a3.twimg.com/profile_images/1150198829/Kirby_Photo__edit__normal.JPG","created_at":"Fri, 25 Feb 2011 17:41:24 +0000","from_user":"TheDaveKirby","id_str":"41191043894493184","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Maybe its time to clean house...MY HOUSE http://bit.ly/ejG22P","id":41191043894493184,"from_user_id":128351479,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"87512773","profile_image_url":"http://a0.twimg.com/profile_images/1252511106/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:24 +0000","from_user":"supportthehood","id_str":"41191043206610946","metadata":{"result_type":"recent"},"to_user_id":2467330,"text":"@eastcoastmp3 #FF it's the way twitter works !!!","id":41191043206610946,"from_user_id":87512773,"to_user":"eastcoastmp3","geo":null,"iso_language_code":"en","to_user_id_str":"2467330","source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"149894545","profile_image_url":"http://a0.twimg.com/profile_images/1219334400/patrick_camo_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:24 +0000","from_user":"suburbpat","id_str":"41191040912330752","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I havent had a rib session on twitter in a while.......I wanna Rib with a nigga with alot followers lol","id":41191040912330752,"from_user_id":149894545,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"97749622","profile_image_url":"http://a0.twimg.com/profile_images/1254640781/IMG1633A_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:24 +0000","from_user":"jrricardosantos","id_str":"41191040547430400","metadata":{"result_type":"recent"},"to_user_id":101017476,"text":"@yofzs pq tirou o CAPS LOCK? kkkk tava bem legal...hehehe eu estou no t\u00e9dio...kkk tbm estou no twitter e msn..aff!!","id":41191040547430400,"from_user_id":97749622,"to_user":"yofzs","geo":null,"iso_language_code":"en","to_user_id_str":"101017476","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"94381536","profile_image_url":"http://a1.twimg.com/profile_images/1174777929/41509_100001699300415_3521888_n_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:23 +0000","from_user":"DonNieves","id_str":"41191038978752512","metadata":{"result_type":"recent"},"to_user_id":151926400,"text":"@TiiH13 cheira meu ovo, no email, no orkut, no msn, no facebook, no twitter, no skype, no spark, no ICQ e no google talk","id":41191038978752512,"from_user_id":94381536,"to_user":"TiiH13","geo":null,"iso_language_code":"en","to_user_id_str":"151926400","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"211858432","profile_image_url":"http://a3.twimg.com/profile_images/1231906180/JonasBrothers_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:23 +0000","from_user":"OriginalJBfans","id_str":"41191038328651776","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I literally forgot about this twitter... so whats occuring followers?","id":41191038328651776,"from_user_id":211858432,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"90317132","profile_image_url":"http://a3.twimg.com/profile_images/1230085056/254101635_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:23 +0000","from_user":"Just2smooth","id_str":"41191036936126464","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Wassup twitter","id":41191036936126464,"from_user_id":90317132,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://ubersocial.com&quot; rel=&quot;nofollow&quot;&gt;\u00dcberSocial&lt;/a&gt;"},{"from_user_id_str":"144771504","profile_image_url":"http://a1.twimg.com/profile_images/1243343836/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:23 +0000","from_user":"ima_b_b_badman","id_str":"41191036638339072","metadata":{"result_type":"recent"},"to_user_id":null,"text":"i been M.I.A. all day twitter my bad","id":41191036638339072,"from_user_id":144771504,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"207922664","profile_image_url":"http://a2.twimg.com/profile_images/1237106108/258356167_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:22 +0000","from_user":"itsthecarter_","id_str":"41191036013391873","metadata":{"result_type":"recent"},"to_user_id":null,"text":"twitter is a stupid addiction.","id":41191036013391873,"from_user_id":207922664,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://ubersocial.com&quot; rel=&quot;nofollow&quot;&gt;\u00dcberSocial&lt;/a&gt;"},{"from_user_id_str":"150000649","profile_image_url":"http://a0.twimg.com/profile_images/1237789059/belllaa_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:22 +0000","from_user":"angelicabrvo","id_str":"41191035707207680","metadata":{"result_type":"recent"},"to_user_id":null,"text":"que hubo twitter? huy que feoxd","id":41191035707207680,"from_user_id":150000649,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://blackberry.com/twitter&quot; rel=&quot;nofollow&quot;&gt;Twitter for BlackBerry\u00ae&lt;/a&gt;"},{"from_user_id_str":"185713003","profile_image_url":"http://a2.twimg.com/profile_images/1191421540/163229_177015295661467_154687431227587_492170_2147500_n_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:22 +0000","from_user":"downbytheshores","id_str":"41191033945595905","metadata":{"result_type":"recent"},"to_user_id":null,"text":"follow us on twitter\nwww.twitter.com/downbytheshores http://fb.me/DhDS915e","id":41191033945595905,"from_user_id":185713003,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.facebook.com/twitter&quot; rel=&quot;nofollow&quot;&gt;Facebook&lt;/a&gt;"}],"max_id":41191052790603776,"since_id":38643906774044672,"refresh_url":"?since_id=41191052790603776&q=twitter","next_page":"?page=2&max_id=41191052790603776&rpp=20&lang=en&q=twitter","results_per_page":20,"page":1,"completed_in":0.128719,"warning":"adjusted since_id to 38643906774044672 (), requested since_id was older than allowed -- since_id removed for pagination.","since_id_str":"38643906774044672","max_id_str":"41191052790603776","query":"twitter"}
benchmarks/json-data/twitter50.jsonnew file+1
@@ -0,0 +1 @@
1+{"results":[{"from_user_id_str":"207858021","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Wed, 26 Jan 2011 04:30:38 +0000","from_user":"pboudarga","id_str":"30120402839666689","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I'm at Rolla Sushi Grill (27737 Bouquet Canyon Road, #106, Btw Haskell Canyon and Rosedell Drive, Saugus) http://4sq.com/gqqdhs","id":30120402839666689,"from_user_id":207858021,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://foursquare.com&quot; rel=&quot;nofollow&quot;&gt;foursquare&lt;/a&gt;"},{"from_user_id_str":"69988683","profile_image_url":"http://a0.twimg.com/profile_images/1211955817/avatar_7888_normal.gif","created_at":"Wed, 26 Jan 2011 04:25:23 +0000","from_user":"YNK33","id_str":"30119083059978240","metadata":{"result_type":"recent"},"to_user_id":null,"text":"hsndfile 0.5.0: Free and open source Haskell bindings for libsndfile http://bit.ly/gHaBWG Mac Os","id":30119083059978240,"from_user_id":69988683,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"81492","profile_image_url":"http://a1.twimg.com/profile_images/423894208/Picture_7_normal.jpg","created_at":"Wed, 26 Jan 2011 04:24:28 +0000","from_user":"satzz","id_str":"30118851488251904","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Emacs\u306e\u30e2\u30fc\u30c9\u8868\u793a\u304c\u4eca(Ruby Controller Outputz RoR Flymake REl hs)\u3068\u306a\u3063\u3066\u3066\u3088\u304f\u308f\u304b\u3089\u306a\u3044\u3093\u3060\u3051\u3069\u6700\u5f8c\u306eREl\u3068\u304bhs\u3063\u3066\u4f55\u3060\u308d\u3046\u2026haskell\u3068\u304b2\u5e74\u4ee5\u4e0a\u66f8\u3044\u3066\u306a\u3044\u3051\u3069\u2026","id":30118851488251904,"from_user_id":81492,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.hootsuite.com&quot; rel=&quot;nofollow&quot;&gt;HootSuite&lt;/a&gt;"},{"from_user_id_str":"9518356","profile_image_url":"http://a2.twimg.com/profile_images/119165723/ocaml-icon_normal.png","created_at":"Wed, 26 Jan 2011 04:19:19 +0000","from_user":"planet_ocaml","id_str":"30117557788741632","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I so miss #haskell type classes in #ocaml - i want to do something like refinement. Also why does ocaml not have... http://bit.ly/geYRwt","id":30117557788741632,"from_user_id":9518356,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"218059","profile_image_url":"http://a1.twimg.com/profile_images/1053837723/twitter-icon9_normal.jpg","created_at":"Wed, 26 Jan 2011 04:16:32 +0000","from_user":"aprikip","id_str":"30116854940835840","metadata":{"result_type":"recent"},"to_user_id":null,"text":"yatex-mode\u3084haskell-mode\u306e\u3053\u3068\u3067\u3059\u306d\u3001\u308f\u304b\u308a\u307e\u3059\u3002","id":30116854940835840,"from_user_id":218059,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://sites.google.com/site/yorufukurou/&quot; rel=&quot;nofollow&quot;&gt;YoruFukurou&lt;/a&gt;"},{"from_user_id_str":"216363","profile_image_url":"http://a1.twimg.com/profile_images/72454310/Tim-Avatar_normal.png","created_at":"Wed, 26 Jan 2011 04:15:30 +0000","from_user":"dysinger","id_str":"30116594684264448","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell in Hawaii tonight for me... #fun","id":30116594684264448,"from_user_id":216363,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.nambu.com/&quot; rel=&quot;nofollow&quot;&gt;Nambu&lt;/a&gt;"},{"from_user_id_str":"1774820","profile_image_url":"http://a2.twimg.com/profile_images/61169291/dan_desert_thumb_normal.jpg","created_at":"Wed, 26 Jan 2011 04:13:36 +0000","from_user":"DanMil","id_str":"30116117682851840","metadata":{"result_type":"recent"},"to_user_id":1594784,"text":"@ojrac @chewedwire @tomheon Haskell isn't a language, it's a belief system. A seductive one...","id":30116117682851840,"from_user_id":1774820,"to_user":"ojrac","geo":null,"iso_language_code":"en","to_user_id_str":"1594784","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"659256","profile_image_url":"http://a0.twimg.com/profile_images/746976711/angular-final_normal.jpg","created_at":"Wed, 26 Jan 2011 04:11:06 +0000","from_user":"djspiewak","id_str":"30115488931520512","metadata":{"result_type":"recent"},"to_user_id":null,"text":"One of the very nice things about Haskell as opposed to SML is the reduced proliferation of identifiers (e.g. andb, orb, etc). #typeclasses","id":30115488931520512,"from_user_id":659256,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://itunes.apple.com/us/app/twitter/id409789998?mt=12&quot; rel=&quot;nofollow&quot;&gt;Twitter for Mac&lt;/a&gt;"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Wed, 26 Jan 2011 04:06:12 +0000","from_user":"listwarenet","id_str":"30114255890026496","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-cafe/84752-re-haskell-cafe-gpl-license-of-h-matrix-and-prelude-numeric.html Re: Haskell-c","id":30114255890026496,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"&lt;a href=&quot;http://1e10.org/cloud/&quot; rel=&quot;nofollow&quot;&gt;1e10&lt;/a&gt;"},{"from_user_id_str":"1594784","profile_image_url":"http://a2.twimg.com/profile_images/378515773/square-profile_normal.jpg","created_at":"Wed, 26 Jan 2011 04:01:29 +0000","from_user":"ojrac","id_str":"30113067333324800","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @tomheon: @ojrac @chewedwire Don't worry, learning Haskell will not give you any clear idea what monad means.","id":30113067333324800,"from_user_id":1594784,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"207589736","profile_image_url":"http://a3.twimg.com/profile_images/1225527428/headshot_1_normal.jpg","created_at":"Wed, 26 Jan 2011 04:00:13 +0000","from_user":"ashleevelazq101","id_str":"30112747555397632","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Federal investigation finds safety violations at The Acadia Hospital: By Meg Haskell, BDN Staff The investigatio... http://bit.ly/dONnpn","id":30112747555397632,"from_user_id":207589736,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"17671137","profile_image_url":"http://a2.twimg.com/profile_images/290264834/Haskell-logo-outer-glow_normal.png","created_at":"Wed, 26 Jan 2011 03:58:00 +0000","from_user":"Hackage","id_str":"30112192346984448","metadata":{"result_type":"recent"},"to_user_id":null,"text":"streams 0.4, added by EdwardKmett: Various Haskell 2010 stream comonads http://bit.ly/idBkPe","id":30112192346984448,"from_user_id":17671137,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"17489366","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Wed, 26 Jan 2011 03:58:00 +0000","from_user":"aapnoot","id_str":"30112191881420800","metadata":{"result_type":"recent"},"to_user_id":null,"text":"streams 0.4, added by EdwardKmett: Various Haskell 2010 stream comonads http://bit.ly/idBkPe","id":30112191881420800,"from_user_id":17489366,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"8530482","profile_image_url":"http://a2.twimg.com/profile_images/137867266/n608671563_7396_normal.jpg","created_at":"Wed, 26 Jan 2011 03:50:12 +0000","from_user":"jeffmclamb","id_str":"30110229207187456","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Angel - daemon to run and monitor processes like daemontools or god, written in Haskell http://ff.im/-wNyLk","id":30110229207187456,"from_user_id":8530482,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://friendfeed.com&quot; rel=&quot;nofollow&quot;&gt;FriendFeed&lt;/a&gt;"},{"from_user_id_str":"177539201","profile_image_url":"http://a0.twimg.com/profile_images/1178368800/img_normal.jpeg","created_at":"Wed, 26 Jan 2011 03:46:01 +0000","from_user":"tomheon","id_str":"30109174645919744","metadata":{"result_type":"recent"},"to_user_id":1594784,"text":"@ojrac @chewedwire Don't worry, learning Haskell will not give you any clear idea what monad means.","id":30109174645919744,"from_user_id":177539201,"to_user":"ojrac","geo":null,"iso_language_code":"en","to_user_id_str":"1594784","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"1594784","profile_image_url":"http://a2.twimg.com/profile_images/378515773/square-profile_normal.jpg","created_at":"Wed, 26 Jan 2011 03:44:34 +0000","from_user":"ojrac","id_str":"30108808684503040","metadata":{"result_type":"recent"},"to_user_id":128028225,"text":"@chewedwire @tomheon Why are you making me curious about Haskell? I LIKE not knowing what monad means!!","id":30108808684503040,"from_user_id":1594784,"to_user":"chewedwire","geo":null,"iso_language_code":"en","to_user_id_str":"128028225","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"23750094","profile_image_url":"http://a0.twimg.com/profile_images/951373780/Moeinthecar_normal.jpg","created_at":"Wed, 26 Jan 2011 03:41:54 +0000","from_user":"shokalshab","id_str":"30108140443795456","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I'm at Magnitude Cheer @ Gymnastics Olympica USA (7735 Haskell Ave., btw Saticoy &amp; Strathern, Van Nuys) http://4sq.com/gmXfaL","id":30108140443795456,"from_user_id":23750094,"geo":null,"iso_language_code":"en","place":{"id":"4e4a2a2f86cb2946","type":"poi","full_name":"Gymnastics Olympica USA, Van Nuys"},"to_user_id_str":null,"source":"&lt;a href=&quot;http://foursquare.com&quot; rel=&quot;nofollow&quot;&gt;foursquare&lt;/a&gt;"},{"from_user_id_str":"8135112","profile_image_url":"http://a0.twimg.com/profile_images/1165240350/LIMITED_normal.jpg","created_at":"Wed, 26 Jan 2011 03:41:35 +0000","from_user":"Claricei","id_str":"30108059208515584","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @kristenmchugh22: @KeithOlbermann Ryan looks like Jughead w/o the hat. And sounds as mealy-mouthed as Eddie Haskell.","id":30108059208515584,"from_user_id":8135112,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"128028225","profile_image_url":"http://a1.twimg.com/profile_images/1224994593/Coding_Drunk_normal.jpg","created_at":"Wed, 26 Jan 2011 03:40:02 +0000","from_user":"chewedwire","id_str":"30107670367182848","metadata":{"result_type":"recent"},"to_user_id":177539201,"text":"@tomheon Cool, I'll take a look. I feel like I should mention this: http://bit.ly/hVstDM","id":30107670367182848,"from_user_id":128028225,"to_user":"tomheon","geo":null,"iso_language_code":"en","to_user_id_str":"177539201","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"8679778","profile_image_url":"http://a3.twimg.com/profile_images/1195318056/me_nyc_12_18_10_icon_normal.jpg","created_at":"Wed, 26 Jan 2011 03:38:42 +0000","from_user":"kristenmchugh22","id_str":"30107332381777920","metadata":{"result_type":"recent"},"to_user_id":756269,"text":"@KeithOlbermann Ryan looks like Jughead w/o the hat. And sounds as mealy-mouthed as Eddie Haskell.","id":30107332381777920,"from_user_id":8679778,"to_user":"KeithOlbermann","geo":null,"iso_language_code":"en","to_user_id_str":"756269","source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"103316559","profile_image_url":"http://a1.twimg.com/profile_images/1179458751/bc3beab4-d59d-4e78-b13b-50747986cfa2_normal.png","created_at":"Wed, 26 Jan 2011 03:36:15 +0000","from_user":"cityslikr","id_str":"30106719153557504","metadata":{"result_type":"recent"},"to_user_id":null,"text":"&quot;Social safety net into a hammock.&quot; So says Eddie Haskell with the GOP response. #SOTU","id":30106719153557504,"from_user_id":103316559,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://blackberry.com/twitter&quot; rel=&quot;nofollow&quot;&gt;Twitter for BlackBerry\u00ae&lt;/a&gt;"},{"from_user_id_str":"169063143","profile_image_url":"http://a0.twimg.com/profile_images/1160506212/9697_1_normal.gif","created_at":"Wed, 26 Jan 2011 03:31:52 +0000","from_user":"wrkforce_safety","id_str":"30105614919143424","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Federal investigation finds safety violations at The Acadia Hospital: By Meg Haskell, BDN Staff The investigatio... http://bit.ly/gA60C1","id":30105614919143424,"from_user_id":169063143,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"177539201","profile_image_url":"http://a0.twimg.com/profile_images/1178368800/img_normal.jpeg","created_at":"Wed, 26 Jan 2011 03:29:40 +0000","from_user":"tomheon","id_str":"30105060960632832","metadata":{"result_type":"recent"},"to_user_id":128028225,"text":"@chewedwire Great book on Haskell: http://oreilly.com/catalog/9780596514983","id":30105060960632832,"from_user_id":177539201,"to_user":"chewedwire","geo":null,"iso_language_code":"en","to_user_id_str":"128028225","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"782692","profile_image_url":"http://a0.twimg.com/profile_images/1031304589/Profile.2007.1_normal.jpg","created_at":"Wed, 26 Jan 2011 03:29:19 +0000","from_user":"turnageb","id_str":"30104974591533057","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @ovillalon: Paul Ryan solves the mystery of whatever happened to Eddie Haskell. #sotu","id":30104974591533057,"from_user_id":782692,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"128028225","profile_image_url":"http://a1.twimg.com/profile_images/1224994593/Coding_Drunk_normal.jpg","created_at":"Wed, 26 Jan 2011 03:28:04 +0000","from_user":"chewedwire","id_str":"30104657267265536","metadata":{"result_type":"recent"},"to_user_id":177539201,"text":"@tomheon I always loved the pattern matching in SML and it looks like Haskell is MUCH better at it. I'm messing around now at tryhaskell.org","id":30104657267265536,"from_user_id":128028225,"to_user":"tomheon","geo":null,"iso_language_code":"en","to_user_id_str":"177539201","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"12834082","profile_image_url":"http://a3.twimg.com/profile_images/1083036140/mugshot_normal.png","created_at":"Wed, 26 Jan 2011 03:28:01 +0000","from_user":"ovillalon","id_str":"30104647213518848","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Paul Ryan solves the mystery of whatever happened to Eddie Haskell. #sotu","id":30104647213518848,"from_user_id":12834082,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"13540930","profile_image_url":"http://a1.twimg.com/profile_images/1205312219/23467_350321383101_821143101_5114147_3010041_n_normal.jpg","created_at":"Wed, 26 Jan 2011 03:26:02 +0000","from_user":"goodfox","id_str":"30104146455560192","metadata":{"result_type":"recent"},"to_user_id":10226179,"text":"@billykeene22 Bordeaux is one of my heroes. I was so excited when he accepted the invitation to campus. He's been a great friend to Haskell.","id":30104146455560192,"from_user_id":13540930,"to_user":"billykeene22","geo":null,"iso_language_code":"en","to_user_id_str":"10226179","source":"&lt;a href=&quot;http://www.ubertwitter.com/bb/download.php&quot; rel=&quot;nofollow&quot;&gt;\u00dcberTwitter&lt;/a&gt;"},{"from_user_id_str":"18616016","profile_image_url":"http://a2.twimg.com/profile_images/1173522726/214397343_normal.jpg","created_at":"Wed, 26 Jan 2011 03:25:18 +0000","from_user":"josej30","id_str":"30103962313031681","metadata":{"result_type":"recent"},"to_user_id":14870909,"text":"@cris7ian Ahh bueno multiparadigma ya es respetable :) Empezar\u00e9 a explotar la parte funcional de los lenguajes ahora #Haskell","id":30103962313031681,"from_user_id":18616016,"to_user":"Cris7ian","geo":null,"iso_language_code":"es","to_user_id_str":"14870909","source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"14870909","profile_image_url":"http://a2.twimg.com/profile_images/1176930429/oso_yo_normal.png","created_at":"Wed, 26 Jan 2011 03:23:43 +0000","from_user":"Cris7ian","id_str":"30103562360983553","metadata":{"result_type":"recent"},"to_user_id":18616016,"text":"@josej30 hahaha no, es multiparadigma y es bastante lazy. Nothing like haskell, pero s\u00ed, el de Flash","id":30103562360983553,"from_user_id":14870909,"to_user":"josej30","geo":null,"iso_language_code":"es","to_user_id_str":"18616016","source":"&lt;a href=&quot;http://www.echofon.com/&quot; rel=&quot;nofollow&quot;&gt;Echofon&lt;/a&gt;"},{"from_user_id_str":"2421643","profile_image_url":"http://a0.twimg.com/profile_images/1190361665/ernestgrumbles-17_normal.jpg","created_at":"Wed, 26 Jan 2011 03:20:24 +0000","from_user":"ernestgrumbles","id_str":"30102730756333568","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Wow... WolframAlpha did not know who Eddie Haskell is. Guess I'll never use that &quot;knowledge engine&quot; again.","id":30102730756333568,"from_user_id":2421643,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"128028225","profile_image_url":"http://a1.twimg.com/profile_images/1224994593/Coding_Drunk_normal.jpg","created_at":"Wed, 26 Jan 2011 03:14:21 +0000","from_user":"chewedwire","id_str":"30101204428132352","metadata":{"result_type":"recent"},"to_user_id":177539201,"text":"@tomheon How is Haskell better/different from CL or Scheme? I honestly don't know, although I'm becoming more curious.","id":30101204428132352,"from_user_id":128028225,"to_user":"tomheon","geo":null,"iso_language_code":"en","to_user_id_str":"177539201","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"13540930","profile_image_url":"http://a1.twimg.com/profile_images/1205312219/23467_350321383101_821143101_5114147_3010041_n_normal.jpg","created_at":"Wed, 26 Jan 2011 03:06:54 +0000","from_user":"goodfox","id_str":"30099329809129473","metadata":{"result_type":"recent"},"to_user_id":null,"text":"A day of vision &amp; speeches. #SOTU now. And a wonderful Haskell Convocation address earlier today by Sinte Gleske President Lionel Bordeaux.","id":30099329809129473,"from_user_id":13540930,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.ubertwitter.com/bb/download.php&quot; rel=&quot;nofollow&quot;&gt;\u00dcberTwitter&lt;/a&gt;"},{"from_user_id_str":"119185220","profile_image_url":"http://a0.twimg.com/profile_images/1089027228/dfg_normal.jpg","created_at":"Wed, 26 Jan 2011 03:03:38 +0000","from_user":"LaLiciouz_03","id_str":"30098510623805440","metadata":{"result_type":"recent"},"to_user_id":null,"text":"The Game with the girl room 330 Haskell follow us...","id":30098510623805440,"from_user_id":119185220,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"18616016","profile_image_url":"http://a2.twimg.com/profile_images/1173522726/214397343_normal.jpg","created_at":"Wed, 26 Jan 2011 02:57:25 +0000","from_user":"josej30","id_str":"30096946144215040","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Voy a extra\u00f1ar Haskell cuando regrese al mundo imperativo. Hay alg\u00fan lenguaje imperativo que tenga este poder funcional? #ci3661","id":30096946144215040,"from_user_id":18616016,"geo":null,"iso_language_code":"es","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"17671137","profile_image_url":"http://a2.twimg.com/profile_images/290264834/Haskell-logo-outer-glow_normal.png","created_at":"Wed, 26 Jan 2011 02:55:32 +0000","from_user":"Hackage","id_str":"30096471814574080","metadata":{"result_type":"recent"},"to_user_id":null,"text":"comonad-transformers 0.9.0, added by EdwardKmett: Haskell 98 comonad transformers http://bit.ly/h6xIsf","id":30096471814574080,"from_user_id":17671137,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"177539201","profile_image_url":"http://a0.twimg.com/profile_images/1178368800/img_normal.jpeg","created_at":"Wed, 26 Jan 2011 02:48:12 +0000","from_user":"tomheon","id_str":"30094626920603649","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Every time I look at Haskell I love it more.","id":30094626920603649,"from_user_id":177539201,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"60792568","profile_image_url":"http://a0.twimg.com/profile_images/1203647517/glenda-flash_normal.jpg","created_at":"Wed, 26 Jan 2011 02:40:42 +0000","from_user":"r_takaishi","id_str":"30092735935422464","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell\u3088\u308aD\u8a00\u8a9e\u304c\u4e0a\u3068\u306f\u601d\u308f\u306a\u304b\u3063\u305f\uff0e http://www.tiobe.com/index.php/content/paperinfo/tpci/index.html","id":30092735935422464,"from_user_id":60792568,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twmode.sf.net/&quot; rel=&quot;nofollow&quot;&gt;twmode&lt;/a&gt;"},{"from_user_id_str":"160145510","profile_image_url":"http://a0.twimg.com/profile_images/1218108166/going_galt_normal.jpg","created_at":"Wed, 26 Jan 2011 02:39:31 +0000","from_user":"wtp1787","id_str":"30092439653974018","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @KLSouth: Eddie Haskell Goes to Washington... &quot;You look really nice tonight, Ms Cleaver&quot;","id":30092439653974018,"from_user_id":160145510,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"96616016","profile_image_url":"http://a1.twimg.com/profile_images/1196978169/Picture0002_normal.jpg","created_at":"Wed, 26 Jan 2011 02:39:20 +0000","from_user":"MelissaRNMBA","id_str":"30092392203816960","metadata":{"result_type":"recent"},"to_user_id":14862975,"text":"@KLSouth At least Eddie Haskell was entertaining.","id":30092392203816960,"from_user_id":96616016,"to_user":"KLSouth","geo":null,"iso_language_code":"en","to_user_id_str":"14862975","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"14862975","profile_image_url":"http://a0.twimg.com/profile_images/421596393/kls_4_normal.JPG","created_at":"Wed, 26 Jan 2011 02:38:29 +0000","from_user":"KLSouth","id_str":"30092178327871489","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Eddie Haskell Goes to Washington... &quot;You look really nice tonight, Ms Cleaver&quot;","id":30092178327871489,"from_user_id":14862975,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Wed, 26 Jan 2011 02:36:17 +0000","from_user":"listwarenet","id_str":"30091626869161984","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-beginners/84641-haskell-beginners-wildcards-in-expressions.html Haskell-beginners - Wild","id":30091626869161984,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"&lt;a href=&quot;http://1e10.org/cloud/&quot; rel=&quot;nofollow&quot;&gt;1e10&lt;/a&gt;"},{"from_user_id_str":"24538048","profile_image_url":"http://a2.twimg.com/profile_images/1117267605/rope_normal.jpg","created_at":"Wed, 26 Jan 2011 02:23:14 +0000","from_user":"dbph","id_str":"30088341030440960","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @dnene: Skilled Calisthenics. Haskell code that outputs python which spits ruby which emits the haskell source. http://j.mp/YlQUL via @mfeathers","id":30088341030440960,"from_user_id":24538048,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"158951567","profile_image_url":"http://a3.twimg.com/profile_images/962721419/Logo_3_normal.jpg","created_at":"Wed, 26 Jan 2011 01:58:31 +0000","from_user":"YubaVetTech","id_str":"30082124207886336","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Dr. Haskell has just been awarded the prestigious Hayward Award for \u2018Excellence in Education\u2019. This award honors... http://fb.me/QgQCxd74","id":30082124207886336,"from_user_id":158951567,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.facebook.com/twitter&quot; rel=&quot;nofollow&quot;&gt;Facebook&lt;/a&gt;"},{"from_user_id_str":"158951567","profile_image_url":"http://a3.twimg.com/profile_images/962721419/Logo_3_normal.jpg","created_at":"Wed, 26 Jan 2011 01:56:04 +0000","from_user":"YubaVetTech","id_str":"30081505476743168","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Dr. Haskell has just been awarded the prestigous Haward Award for Excellence in Education. This award honors... http://fb.me/PC9mYmCR","id":30081505476743168,"from_user_id":158951567,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.facebook.com/twitter&quot; rel=&quot;nofollow&quot;&gt;Facebook&lt;/a&gt;"},{"from_user_id_str":"2331498","profile_image_url":"http://a3.twimg.com/profile_images/494632120/me_normal.jpg","created_at":"Wed, 26 Jan 2011 01:43:50 +0000","from_user":"Verus","id_str":"30078427155406848","metadata":{"result_type":"recent"},"to_user_id":79273052,"text":"@kami_joe \u3044\u3084\uff0c\u8ab2\u984c\u306f\u89e3\u6c7a\u5bfe\u8c61(\u30d1\u30ba\u30eb\u3068\u304b)\u3092\u4e0e\u3048\u3089\u308c\u3066\uff0c\u554f\u984c\u5b9a\u7fa9\u3068\u30d7\u30ed\u30b0\u30e9\u30df\u30f3\u30b0(\u6307\u5b9a\u8a00\u8a9e\u306fC++\u3082\u3057\u304f\u306fJava)\u3068\u3044\u3046\u3044\u308f\u3070\u666e\u901a\u306a\u8ab2\u984c\u3067\u306f\u3042\u308b\u3093\u3060\u3051\u3069\uff0e\u95a2\u6570\u578b\u8a00\u8a9e\u306fHaskell\u306e\u6388\u696d\u304c\u307e\u305f\u5225\u306b\u3042\u308b\u306e\uff0e","id":30078427155406848,"from_user_id":2331498,"to_user":"kami_joe","geo":null,"iso_language_code":"ja","to_user_id_str":"79273052","source":"&lt;a href=&quot;http://itunes.apple.com/us/app/twitter/id409789998?mt=12&quot; rel=&quot;nofollow&quot;&gt;Twitter for Mac&lt;/a&gt;"},{"from_user_id_str":"79151233","profile_image_url":"http://a2.twimg.com/a/1295051201/images/default_profile_2_normal.png","created_at":"Wed, 26 Jan 2011 01:40:37 +0000","from_user":"cz_newdrafts","id_str":"30077617361125376","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell programming language http://bit.ly/gpPAwB","id":30077617361125376,"from_user_id":79151233,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"&lt;a href=&quot;http://tommorris.org/&quot; rel=&quot;nofollow&quot;&gt;tommorris' hacksample&lt;/a&gt;"},{"from_user_id_str":"2331498","profile_image_url":"http://a3.twimg.com/profile_images/494632120/me_normal.jpg","created_at":"Wed, 26 Jan 2011 01:02:57 +0000","from_user":"Verus","id_str":"30068139416879104","metadata":{"result_type":"recent"},"to_user_id":9252720,"text":"@shukukei Java\u3068C\u306f\u3042\u308b\u7a0b\u5ea6\u66f8\u3051\u3066\u3042\u305f\u308a\u307e\u3048\u306a\u3068\u3053\u308d\u304c\u3042\u308b\u304b\u3089\u306a\u30fc\uff0ePython\u306f\u500b\u4eba\u7684\u306b\u611f\u899a\u304c\u5408\u308f\u306a\u3044\uff0e\u611f\u899a\u306a\u306e\u3067\uff0c\u3082\u3046\u3069\u3046\u3057\u3088\u3046\u3082\u306a\u3044\uff57 \u3044\u307e\u306fScala\u3068Haskell\u3092\u3082\u3063\u3068\u6975\u3081\u305f\u3044\u3068\u3053\u308d\uff0e","id":30068139416879104,"from_user_id":2331498,"to_user":"shukukei","geo":null,"iso_language_code":"ja","to_user_id_str":"9252720","source":"&lt;a href=&quot;http://itunes.apple.com/us/app/twitter/id409789998?mt=12&quot; rel=&quot;nofollow&quot;&gt;Twitter for Mac&lt;/a&gt;"},{"from_user_id_str":"2781460","profile_image_url":"http://a0.twimg.com/profile_images/82526625/.joeyicon_normal.jpg","created_at":"Wed, 26 Jan 2011 01:02:35 +0000","from_user":"joeyhess","id_str":"30068046538219520","metadata":{"result_type":"recent"},"to_user_id":null,"text":"just figured out that I can use parameterized types to remove a dependency loop in git-annex's type definitions. whee #haskell","id":30068046538219520,"from_user_id":2781460,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://identi.ca&quot; rel=&quot;nofollow&quot;&gt;identica&lt;/a&gt;"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Wed, 26 Jan 2011 00:54:22 +0000","from_user":"listwarenet","id_str":"30065977920061440","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-beginners/84466-haskell-beginners-bytestring-question.html Haskell-beginners - Bytestrin","id":30065977920061440,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"&lt;a href=&quot;http://1e10.org/cloud/&quot; rel=&quot;nofollow&quot;&gt;1e10&lt;/a&gt;"},{"from_user_id_str":"1291845","profile_image_url":"http://a0.twimg.com/profile_images/1225743404/ThinOxygen-small-opaque-solidarity_normal.png","created_at":"Wed, 26 Jan 2011 00:52:07 +0000","from_user":"_aaron_","id_str":"30065412242669568","metadata":{"result_type":"recent"},"to_user_id":null,"text":"wanted: librly licensed high level native compiled lang with min runtime (otherwise cobra/mono would be perfect) for win. lua? haskell? ooc?","id":30065412242669568,"from_user_id":1291845,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"}],"max_id":30120402839666689,"since_id":0,"refresh_url":"?since_id=30120402839666689&q=haskell","next_page":"?page=2&max_id=30120402839666689&rpp=50&q=haskell","results_per_page":50,"page":1,"completed_in":0.291696,"since_id_str":"0","max_id_str":"30120402839666689","query":"haskell"}
benchmarks/warp-3.0.1.1/LICENSEnew file+20
@@ -0,0 +1,20 @@
1+Copyright (c) 2012 Michael Snoyman, http://www.yesodweb.com/
2+
3+Permission is hereby granted, free of charge, to any person obtaining
4+a copy of this software and associated documentation files (the
5+"Software"), to deal in the Software without restriction, including
6+without limitation the rights to use, copy, modify, merge, publish,
7+distribute, sublicense, and/or sell copies of the Software, and to
8+permit persons to whom the Software is furnished to do so, subject to
9+the following conditions:
10+
11+The above copyright notice and this permission notice shall be
12+included in all copies or substantial portions of the Software.
13+
14+THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
15+EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
16+MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
17+NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE
18+LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION
19+OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION
20+WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
benchmarks/warp-3.0.1.1/Network/Wai/Handler/Warp/ReadInt.hsnew file+67
@@ -0,0 +1,67 @@
1+{-# LANGUAGE OverloadedStrings #-}
2+{-# LANGUAGE MagicHash #-}
3+{-# LANGUAGE BangPatterns #-}
4+
5+-- Copyright : Erik de Castro Lopo <erikd@mega-nerd.com>
6+-- License : BSD3
7+
8+module Network.Wai.Handler.Warp.ReadInt (
9+ readInt
10+ , readInt64
11+ ) where
12+
13+-- This function lives in its own file because the MagicHash pragma interacts
14+-- poorly with the CPP pragma.
15+
16+import Data.ByteString (ByteString)
17+import qualified Data.ByteString as S
18+import Data.Int (Int64)
19+import GHC.Prim
20+import GHC.Types
21+import GHC.Word
22+
23+{-# INLINE readInt #-}
24+readInt :: Integral a => ByteString -> a
25+readInt bs = fromIntegral $ readInt64 bs
26+
27+-- This function is used to parse the Content-Length field of HTTP headers and
28+-- is a performance hot spot. It should only be replaced with something
29+-- significantly and provably faster.
30+--
31+-- It needs to be able work correctly on 32 bit CPUs for file sizes > 2G so we
32+-- use Int64 here and then make a generic 'readInt' that allows conversion to
33+-- Int and Integer.
34+
35+{-# NOINLINE readInt64 #-}
36+readInt64 :: ByteString -> Int64
37+readInt64 bs = S.foldl' (\ !i !c -> i * 10 + fromIntegral (mhDigitToInt c)) 0
38+ $ S.takeWhile isDigit bs
39+
40+data Table = Table !Addr#
41+
42+{-# NOINLINE mhDigitToInt #-}
43+mhDigitToInt :: Word8 -> Int
44+mhDigitToInt (W8# i) = I# (word2Int# (indexWord8OffAddr# addr (word2Int# i)))
45+ where
46+ !(Table addr) = table
47+ table :: Table
48+ table = Table
49+ "\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\
50+ \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\
51+ \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\
52+ \\x00\x01\x02\x03\x04\x05\x06\x07\x08\x09\x00\x00\x00\x00\x00\x00\
53+ \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\
54+ \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\
55+ \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\
56+ \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\
57+ \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\
58+ \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\
59+ \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\
60+ \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\
61+ \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\
62+ \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\
63+ \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\
64+ \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00"#
65+
66+isDigit :: Word8 -> Bool
67+isDigit w = w >= 48 && w <= 57
benchmarks/warp-3.0.1.1/Network/Wai/Handler/Warp/RequestHeader.hsnew file+172
@@ -0,0 +1,172 @@
1+{-# LANGUAGE DeriveDataTypeable #-}
2+{-# LANGUAGE OverloadedStrings #-}
3+{-# LANGUAGE BangPatterns #-}
4+
5+module Network.Wai.Handler.Warp.RequestHeader (
6+ parseHeaderLines
7+ , parseByteRanges
8+ ) where
9+
10+import Control.Exception (Exception, throwIO)
11+import Control.Monad (when)
12+import Data.Typeable (Typeable)
13+import qualified Data.ByteString as S
14+import qualified Data.ByteString.Char8 as B (unpack, readInteger)
15+import Data.ByteString.Internal (ByteString(..), memchr)
16+import qualified Data.CaseInsensitive as CI
17+import Data.Word (Word8)
18+import Foreign.ForeignPtr (withForeignPtr)
19+import Foreign.Ptr (Ptr, plusPtr, minusPtr, nullPtr)
20+import Foreign.Storable (peek)
21+import qualified Network.HTTP.Types as H
22+-- import Network.Wai.Handler.Warp.Types
23+import qualified Network.HTTP.Types.Header as HH
24+-- $setup
25+-- >>> :set -XOverloadedStrings
26+
27+data InvalidRequest = NotEnoughLines [String]
28+ | BadFirstLine String
29+ | NonHttp
30+ | IncompleteHeaders
31+ | ConnectionClosedByPeer
32+ | OverLargeHeader
33+ deriving (Eq, Typeable, Show)
34+
35+instance Exception InvalidRequest
36+
37+----------------------------------------------------------------
38+
39+parseHeaderLines :: [ByteString]
40+ -> IO (H.Method
41+ ,ByteString -- Path
42+ ,ByteString -- Path, parsed
43+ ,ByteString -- Query
44+ ,H.HttpVersion
45+ ,H.RequestHeaders
46+ )
47+parseHeaderLines [] = throwIO $ NotEnoughLines []
48+parseHeaderLines (firstLine:otherLines) = do
49+ (method, path', query, httpversion) <- parseRequestLine firstLine
50+ let path = H.extractPath path'
51+ hdr = map parseHeader otherLines
52+ return (method, path', path, query, httpversion, hdr)
53+
54+----------------------------------------------------------------
55+
56+-- |
57+--
58+-- >>> parseRequestLine "GET / HTTP/1.1"
59+-- ("GET","/","",HTTP/1.1)
60+-- >>> parseRequestLine "POST /cgi/search.cgi?key=foo HTTP/1.0"
61+-- ("POST","/cgi/search.cgi","?key=foo",HTTP/1.0)
62+-- >>> parseRequestLine "GET "
63+-- *** Exception: Warp: Invalid first line of request: "GET "
64+-- >>> parseRequestLine "GET /NotHTTP UNKNOWN/1.1"
65+-- *** Exception: Warp: Request line specified a non-HTTP request
66+parseRequestLine :: ByteString
67+ -> IO (H.Method
68+ ,ByteString -- Path
69+ ,ByteString -- Query
70+ ,H.HttpVersion)
71+parseRequestLine requestLine@(PS fptr off len) = withForeignPtr fptr $ \ptr -> do
72+ when (len < 14) $ throwIO baderr
73+ let methodptr = ptr `plusPtr` off
74+ limptr = methodptr `plusPtr` len
75+ lim0 = fromIntegral len
76+
77+ pathptr0 <- memchr methodptr 32 lim0 -- ' '
78+ when (pathptr0 == nullPtr || (limptr `minusPtr` pathptr0) < 11) $
79+ throwIO baderr
80+ let pathptr = pathptr0 `plusPtr` 1
81+ lim1 = fromIntegral (limptr `minusPtr` pathptr0)
82+
83+ httpptr0 <- memchr pathptr 32 lim1 -- ' '
84+ when (httpptr0 == nullPtr || (limptr `minusPtr` httpptr0) < 9) $
85+ throwIO baderr
86+ let httpptr = httpptr0 `plusPtr` 1
87+ lim2 = fromIntegral (httpptr0 `minusPtr` pathptr)
88+
89+ checkHTTP httpptr
90+ !hv <- httpVersion httpptr
91+ queryptr <- memchr pathptr 63 lim2 -- '?'
92+
93+ let !method = bs ptr methodptr pathptr0
94+ !path
95+ | queryptr == nullPtr = bs ptr pathptr httpptr0
96+ | otherwise = bs ptr pathptr queryptr
97+ !query
98+ | queryptr == nullPtr = S.empty
99+ | otherwise = bs ptr queryptr httpptr0
100+
101+ return (method,path,query,hv)
102+ where
103+ baderr = BadFirstLine $ B.unpack requestLine
104+ check :: Ptr Word8 -> Int -> Word8 -> IO ()
105+ check p n w = do
106+ w0 <- peek $ p `plusPtr` n
107+ when (w0 /= w) $ throwIO NonHttp
108+ checkHTTP httpptr = do
109+ check httpptr 0 72 -- 'H'
110+ check httpptr 1 84 -- 'T'
111+ check httpptr 2 84 -- 'T'
112+ check httpptr 3 80 -- 'P'
113+ check httpptr 4 47 -- '/'
114+ check httpptr 6 46 -- '.'
115+ httpVersion httpptr = do
116+ major <- peek $ httpptr `plusPtr` 5
117+ minor <- peek $ httpptr `plusPtr` 7
118+ return $ if major == (49 :: Word8) && minor == (49 :: Word8) then
119+ H.http11
120+ else
121+ H.http10
122+ bs ptr p0 p1 = PS fptr o l
123+ where
124+ o = p0 `minusPtr` ptr
125+ l = p1 `minusPtr` p0
126+
127+----------------------------------------------------------------
128+
129+-- |
130+--
131+-- >>> parseHeader "Content-Length:47"
132+-- ("Content-Length","47")
133+-- >>> parseHeader "Accept-Ranges: bytes"
134+-- ("Accept-Ranges","bytes")
135+-- >>> parseHeader "Host: example.com:8080"
136+-- ("Host","example.com:8080")
137+-- >>> parseHeader "NoSemiColon"
138+-- ("NoSemiColon","")
139+
140+parseHeader :: ByteString -> H.Header
141+parseHeader s =
142+ let (k, rest) = S.break (== 58) s -- ':'
143+ rest' = S.dropWhile (\c -> c == 32 || c == 9) $ S.drop 1 rest
144+ in (CI.mk k, rest')
145+
146+parseByteRanges :: S.ByteString -> Maybe HH.ByteRanges
147+parseByteRanges bs1 = do
148+ bs2 <- stripPrefix "bytes=" bs1
149+ (r, bs3) <- range bs2
150+ ranges (r:) bs3
151+ where
152+ range bs2 =
153+ case stripPrefix "-" bs2 of
154+ Just bs3 -> do
155+ (i, bs4) <- B.readInteger bs3
156+ Just (HH.ByteRangeSuffix i, bs4)
157+ Nothing -> do
158+ (i, bs3) <- B.readInteger bs2
159+ bs4 <- stripPrefix "-" bs3
160+ case B.readInteger bs4 of
161+ Nothing -> Just (HH.ByteRangeFrom i, bs4)
162+ Just (j, bs5) -> Just (HH.ByteRangeFromTo i j, bs5)
163+ ranges front bs3 =
164+ case stripPrefix "," bs3 of
165+ Nothing -> Just (front [])
166+ Just bs4 -> do
167+ (r, bs5) <- range bs4
168+ ranges (front . (r:)) bs5
169+
170+ stripPrefix x y
171+ | x `S.isPrefixOf` y = Just (S.drop (S.length x) y)
172+ | otherwise = Nothing
changelog.mdnew file+114
@@ -0,0 +1,114 @@
1+0.13.2.1
2+
3+* Improved performance of `Data.Attoparsec.Text.asciiCI`
4+
5+0.13.2.0
6+
7+* `pure` is now strict in `Position`
8+
9+0.13.1.0
10+
11+* `runScanner` now correctly returns the final state
12+ (https://github.com/bos/attoparsec/issues/105).
13+* `Parser`, `ZeptoT`, `Buffer`, and `More` now expose `Semigroup` instances.
14+* `Parser`, and `ZeptoT` now expose `MonadFail` instances.
15+
16+0.13.0.2
17+
18+* Restore the fast specialised character set implementation for Text
19+* Move testsuite from test-framework to tasty
20+* Performance optimization of takeWhile and takeWhile1
21+
22+0.13.0.1
23+
24+* Fixed a bug in the implementations of inClass and notInClass for
25+ Text (https://github.com/bos/attoparsec/issues/103)
26+
27+0.13.0.0
28+
29+* Made the parser type in the Zepto module a monad transformer
30+ (needed by aeson's string unescaping parser).
31+
32+0.12.1.6
33+
34+* Fixed a case folding bug in the ByteString version of stringCI.
35+
36+0.12.1.5
37+
38+* Fixed an indexing bug in the new Text implementation of string,
39+ reported by Michel Boucey.
40+
41+0.12.1.4
42+
43+* Fixed a case where the string parser would consume an unnecessary
44+ amount of input before failing a match, when it could bail much
45+ earlier (https://github.com/bos/attoparsec/issues/97)
46+
47+* Added more context to error messages
48+ (https://github.com/bos/attoparsec/pull/79)
49+
50+0.12.1.3
51+
52+* Fixed incorrect tracking of Text lengths
53+ (https://github.com/bos/attoparsec/issues/80)
54+
55+0.12.1.2
56+
57+* Fixed the incorrect tracking of capacity if the initial buffer was
58+ empty (https://github.com/bos/attoparsec/issues/75)
59+
60+0.12.1.1
61+
62+* Fixed a data corruption bug that occurred under some circumstances
63+ if a buffer grew after prompting for more input
64+ (https://github.com/bos/attoparsec/issues/74)
65+
66+0.12.1.0
67+
68+* Now compatible with GHC 7.9
69+
70+* Reintroduced the Chunk class, used by the parsers package
71+
72+0.12.0.0
73+
74+* A new internal representation makes almost all real-world parsers
75+ faster, sometimes by big margins. For example, parsing JSON data
76+ with aeson is now up to 70% faster. These performance improvements
77+ also come with reduced memory consumption and some new capabilities.
78+
79+* The new match combinator gives both the result of a parse and the
80+ input that it matched.
81+
82+* The test suite has doubled in size. This made it possible to switch
83+ to the new internal representation with a decent degree of
84+ confidence that everything was more or less working.
85+
86+* The benchmark suite now contains a small family of benchmarks taken
87+ from real-world uses of attoparsec.
88+
89+* A few types that ought to have been private now are.
90+
91+* A few obsolete modules and functions have been marked as deprecated.
92+ They will be removed from the next major release.
93+
94+0.11.3.0
95+
96+* New function scientific is compatible with rational, but parses
97+ integers more efficiently (https://github.com/bos/aeson/issues/198)
98+
99+0.11.2.0
100+
101+* The new Chunk typeclass allows for some code sharing with Ed
102+ Kmett's parsers package: http://hackage.haskell.org/package/parsers
103+
104+* New function runScanner generalises scan to return the final state
105+ of the scanner as well as the input consumed.
106+
107+
108+0.11.1.0
109+
110+* New dependency: the scientific package. This allows us to parse
111+ numbers much more efficiently.
112+
113+* peekWord8', peekChar': new primitive parsers that allow
114+ single-character lookahead.
examples/TestRFC2616.hs → examples/Atto_RFC2616.hsrenamed+16−8
@@ -1,21 +1,28 @@
1{-# LANGUAGE BangPatterns #-}
1{-# LANGUAGE BangPatterns #-}
2−import RFC2616
2+
3−import Control.Monad (forM_)
3+module Main (main) where
4−import System.IO
4+
5+import Control.Applicative
5import Control.Exception (bracket)
6import Control.Exception (bracket)
7+import Control.Monad (forM_)
8+import Data.Attoparsec.ByteString
9+import RFC2616
6import System.Environment
10import System.Environment
11+import System.IO
7import qualified Data.ByteString.Char8 as B
12import qualified Data.ByteString.Char8 as B
8−import Data.Attoparsec
9
13
14+refill :: Handle -> IO B.ByteString
10−refill h = B.hGet h (4*1024)
15+refill h = B.hGet h (80*1024)
11
16
17+listy :: FilePath -> Handle -> IO ()
12listy file h = do
18listy file h = do
13 r <- parseWith (refill h) (many request) =<< refill h
19 r <- parseWith (refill h) (many request) =<< refill h
14 case r of
20 case r of
15 Fail _ _ msg -> hPutStrLn stderr $ file ++ ": " ++ msg
21 Fail _ _ msg -> hPutStrLn stderr $ file ++ ": " ++ msg
16 Done _ reqs -> print (length reqs)
22 Done _ reqs -> print (length reqs)
17−
23+
24+incrementy :: FilePath -> Handle -> IO ()
18−incrementy file h = go 0 =<< refill h
25+incrementy file h = go (0::Int) =<< refill h
19 where
26 where
20 go !n is = do
27 go !n is = do
21 r <- parseWith (refill h) request is
28 r <- parseWith (refill h) request is
@@ -28,7 +35,8 @@ incrementy file h = go 0 =<< refill h
28 then print (n+1)
35 then print (n+1)
29 else go (n+1) s
36 else go (n+1) s
30 | otherwise -> go (n+1) bs
37 | otherwise -> go (n+1) bs
31−
38+
39+main :: IO ()
32main = do
40main = do
33 args <- getArgs
41 args <- getArgs
34 forM_ args $ \arg ->
42 forM_ args $ \arg ->
examples/Makefile+6−2
@@ -1,4 +1,4 @@
1−CC := gcc
1+CC := cc
2CFLAGS := -O3 -Wall
2CFLAGS := -O3 -Wall
3# To make the code about 6% faster:
3# To make the code about 6% faster:
4# CFLAGS += -fwhole-program --combine
4# CFLAGS += -fwhole-program --combine
@@ -12,4 +12,8 @@ c-http: rfc2616.c http_parser.c
12clean:
12clean:
13 rm -f *.hi *.o c-http
13 rm -f *.hi *.o c-http
14
14
15−vpath %.c $(HOME)/hg/http-parser
15+http_parser.c: http_parser.h
16+ curl -O https://raw.githubusercontent.com/joyent/http-parser/master/http_parser.c
17+
18+http_parser.h:
19+ curl -O https://raw.githubusercontent.com/joyent/http-parser/master/http_parser.h
examples/Parsec_RFC2616.hs+9−6
@@ -23,15 +23,16 @@ token :: Stream s m Char => ParsecT s u m Char
23token = satisfy $ \c -> S.notMember (fromEnum c) set
23token = satisfy $ \c -> S.notMember (fromEnum c) set
24 where set = S.fromList . map fromEnum $ ['\0'..'\31'] ++ "()<>@,;:\\\"/[]?={} \t" ++ ['\128'..'\255']
24 where set = S.fromList . map fromEnum $ ['\0'..'\31'] ++ "()<>@,;:\\\"/[]?={} \t" ++ ['\128'..'\255']
25
25
26+isHorizontalSpace :: Char -> Bool
26isHorizontalSpace c = c == ' ' || c == '\t'
27isHorizontalSpace c = c == ' ' || c == '\t'
27
28
28skipHSpaces :: Stream s m Char => ParsecT s u m ()
29skipHSpaces :: Stream s m Char => ParsecT s u m ()
29skipHSpaces = skipMany1 (satisfy isHorizontalSpace)
30skipHSpaces = skipMany1 (satisfy isHorizontalSpace)
30
31
31data Request = Request {
32data Request = Request {
32− requestMethod :: String
33+ _requestMethod :: String
33− , requestUri :: String
34+ , _requestUri :: String
34− , requestProtocol :: String
35+ , _requestProtocol :: String
35 } deriving (Eq, Ord, Show)
36 } deriving (Eq, Ord, Show)
36
37
37requestLine :: Stream s m Char => ParsecT s u m Request
38requestLine :: Stream s m Char => ParsecT s u m Request
@@ -47,8 +48,8 @@ endOfLine :: Stream s m Char => ParsecT s u m ()
47endOfLine = (string "\r\n" *> pure ()) <|> (char '\n' *> pure ())
48endOfLine = (string "\r\n" *> pure ()) <|> (char '\n' *> pure ())
48
49
49data Header = Header {
50data Header = Header {
50− headerName :: String
51+ _headerName :: String
51− , headerValue :: [String]
52+ , _headerValue :: [String]
52 } deriving (Eq, Ord, Show)
53 } deriving (Eq, Ord, Show)
53
54
54messageHeader :: Stream s m Char => ParsecT s u m Header
55messageHeader :: Stream s m Char => ParsecT s u m Header
@@ -61,14 +62,16 @@ messageHeader = do
61request :: Stream s m Char => ParsecT s u m (Request, [Header])
62request :: Stream s m Char => ParsecT s u m (Request, [Header])
62request = (,) <$> requestLine <*> many messageHeader <* endOfLine
63request = (,) <$> requestLine <*> many messageHeader <* endOfLine
63
64
65+listy :: FilePath -> IO ()
64listy arg = do
66listy arg = do
65 r <- parseFromFile (many request) arg
67 r <- parseFromFile (many request) arg
66 case r of
68 case r of
67 Left err -> putStrLn $ arg ++ ": " ++ show err
69 Left err -> putStrLn $ arg ++ ": " ++ show err
68 Right rs -> print (length rs)
70 Right rs -> print (length rs)
69
71
72+chunky :: FilePath -> IO ()
70chunky arg = bracket (openFile arg ReadMode) hClose $ \h ->
73chunky arg = bracket (openFile arg ReadMode) hClose $ \h ->
71− loop 0 =<< B.hGetContents h
74+ loop (0::Int) =<< B.hGetContents h
72 where
75 where
73 loop !n bs
76 loop !n bs
74 | B.null bs = print n
77 | B.null bs = print n
examples/RFC2616.hs+26−51
@@ -5,86 +5,61 @@ module RFC2616
5 Header(..)
5 Header(..)
6 , Request(..)
6 , Request(..)
7 , Response(..)
7 , Response(..)
8− , isToken
9− , messageHeader
10 , request
8 , request
11− , requestLine
12 , response
9 , response
13− , responseLine
14− , lowerHeader
15− , lookupHeader
16 ) where
10 ) where
17
11
18−import Control.Applicative hiding (many)
12+import Control.Applicative
19−import Data.Attoparsec as P
13+import Data.Attoparsec.ByteString as P
20−import qualified Data.Attoparsec.Char8 as P8
21−import Data.Attoparsec.Char8 (char8, endOfLine, isDigit_w8)
14+import Data.Attoparsec.ByteString.Char8 (char8, endOfLine, isDigit_w8)
15+import Data.ByteString (ByteString)
22import Data.Word (Word8)
16import Data.Word (Word8)
23−import qualified Data.ByteString.Char8 as B hiding (map)
17+import Data.Attoparsec.ByteString.Char8 (isEndOfLine, isHorizontalSpace)
24−import qualified Data.ByteString as B (map)
25
18
26isToken :: Word8 -> Bool
19isToken :: Word8 -> Bool
27isToken w = w <= 127 && notInClass "\0-\31()<>@,;:\\\"/[]?={} \t" w
20isToken w = w <= 127 && notInClass "\0-\31()<>@,;:\\\"/[]?={} \t" w
28
21
29skipSpaces :: Parser ()
22skipSpaces :: Parser ()
30−skipSpaces = satisfy P8.isHorizontalSpace *> skipWhile P8.isHorizontalSpace
23+skipSpaces = satisfy isHorizontalSpace *> skipWhile isHorizontalSpace
31
24
32data Request = Request {
25data Request = Request {
33− requestMethod :: !B.ByteString
26+ requestMethod :: ByteString
34− , requestUri :: !B.ByteString
27+ , requestUri :: ByteString
35− , requestVersion :: !B.ByteString
28+ , requestVersion :: ByteString
36 } deriving (Eq, Ord, Show)
29 } deriving (Eq, Ord, Show)
37
30
38−httpVersion :: Parser B.ByteString
31+httpVersion :: Parser ByteString
39−httpVersion = string "HTTP/" *> P.takeWhile (\c -> isDigit_w8 c || c == 46)
32+httpVersion = "HTTP/" *> P.takeWhile (\c -> isDigit_w8 c || c == 46)
40
33
41requestLine :: Parser Request
34requestLine :: Parser Request
42−requestLine = do
43− method <- P.takeWhile1 isToken <* char8 ' '
35+requestLine = Request <$> (takeWhile1 isToken <* char8 ' ')
44− uri <- P.takeWhile1 (/=32) <* char8 ' '
36+ <*> (takeWhile1 (/=32) <* char8 ' ')
45− version <- httpVersion <* endOfLine
37+ <*> (httpVersion <* endOfLine)
46− return $! Request method uri version
47
38
48data Header = Header {
39data Header = Header {
49− headerName :: !B.ByteString
40+ headerName :: ByteString
50− , headerValue :: [B.ByteString]
41+ , headerValue :: [ByteString]
51 } deriving (Eq, Ord, Show)
42 } deriving (Eq, Ord, Show)
52
43
53messageHeader :: Parser Header
44messageHeader :: Parser Header
54−messageHeader = do
45+messageHeader = Header
55− header <- P.takeWhile isToken <* char8 ':' <* skipWhile P8.isHorizontalSpace
46+ <$> (P.takeWhile isToken <* char8 ':' <* skipWhile isHorizontalSpace)
56− body <- takeTill P8.isEndOfLine <* endOfLine
47+ <*> ((:) <$> (takeTill isEndOfLine <* endOfLine)
57− bodies <- many $ skipSpaces *> takeTill P8.isEndOfLine <* endOfLine
48+ <*> (many $ skipSpaces *> takeTill isEndOfLine <* endOfLine))
58− return $! Header header (body:bodies)
59
49
60request :: Parser (Request, [Header])
50request :: Parser (Request, [Header])
61request = (,) <$> requestLine <*> many messageHeader <* endOfLine
51request = (,) <$> requestLine <*> many messageHeader <* endOfLine
62
52
63data Response = Response {
53data Response = Response {
64− responseVersion :: !B.ByteString
54+ responseVersion :: ByteString
65− , responseCode :: !B.ByteString
55+ , responseCode :: ByteString
66− , responseMsg :: !B.ByteString
56+ , responseMsg :: ByteString
67 } deriving (Eq, Ord, Show)
57 } deriving (Eq, Ord, Show)
68
58
69responseLine :: Parser Response
59responseLine :: Parser Response
70−responseLine = do
71− version <- httpVersion <* char8 ' '
60+responseLine = Response <$> (httpVersion <* char8 ' ')
72− code <- P.takeWhile isDigit_w8 <* char8 ' '
61+ <*> (P.takeWhile isDigit_w8 <* char8 ' ')
73− msg <- P.takeTill P8.isEndOfLine <* endOfLine
62+ <*> (takeTill isEndOfLine <* endOfLine)
74− return $! Response version code msg
75
63
76response :: Parser (Response, [Header])
64response :: Parser (Response, [Header])
77response = (,) <$> responseLine <*> many messageHeader <* endOfLine
65response = (,) <$> responseLine <*> many messageHeader <* endOfLine
78−
79−lowerHeader :: Header -> Header
80−lowerHeader (Header n v) = Header (B.map toLower n) (map (B.map toLower) v)
81− where toLower w | w >= 65 && w <= 90 = w + 32
82− | otherwise = w
83−
84−lookupHeader :: B.ByteString -> [Header] -> [B.ByteString]
85−lookupHeader k = go
86− where
87− go (Header n v:hs)
88− | k == n = v
89− | otherwise = go hs
90− go _ = []
examples/attoparsec-examples.cabalnew file+31
@@ -0,0 +1,31 @@
1+-- These examples are not intended to be installed.
2+-- So don't install 'em.
3+
4+name: attoparsec-examples
5+version: 0
6+cabal-version: >=1.6
7+build-type: Simple
8+
9+executable atto-rfc2616
10+ main-is: Atto_RFC2616.hs
11+ hs-source-dirs: .. .
12+ ghc-options: -O2 -Wall -rtsopts
13+ build-depends:
14+ array,
15+ base == 4.*,
16+ bytestring >= 0.10.4.0,
17+ deepseq >= 1.1,
18+ scientific >= 0.3.1,
19+ text >= 1.1.1.0
20+
21+executable parsec-rfc2616
22+ main-is: Parsec_RFC2616.hs
23+ hs-source-dirs: .
24+ ghc-options: -O2 -Wall -rtsopts
25+ build-depends:
26+ array,
27+ base == 4.*,
28+ containers,
29+ bytestring >= 0.10.4.0,
30+ parsec,
31+ text >= 1.1.1.0
examples/http-requests.txtnew file+494
@@ -0,0 +1,494 @@
1+GET / HTTP/1.1
2+Host: www.reddit.com
3+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
4+Accept: text/html,application/xhtml+xml,application/xml;q=0.9,*/*;q=0.8
5+Accept-Language: en-us,en;q=0.5
6+Accept-Encoding: gzip, deflate
7+Connection: keep-alive
8+
9+GET /reddit.v_EZwRzV-Ns.css HTTP/1.1
10+Host: www.redditstatic.com
11+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
12+Accept: text/css,*/*;q=0.1
13+Accept-Language: en-us,en;q=0.5
14+Accept-Encoding: gzip, deflate
15+Connection: keep-alive
16+Referer: http://www.reddit.com/
17+
18+GET /reddit-init.en-us.O1zuMqOOQvY.js HTTP/1.1
19+Host: www.redditstatic.com
20+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
21+Accept: */*
22+Accept-Language: en-us,en;q=0.5
23+Accept-Encoding: gzip, deflate
24+Connection: keep-alive
25+Referer: http://www.reddit.com/
26+
27+GET /reddit.en-us.31yAfSoTsfo.js HTTP/1.1
28+Host: www.redditstatic.com
29+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
30+Accept: */*
31+Accept-Language: en-us,en;q=0.5
32+Accept-Encoding: gzip, deflate
33+Connection: keep-alive
34+Referer: http://www.reddit.com/
35+
36+GET /kill.png HTTP/1.1
37+Host: www.redditstatic.com
38+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
39+Accept: image/png,image/*;q=0.8,*/*;q=0.5
40+Accept-Language: en-us,en;q=0.5
41+Accept-Encoding: gzip, deflate
42+Connection: keep-alive
43+Referer: http://www.reddit.com/
44+
45+GET /icon.png HTTP/1.1
46+Host: www.redditstatic.com
47+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
48+Accept: text/html,application/xhtml+xml,application/xml;q=0.9,*/*;q=0.8
49+Accept-Language: en-us,en;q=0.5
50+Accept-Encoding: gzip, deflate
51+Connection: keep-alive
52+
53+GET /favicon.ico HTTP/1.1
54+Host: www.redditstatic.com
55+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
56+Accept: text/html,application/xhtml+xml,application/xml;q=0.9,*/*;q=0.8
57+Accept-Language: en-us,en;q=0.5
58+Accept-Encoding: gzip, deflate
59+Connection: keep-alive
60+
61+GET /AMZM4CWd6zstSC8y.jpg HTTP/1.1
62+Host: b.thumbs.redditmedia.com
63+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
64+Accept: image/png,image/*;q=0.8,*/*;q=0.5
65+Accept-Language: en-us,en;q=0.5
66+Accept-Encoding: gzip, deflate
67+Connection: keep-alive
68+Referer: http://www.reddit.com/
69+
70+GET /jz1d5Nm0w97-YyNm.jpg HTTP/1.1
71+Host: b.thumbs.redditmedia.com
72+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
73+Accept: image/png,image/*;q=0.8,*/*;q=0.5
74+Accept-Language: en-us,en;q=0.5
75+Accept-Encoding: gzip, deflate
76+Connection: keep-alive
77+Referer: http://www.reddit.com/
78+
79+GET /aWGO99I6yOcNUKXB.jpg HTTP/1.1
80+Host: a.thumbs.redditmedia.com
81+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
82+Accept: image/png,image/*;q=0.8,*/*;q=0.5
83+Accept-Language: en-us,en;q=0.5
84+Accept-Encoding: gzip, deflate
85+Connection: keep-alive
86+Referer: http://www.reddit.com/
87+
88+GET /rZ_rD5TjrJM0E9Aj.css HTTP/1.1
89+Host: e.thumbs.redditmedia.com
90+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
91+Accept: text/css,*/*;q=0.1
92+Accept-Language: en-us,en;q=0.5
93+Accept-Encoding: gzip, deflate
94+Connection: keep-alive
95+Referer: http://www.reddit.com/
96+
97+GET /tmsPwagFzyTvrGRx.jpg HTTP/1.1
98+Host: a.thumbs.redditmedia.com
99+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
100+Accept: image/png,image/*;q=0.8,*/*;q=0.5
101+Accept-Language: en-us,en;q=0.5
102+Accept-Encoding: gzip, deflate
103+Connection: keep-alive
104+Referer: http://www.reddit.com/
105+
106+GET /KYgUaLvXCK3TCEJx.jpg HTTP/1.1
107+Host: a.thumbs.redditmedia.com
108+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
109+Accept: image/png,image/*;q=0.8,*/*;q=0.5
110+Accept-Language: en-us,en;q=0.5
111+Accept-Encoding: gzip, deflate
112+Connection: keep-alive
113+Referer: http://www.reddit.com/
114+
115+GET /81pzxT5x2ozuEaxX.jpg HTTP/1.1
116+Host: e.thumbs.redditmedia.com
117+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
118+Accept: image/png,image/*;q=0.8,*/*;q=0.5
119+Accept-Language: en-us,en;q=0.5
120+Accept-Encoding: gzip, deflate
121+Connection: keep-alive
122+Referer: http://www.reddit.com/
123+
124+GET /MFqCUiUVPO5V8t6x.jpg HTTP/1.1
125+Host: a.thumbs.redditmedia.com
126+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
127+Accept: image/png,image/*;q=0.8,*/*;q=0.5
128+Accept-Language: en-us,en;q=0.5
129+Accept-Encoding: gzip, deflate
130+Connection: keep-alive
131+Referer: http://www.reddit.com/
132+
133+GET /TFpYTiAO5aEowokv.jpg HTTP/1.1
134+Host: e.thumbs.redditmedia.com
135+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
136+Accept: image/png,image/*;q=0.8,*/*;q=0.5
137+Accept-Language: en-us,en;q=0.5
138+Accept-Encoding: gzip, deflate
139+Connection: keep-alive
140+Referer: http://www.reddit.com/
141+
142+GET /eMWMpmm9APNeNqcF.jpg HTTP/1.1
143+Host: e.thumbs.redditmedia.com
144+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
145+Accept: image/png,image/*;q=0.8,*/*;q=0.5
146+Accept-Language: en-us,en;q=0.5
147+Accept-Encoding: gzip, deflate
148+Connection: keep-alive
149+Referer: http://www.reddit.com/
150+
151+GET /S-IpsJrOKuaK9GZ8.jpg HTTP/1.1
152+Host: c.thumbs.redditmedia.com
153+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
154+Accept: image/png,image/*;q=0.8,*/*;q=0.5
155+Accept-Language: en-us,en;q=0.5
156+Accept-Encoding: gzip, deflate
157+Connection: keep-alive
158+Referer: http://www.reddit.com/
159+
160+GET /3V6dj9PDsNnheDXn.jpg HTTP/1.1
161+Host: c.thumbs.redditmedia.com
162+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
163+Accept: image/png,image/*;q=0.8,*/*;q=0.5
164+Accept-Language: en-us,en;q=0.5
165+Accept-Encoding: gzip, deflate
166+Connection: keep-alive
167+Referer: http://www.reddit.com/
168+
169+GET /wQ3-VmNXhv8sg4SJ.jpg HTTP/1.1
170+Host: c.thumbs.redditmedia.com
171+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
172+Accept: image/png,image/*;q=0.8,*/*;q=0.5
173+Accept-Language: en-us,en;q=0.5
174+Accept-Encoding: gzip, deflate
175+Connection: keep-alive
176+Referer: http://www.reddit.com/
177+
178+GET /ixd1C1njpczEWC22.jpg HTTP/1.1
179+Host: c.thumbs.redditmedia.com
180+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
181+Accept: image/png,image/*;q=0.8,*/*;q=0.5
182+Accept-Language: en-us,en;q=0.5
183+Accept-Encoding: gzip, deflate
184+Connection: keep-alive
185+Referer: http://www.reddit.com/
186+
187+GET /nGsQj15VyOHMwmq8.jpg HTTP/1.1
188+Host: c.thumbs.redditmedia.com
189+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
190+Accept: image/png,image/*;q=0.8,*/*;q=0.5
191+Accept-Language: en-us,en;q=0.5
192+Accept-Encoding: gzip, deflate
193+Connection: keep-alive
194+Referer: http://www.reddit.com/
195+
196+GET /zT4yQmDxQLbIxK1b.jpg HTTP/1.1
197+Host: c.thumbs.redditmedia.com
198+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
199+Accept: image/png,image/*;q=0.8,*/*;q=0.5
200+Accept-Language: en-us,en;q=0.5
201+Accept-Encoding: gzip, deflate
202+Connection: keep-alive
203+Referer: http://www.reddit.com/
204+
205+GET /L5e1HcZLv1iu4nrG.jpg HTTP/1.1
206+Host: f.thumbs.redditmedia.com
207+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
208+Accept: image/png,image/*;q=0.8,*/*;q=0.5
209+Accept-Language: en-us,en;q=0.5
210+Accept-Encoding: gzip, deflate
211+Connection: keep-alive
212+Referer: http://www.reddit.com/
213+
214+GET /WJFFPxD8X4JO_lIG.jpg HTTP/1.1
215+Host: f.thumbs.redditmedia.com
216+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
217+Accept: image/png,image/*;q=0.8,*/*;q=0.5
218+Accept-Language: en-us,en;q=0.5
219+Accept-Encoding: gzip, deflate
220+Connection: keep-alive
221+Referer: http://www.reddit.com/
222+
223+GET /hVMVTDdjuY3bQox5.jpg HTTP/1.1
224+Host: f.thumbs.redditmedia.com
225+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
226+Accept: image/png,image/*;q=0.8,*/*;q=0.5
227+Accept-Language: en-us,en;q=0.5
228+Accept-Encoding: gzip, deflate
229+Connection: keep-alive
230+Referer: http://www.reddit.com/
231+
232+GET /rnWf8CjBcyPQs5y_.jpg HTTP/1.1
233+Host: f.thumbs.redditmedia.com
234+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
235+Accept: image/png,image/*;q=0.8,*/*;q=0.5
236+Accept-Language: en-us,en;q=0.5
237+Accept-Encoding: gzip, deflate
238+Connection: keep-alive
239+Referer: http://www.reddit.com/
240+
241+GET /gZJL1jNylKbGV4d-.jpg HTTP/1.1
242+Host: d.thumbs.redditmedia.com
243+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
244+Accept: image/png,image/*;q=0.8,*/*;q=0.5
245+Accept-Language: en-us,en;q=0.5
246+Accept-Encoding: gzip, deflate
247+Connection: keep-alive
248+Referer: http://www.reddit.com/
249+
250+GET /aNd2zNRLXiMnKUFh.jpg HTTP/1.1
251+Host: c.thumbs.redditmedia.com
252+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
253+Accept: image/png,image/*;q=0.8,*/*;q=0.5
254+Accept-Language: en-us,en;q=0.5
255+Accept-Encoding: gzip, deflate
256+Connection: keep-alive
257+Referer: http://www.reddit.com/
258+
259+GET /droparrowgray.gif HTTP/1.1
260+Host: www.redditstatic.com
261+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
262+Accept: image/png,image/*;q=0.8,*/*;q=0.5
263+Accept-Language: en-us,en;q=0.5
264+Accept-Encoding: gzip, deflate
265+Connection: keep-alive
266+Referer: http://www.redditstatic.com/reddit.v_EZwRzV-Ns.css
267+
268+GET /sprite-reddit.an0Lnf61Ap4.png HTTP/1.1
269+Host: www.redditstatic.com
270+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
271+Accept: image/png,image/*;q=0.8,*/*;q=0.5
272+Accept-Language: en-us,en;q=0.5
273+Accept-Encoding: gzip, deflate
274+Connection: keep-alive
275+Referer: http://www.redditstatic.com/reddit.v_EZwRzV-Ns.css
276+
277+GET /ga.js HTTP/1.1
278+Host: www.google-analytics.com
279+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
280+Accept: */*
281+Accept-Language: en-us,en;q=0.5
282+Accept-Encoding: gzip, deflate
283+Connection: keep-alive
284+Referer: http://www.reddit.com/
285+If-Modified-Since: Tue, 29 Oct 2013 19:33:51 GMT
286+
287+GET /reddit/ads.html?sr=-reddit.com&bust2 HTTP/1.1
288+Host: static.adzerk.net
289+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
290+Accept: text/html,application/xhtml+xml,application/xml;q=0.9,*/*;q=0.8
291+Accept-Language: en-us,en;q=0.5
292+Accept-Encoding: gzip, deflate
293+Connection: keep-alive
294+Referer: http://www.reddit.com/
295+
296+GET /pixel/of_destiny.png?v=hOlmDALJCWWdjzfBV4ZxJPmrdCLWB%2Ftq7Z%2Ffp4Q%2FxXbVPPREuMJMVGzKraTuhhNWxCCwi6yFEZg%3D&r=783333388 HTTP/1.1
297+Host: pixel.redditmedia.com
298+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
299+Accept: image/png,image/*;q=0.8,*/*;q=0.5
300+Accept-Language: en-us,en;q=0.5
301+Accept-Encoding: gzip, deflate
302+Connection: keep-alive
303+Referer: http://www.reddit.com/
304+
305+GET /UNcO-h_QcS9PD-Gn.jpg HTTP/1.1
306+Host: c.thumbs.redditmedia.com
307+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
308+Accept: image/png,image/*;q=0.8,*/*;q=0.5
309+Accept-Language: en-us,en;q=0.5
310+Accept-Encoding: gzip, deflate
311+Connection: keep-alive
312+Referer: http://e.thumbs.redditmedia.com/rZ_rD5TjrJM0E9Aj.css
313+
314+GET /welcome-lines.png HTTP/1.1
315+Host: www.redditstatic.com
316+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
317+Accept: image/png,image/*;q=0.8,*/*;q=0.5
318+Accept-Language: en-us,en;q=0.5
319+Accept-Encoding: gzip, deflate
320+Connection: keep-alive
321+Referer: http://www.redditstatic.com/reddit.v_EZwRzV-Ns.css
322+
323+GET /welcome-upvote.png HTTP/1.1
324+Host: www.redditstatic.com
325+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
326+Accept: image/png,image/*;q=0.8,*/*;q=0.5
327+Accept-Language: en-us,en;q=0.5
328+Accept-Encoding: gzip, deflate
329+Connection: keep-alive
330+Referer: http://www.redditstatic.com/reddit.v_EZwRzV-Ns.css
331+
332+GET /__utm.gif?utmwv=5.5.1&utms=1&utmn=720496082&utmhn=www.reddit.com&utme=8(site*srpath*usertype*uitype)9(%20reddit.com*%20reddit.com-GET_listing*guest*web)11(3!2)&utmcs=UTF-8&utmsr=2560x1600&utmvp=1288x792&utmsc=24-bit&utmul=en-us&utmje=1&utmfl=13.0%20r0&utmdt=reddit%3A%20the%20front%20page%20of%20the%20internet&utmhid=2129416330&utmr=-&utmp=%2F&utmht=1400862512705&utmac=UA-12131688-1&utmcc=__utma%3D55650728.585571751.1400862513.1400862513.1400862513.1%3B%2B__utmz%3D55650728.1400862513.1.1.utmcsr%3D(direct)%7Cutmccn%3D(direct)%7Cutmcmd%3D(none)%3B&utmu=qR~ HTTP/1.1
333+Host: www.google-analytics.com
334+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
335+Accept: image/png,image/*;q=0.8,*/*;q=0.5
336+Accept-Language: en-us,en;q=0.5
337+Accept-Encoding: gzip, deflate
338+Connection: keep-alive
339+Referer: http://www.reddit.com/
340+
341+GET /ImnpOQhbXUPkwceN.png HTTP/1.1
342+Host: a.thumbs.redditmedia.com
343+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
344+Accept: image/png,image/*;q=0.8,*/*;q=0.5
345+Accept-Language: en-us,en;q=0.5
346+Accept-Encoding: gzip, deflate
347+Connection: keep-alive
348+Referer: http://www.reddit.com/
349+
350+GET /ajax/libs/jquery/1.7.1/jquery.min.js HTTP/1.1
351+Host: ajax.googleapis.com
352+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
353+Accept: */*
354+Accept-Language: en-us,en;q=0.5
355+Accept-Encoding: gzip, deflate
356+Connection: keep-alive
357+Referer: http://static.adzerk.net/reddit/ads.html?sr=-reddit.com&bust2
358+
359+GET /__utm.gif?utmwv=5.5.1&utms=2&utmn=1493472678&utmhn=www.reddit.com&utmt=event&utme=5(AdBlock*enabled*false)(0)8(site*srpath*usertype*uitype)9(%20reddit.com*%20reddit.com-GET_listing*guest*web)11(3!2)&utmcs=UTF-8&utmsr=2560x1600&utmvp=1288x792&utmsc=24-bit&utmul=en-us&utmje=1&utmfl=13.0%20r0&utmdt=reddit%3A%20the%20front%20page%20of%20the%20internet&utmhid=2129416330&utmr=-&utmp=%2F&utmht=1400862512708&utmac=UA-12131688-1&utmni=1&utmcc=__utma%3D55650728.585571751.1400862513.1400862513.1400862513.1%3B%2B__utmz%3D55650728.1400862513.1.1.utmcsr%3D(direct)%7Cutmccn%3D(direct)%7Cutmcmd%3D(none)%3B&utmu=6R~ HTTP/1.1
360+Host: www.google-analytics.com
361+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
362+Accept: image/png,image/*;q=0.8,*/*;q=0.5
363+Accept-Language: en-us,en;q=0.5
364+Accept-Encoding: gzip, deflate
365+Connection: keep-alive
366+Referer: http://www.reddit.com/
367+
368+GET /ados.js?q=43 HTTP/1.1
369+Host: secure.adzerk.net
370+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
371+Accept: */*
372+Accept-Language: en-us,en;q=0.5
373+Accept-Encoding: gzip, deflate
374+Connection: keep-alive
375+Referer: http://static.adzerk.net/reddit/ads.html?sr=-reddit.com&bust2
376+
377+GET /fetch-trackers?callback=jQuery111005268222517967478_1400862512407&ids%5B%5D=t3_25jzeq-t8_k2ii&_=1400862512408 HTTP/1.1
378+Host: tracker.redditmedia.com
379+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
380+Accept: */*
381+Accept-Language: en-us,en;q=0.5
382+Accept-Encoding: gzip, deflate
383+Connection: keep-alive
384+Referer: http://www.reddit.com/
385+
386+GET /ados?t=1400862512892&request={%22Placements%22:[{%22A%22:5146,%22S%22:24950,%22D%22:%22main%22,%22AT%22:5},{%22A%22:5146,%22S%22:24950,%22D%22:%22sponsorship%22,%22AT%22:8}],%22Keywords%22:%22-reddit.com%22,%22Referrer%22:%22http%3A%2F%2Fwww.reddit.com%2F%22,%22IsAsync%22:true,%22WriteResults%22:true} HTTP/1.1
387+Host: engine.adzerk.net
388+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
389+Accept: */*
390+Accept-Language: en-us,en;q=0.5
391+Accept-Encoding: gzip, deflate
392+Connection: keep-alive
393+Referer: http://static.adzerk.net/reddit/ads.html?sr=-reddit.com&bust2
394+
395+GET /pixel/of_doom.png?id=t3_25jzeq-t8_k2ii&hash=da31d967485cdbd459ce1e9a5dde279fef7fc381&r=1738649500 HTTP/1.1
396+Host: pixel.redditmedia.com
397+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
398+Accept: image/png,image/*;q=0.8,*/*;q=0.5
399+Accept-Language: en-us,en;q=0.5
400+Accept-Encoding: gzip, deflate
401+Connection: keep-alive
402+Referer: http://www.reddit.com/
403+
404+GET /Extensions/adFeedback.js HTTP/1.1
405+Host: static.adzrk.net
406+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
407+Accept: */*
408+Accept-Language: en-us,en;q=0.5
409+Accept-Encoding: gzip, deflate
410+Connection: keep-alive
411+Referer: http://static.adzerk.net/reddit/ads.html?sr=-reddit.com&bust2
412+
413+GET /Extensions/adFeedback.css HTTP/1.1
414+Host: static.adzrk.net
415+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
416+Accept: text/css,*/*;q=0.1
417+Accept-Language: en-us,en;q=0.5
418+Accept-Encoding: gzip, deflate
419+Connection: keep-alive
420+Referer: http://static.adzerk.net/reddit/ads.html?sr=-reddit.com&bust2
421+
422+GET /reddit/ads-load.html?bust2 HTTP/1.1
423+Host: static.adzerk.net
424+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
425+Accept: text/html,application/xhtml+xml,application/xml;q=0.9,*/*;q=0.8
426+Accept-Language: en-us,en;q=0.5
427+Accept-Encoding: gzip, deflate
428+Connection: keep-alive
429+Referer: http://www.reddit.com/
430+
431+GET /Advertisers/a774d7d6148046efa89403a8db635a81.jpg HTTP/1.1
432+Host: static.adzerk.net
433+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
434+Accept: image/png,image/*;q=0.8,*/*;q=0.5
435+Accept-Language: en-us,en;q=0.5
436+Accept-Encoding: gzip, deflate
437+Connection: keep-alive
438+Referer: http://static.adzerk.net/reddit/ads.html?sr=-reddit.com&bust2
439+
440+GET /i.gif?e=eyJhdiI6NjIzNTcsImF0Ijo1LCJjbSI6MTE2MzUxLCJjaCI6Nzk4NCwiY3IiOjMzNzAxNSwiZGkiOiI4NmI2Y2UzYWM5NDM0MjhkOTk2ZTg4MjYwZDE5ZTE1YyIsImRtIjoxLCJmYyI6NDE2MTI4LCJmbCI6MjEwNDY0LCJrdyI6Ii1yZWRkaXQuY29tIiwibWsiOiItcmVkZGl0LmNvbSIsIm53Ijo1MTQ2LCJwYyI6MCwicHIiOjIwMzYyLCJydCI6MSwicmYiOiJodHRwOi8vd3d3LnJlZGRpdC5jb20vIiwic3QiOjI0OTUwLCJ1ayI6InVlMS01ZWIwOGFlZWQ5YTc0MDFjOTE5NWNiOTMzZWI3Yzk2NiIsInRzIjoxNDAwODYyNTkzNjQ1fQ&s=lwlbFf2Uywt7zVBFRj_qXXu7msY HTTP/1.1
441+Host: engine.adzerk.net
442+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
443+Accept: image/png,image/*;q=0.8,*/*;q=0.5
444+Accept-Language: en-us,en;q=0.5
445+Accept-Encoding: gzip, deflate
446+Connection: keep-alive
447+Referer: http://static.adzerk.net/reddit/ads.html?sr=-reddit.com&bust2
448+Cookie: azk=ue1-5eb08aeed9a7401c9195cb933eb7c966
449+
450+GET /BurstingPipe/adServer.bs?cn=tf&c=19&mc=imp&pli=9994987&PluID=0&ord=1400862593644&rtu=-1 HTTP/1.1
451+Host: bs.serving-sys.com
452+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
453+Accept: image/png,image/*;q=0.8,*/*;q=0.5
454+Accept-Language: en-us,en;q=0.5
455+Accept-Encoding: gzip, deflate
456+Connection: keep-alive
457+Referer: http://static.adzerk.net/reddit/ads.html?sr=-reddit.com&bust2
458+
459+GET /Advertisers/63cfd0044ffd49c0a71a6626f7a1d8f0.jpg HTTP/1.1
460+Host: static.adzerk.net
461+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
462+Accept: image/png,image/*;q=0.8,*/*;q=0.5
463+Accept-Language: en-us,en;q=0.5
464+Accept-Encoding: gzip, deflate
465+Connection: keep-alive
466+Referer: http://static.adzerk.net/reddit/ads-load.html?bust2
467+
468+GET /BurstingPipe/adServer.bs?cn=tf&c=19&mc=imp&pli=9962555&PluID=0&ord=1400862593645&rtu=-1 HTTP/1.1
469+Host: bs.serving-sys.com
470+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
471+Accept: image/png,image/*;q=0.8,*/*;q=0.5
472+Accept-Language: en-us,en;q=0.5
473+Accept-Encoding: gzip, deflate
474+Connection: keep-alive
475+Referer: http://static.adzerk.net/reddit/ads-load.html?bust2
476+Cookie: S_9994987=6754579095859875029; A4=01fmFvgRnI09SF00000; u2=d1263d39-874b-4a89-86cd-a2ab0860ed4e3Zl040
477+
478+GET /i.gif?e=eyJhdiI6NjIzNTcsImF0Ijo4LCJjbSI6MTE2MzUxLCJjaCI6Nzk4NCwiY3IiOjMzNzAxOCwiZGkiOiI3OTdlZjU3OWQ5NjE0ODdiODYyMGMyMGJkOTE4YzNiMSIsImRtIjoxLCJmYyI6NDE2MTMxLCJmbCI6MjEwNDY0LCJrdyI6Ii1yZWRkaXQuY29tIiwibWsiOiItcmVkZGl0LmNvbSIsIm53Ijo1MTQ2LCJwYyI6MCwicHIiOjIwMzYyLCJydCI6MSwicmYiOiJodHRwOi8vd3d3LnJlZGRpdC5jb20vIiwic3QiOjI0OTUwLCJ1ayI6InVlMS01ZWIwOGFlZWQ5YTc0MDFjOTE5NWNiOTMzZWI3Yzk2NiIsInRzIjoxNDAwODYyNTkzNjQ2fQ&s=OjzxzXAgQksbdQOHNm-bjZcnZPA HTTP/1.1
479+Host: engine.adzerk.net
480+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
481+Accept: image/png,image/*;q=0.8,*/*;q=0.5
482+Accept-Language: en-us,en;q=0.5
483+Accept-Encoding: gzip, deflate
484+Connection: keep-alive
485+Referer: http://static.adzerk.net/reddit/ads-load.html?bust2
486+Cookie: azk=ue1-5eb08aeed9a7401c9195cb933eb7c966
487+
488+GET /subscribe?host_int=1042356184&ns_map=571794054_374233948806,464381511_13349283399&user_id=245722467&nid=1399334269710011966&ts=1400862514 HTTP/1.1
489+Host: notify8.dropbox.com
490+Accept-Encoding: identity
491+Connection: keep-alive
492+X-Dropbox-Locale: en_US
493+User-Agent: DropboxDesktopClient/2.7.54 (Macintosh; 10.8; ('i32',); en_US)
494+
examples/rfc2616.c+27−21
@@ -1,21 +1,22 @@
1/*
1/*
2− * This is a simple driver for Ryan Dahl's hand-bummed C http-parser
2+ * This is a simple driver for the http-parser package. It is
3− * package. It is intended to read one HTTP request after another
3+ * intended to read one HTTP request after another from a file,
4− * from a file, nothing more.
4+ * nothing more.
5 *
5 *
6 * For "feature parity" with the Haskell code in RFC2616.hs, we
6 * For "feature parity" with the Haskell code in RFC2616.hs, we
7 * allocate and populate a simple structure describing each request,
7 * allocate and populate a simple structure describing each request,
8 * since that's the sort of thing that many real applications would
8 * since that's the sort of thing that many real applications would
9 * themselves do and the library doesn't do this for us.
9 * themselves do and the library doesn't do this for us.
10 *
10 *
11− * For the http-parser source, see http://github.com/ry/http-parser/
11+ * For the http-parser source, see
12+ * https://github.com/joyent/http-parser/blob/master/http_parser.c
12 */
13 */
13
14
14/*
15/*
15 * Turn off this preprocessor symbol to have the callbacks do nothing
16 * Turn off this preprocessor symbol to have the callbacks do nothing
16 * at all, which "improves performance" by about 50%.
17 * at all, which "improves performance" by about 50%.
17 */
18 */
18−#define LOOK_BUSY
19+/*#define LOOK_BUSY*/
19
20
20#include <assert.h>
21#include <assert.h>
21#include <fcntl.h>
22#include <fcntl.h>
@@ -27,18 +28,18 @@
27#include <unistd.h>
28#include <unistd.h>
28
29
29#include "http_parser.h"
30#include "http_parser.h"
30−
31+
31struct http_string {
32struct http_string {
32 size_t len;
33 size_t len;
33 char value[0];
34 char value[0];
34};
35};
35−
36+
36struct http_header {
37struct http_header {
37 struct http_string *name;
38 struct http_string *name;
38 struct http_string *value;
39 struct http_string *value;
39 struct http_header *next;
40 struct http_header *next;
40};
41};
41−
42+
42struct http_request {
43struct http_request {
43 struct http_string *method;
44 struct http_string *method;
44 struct http_string *uri;
45 struct http_string *uri;
@@ -49,7 +50,7 @@ struct data {
49 size_t count;
50 size_t count;
50 struct http_request req;
51 struct http_request req;
51};
52};
52−
53+
53static void *xmalloc(size_t size)
54static void *xmalloc(size_t size)
54{
55{
55 void *ptr;
56 void *ptr;
@@ -78,7 +79,7 @@ static void xstrcat(struct http_string **dst, const char *src, size_t len)
78 *dst = xstrdup(src, len, 0);
79 *dst = xstrdup(src, len, 0);
79 return;
80 return;
80 }
81 }
81−
82+
82 p = xstrdup((*dst)->value, (*dst)->len, len);
83 p = xstrdup((*dst)->value, (*dst)->len, len);
83 memcpy(p->value + (*dst)->len, src, len);
84 memcpy(p->value + (*dst)->len, src, len);
84 p->len += len;
85 p->len += len;
@@ -98,7 +99,7 @@ static int begin(http_parser *p)
98static int url(http_parser *p, const char *at, size_t len)
99static int url(http_parser *p, const char *at, size_t len)
99{
100{
100#ifdef LOOK_BUSY
101#ifdef LOOK_BUSY
101− struct data *data = p->data;
102+ struct data *data = p->data;
102
103
103 xstrcat(&data->req.uri, at, len);
104 xstrcat(&data->req.uri, at, len);
104#endif
105#endif
@@ -119,7 +120,7 @@ static int header_field(http_parser *p, const char *at, size_t len)
119 hdr->name = xstrdup(at, len, 0);
120 hdr->name = xstrdup(at, len, 0);
120 hdr->value = NULL;
121 hdr->value = NULL;
121 hdr->next = NULL;
122 hdr->next = NULL;
122−
123+
123 if (data->req.last != NULL)
124 if (data->req.last != NULL)
124 data->req.last->next = hdr;
125 data->req.last->next = hdr;
125 data->req.last = hdr;
126 data->req.last = hdr;
@@ -150,7 +151,7 @@ static int complete(http_parser *p)
150
151
151 free(data->req.method);
152 free(data->req.method);
152 free(data->req.uri);
153 free(data->req.uri);
153−
154+
154 for (hdr = data->req.headers; hdr != NULL; hdr = next) {
155 for (hdr = data->req.headers; hdr != NULL; hdr = next) {
155 next = hdr->next;
156 next = hdr->next;
156 free(hdr->name);
157 free(hdr->name);
@@ -164,7 +165,7 @@ static int complete(http_parser *p)
164 data->req.headers = NULL;
165 data->req.headers = NULL;
165 data->req.last = NULL;
166 data->req.last = NULL;
166#endif
167#endif
167−
168+
168 /* Bludgeon http_parser into understanding that we really want to
169 /* Bludgeon http_parser into understanding that we really want to
169 * keep parsing after a request that in principle ought to close
170 * keep parsing after a request that in principle ought to close
170 * the "connection". */
171 * the "connection". */
@@ -180,16 +181,21 @@ static int complete(http_parser *p)
180static void parse(const char *path, int fd)
181static void parse(const char *path, int fd)
181{
182{
182 struct data data;
183 struct data data;
184+ http_parser_settings s;
183 http_parser p;
185 http_parser p;
184 ssize_t nread;
186 ssize_t nread;
185
187
186− http_parser_init(&p, HTTP_REQUEST);
188+ memset(&s, 0, sizeof(s));
187− p.on_message_begin = begin;
189+ s.on_message_begin = begin;
188− p.on_url = url;
190+ s.on_url = url;
189− p.on_header_field = header_field;
191+ s.on_header_field = header_field;
190− p.on_header_value = header_value;
192+ s.on_header_value = header_value;
191− p.on_message_complete = complete;
193+ s.on_message_complete = complete;
194+
192 p.data = &data;
195 p.data = &data;
196+
197+ http_parser_init(&p, HTTP_REQUEST);
198+
193 data.count = 0;
199 data.count = 0;
194 data.req.method = NULL;
200 data.req.method = NULL;
195 data.req.uri = NULL;
201 data.req.uri = NULL;
@@ -202,7 +208,7 @@ static void parse(const char *path, int fd)
202
208
203 nread = read(fd, buf, sizeof(buf));
209 nread = read(fd, buf, sizeof(buf));
204
210
205− np = http_parser_execute(&p, buf, nread);
211+ np = http_parser_execute(&p, &s, buf, nread);
206 if (np != nread) {
212 if (np != nread) {
207 fprintf(stderr, "%s: parse failed\n", path);
213 fprintf(stderr, "%s: parse failed\n", path);
208 break;
214 break;
tests/Makefiledeleted−14
@@ -1,14 +0,0 @@
1−all: TestFastSet.out qc.out
2−
3−%.out: %.exe
4− ./$< | tee $<.tmp
5− mv $<.tmp $@
6−
7−qc.exe: QC.hs
8− ghc -O -fno-warn-orphans --make -o $@ $<
9−
10−%.exe: %.hs
11− ghc -O -fno-warn-orphans --make -o $@ $<
12−
13−clean:
14− -rm -f *.hi *.o *.exe *.out
tests/QC.hs+13−102
@@ -1,108 +1,19 @@
1−{-# LANGUAGE OverloadedStrings #-}
2−{-# OPTIONS_GHC -fno-warn-orphans #-}
1+{-# OPTIONS_GHC -fno-warn-missing-signatures #-}
3module Main (main) where
2module Main (main) where
4
3
5−import Control.Applicative ((<$>))
4+import qualified QC.Buffer as Buffer
6−import Prelude hiding (takeWhile)
5+import qualified QC.ByteString as ByteString
6+import qualified QC.Combinator as Combinator
7+import qualified QC.Simple as Simple
8+import qualified QC.Text as Text
7−import Test.Framework (defaultMain, testGroup)
9+import Test.Tasty (defaultMain, testGroup)
8−import Test.Framework.Providers.QuickCheck2 (testProperty)
9−import Test.QuickCheck
10−import qualified Data.Attoparsec as P
11−import qualified Data.ByteString as B
12−import qualified Data.ByteString as S
13−import qualified Data.ByteString.Lazy as L
14−
15−instance Arbitrary S.ByteString where
16− arbitrary = S.pack <$> arbitrary
17−
18−instance Arbitrary L.ByteString where
19− arbitrary = sized $ \n -> resize (round (sqrt (toEnum n :: Double)))
20− ((L.fromChunks . map (S.pack . nonEmpty)) <$> arbitrary)
21− where nonEmpty (NonEmpty a) = a
22−
23−-- Naming.
24−
25−{-
26−label (NonEmpty s) = case parse (anyWord8 <?> s) B.empty of
27− (_, Left err) -> s `isInfixOf` err
28− _ -> False
29−-}
30−
31−-- Basic byte-level combinators.
32−
33−maybeP p s = case P.parse p s `P.feed` B.empty of
34− P.Done _ i -> Just i
35− _ -> Nothing
36−
37−defP p s = P.parse p s `P.feed` B.empty
38−
39−satisfy w s = maybeP (P.satisfy (<=w)) (B.cons w s) == Just w
40−
41−word8 w s = maybeP (P.word8 w) (B.cons w s) == Just w
42−
43−anyWord8 s = maybeP P.anyWord8 s == if B.null s
44− then Nothing
45− else Just (B.head s)
46−
47−notWord8 w (NonEmpty s) = maybeP (P.notWord8 w) bs == if v == w
48− then Nothing
49− else Just v
50− where v = B.head bs
51− bs = B.pack s
52−
53−string s = maybeP (P.string s) s == Just s
54−
55−skipWhile w s =
56− let t = B.dropWhile (<=w) s
57− in case defP (P.skipWhile (<=w)) s of
58− P.Done t' () -> t == t'
59− _ -> False
60−
61−takeCount (Positive k) s =
62− case maybeP (P.take k) s of
63− Nothing -> k > B.length s
64− Just s' -> k <= B.length s
65−
66−takeWhile w s =
67− let (h,t) = B.span (==w) s
68− in case defP (P.takeWhile (==w)) s of
69− P.Done t' h' -> t == t' && h == h'
70− _ -> False
71−
72−takeWhile1 w s =
73− let s' = B.cons w s
74− (h,t) = B.span (<=w) s'
75− in case defP (P.takeWhile1 (<=w)) s' of
76− P.Done t' h' -> t == t' && h == h'
77− _ -> False
78−
79−takeTill w s =
80− let (h,t) = B.break (==w) s
81− in case defP (P.takeTill (==w)) s of
82− P.Done t' h' -> t == t' && h == h'
83− _ -> False
84−
85−takeWhile1_empty = maybeP (P.takeWhile1 undefined) B.empty == Nothing
86−
87−endOfInput s = maybeP P.endOfInput s == if B.null s
88− then Just ()
89− else Nothing
90
10
91main = defaultMain tests
11main = defaultMain tests
92
12
93−tests = [
94− testGroup "fnord" [
13+tests = testGroup "tests" [
95− testProperty "satisfy" satisfy,
14+ testGroup "bs" ByteString.tests
96− testProperty "word8" word8,
15+ , testGroup "buf" Buffer.tests
97− testProperty "notWord8" notWord8,
16+ , testGroup "combinator" Combinator.tests
98− testProperty "anyWord8" anyWord8,
17+ , testGroup "simple" Simple.tests
99− testProperty "string" string,
18+ , testGroup "text" Text.tests
100− testProperty "skipWhile" skipWhile,
101− testProperty "takeCount" takeCount,
102− testProperty "takeWhile" takeWhile,
103− testProperty "takeWhile1" takeWhile1,
104− testProperty "takeWhile1_empty" takeWhile1_empty,
105− testProperty "takeTill" takeTill,
106− testProperty "endOfInput" endOfInput
107− ]
108 ]
19 ]
tests/QC/Buffer.hsnew file+96
@@ -0,0 +1,96 @@
1+{-# LANGUAGE BangPatterns, CPP, FlexibleInstances, OverloadedStrings,
2+ TypeSynonymInstances #-}
3+
4+module QC.Buffer (tests) where
5+
6+#if !MIN_VERSION_base(4,8,0)
7+import Control.Applicative ((<$>))
8+import Data.Monoid (Monoid(mconcat))
9+#endif
10+import QC.Common ()
11+import Test.Tasty (TestTree)
12+import Test.Tasty.QuickCheck (testProperty)
13+import Test.QuickCheck
14+import qualified Data.Attoparsec.ByteString.Buffer as BB
15+import qualified Data.Attoparsec.Text.Buffer as BT
16+import qualified Data.ByteString as B
17+import qualified Data.ByteString.Unsafe as B
18+import qualified Data.Text as T
19+import qualified Data.Text.Unsafe as T
20+
21+data BP t b = BP [t] !t !b
22+ deriving (Eq, Show)
23+
24+type BPB = BP B.ByteString BB.Buffer
25+type BPT = BP T.Text BT.Buffer
26+
27+instance Arbitrary BPB where
28+ arbitrary = do
29+ bss <- arbitrary
30+ return $! toBP BB.buffer bss
31+
32+ shrink (BP bss _ _) = toBP BB.buffer <$> shrink bss
33+
34+instance Arbitrary BPT where
35+ arbitrary = do
36+ bss <- arbitrary
37+ return $! toBP BT.buffer bss
38+
39+ shrink (BP bss _ _) = toBP BT.buffer <$> shrink bss
40+
41+toBP :: (Monoid a, Monoid b) => (a -> b) -> [a] -> BP a b
42+toBP buf bss = BP bss (mconcat bss) (mconcat (map buf bss))
43+
44+b_unbuffer :: BPB -> Property
45+b_unbuffer (BP _ts t buf) = t === BB.unbuffer buf
46+
47+t_unbuffer :: BPT -> Property
48+t_unbuffer (BP _ts t buf) = t === BT.unbuffer buf
49+
50+b_length :: BPB -> Property
51+b_length (BP _ts t buf) = B.length t === BB.length buf
52+
53+t_length :: BPT -> Property
54+t_length (BP _ts t buf) = T.lengthWord16 t === BT.length buf
55+
56+b_unsafeIndex :: BPB -> Gen Property
57+b_unsafeIndex (BP _ts t buf) = do
58+ let l = B.length t
59+ i <- choose (0,l-1)
60+ return $ l === 0 .||. B.unsafeIndex t i === BB.unsafeIndex buf i
61+
62+t_iter :: BPT -> Gen Property
63+t_iter (BP _ts t buf) = do
64+ let l = T.lengthWord16 t
65+ i <- choose (0,l-1)
66+ let it (T.Iter c q) = (c,q)
67+ return $ l === 0 .||. it (T.iter t i) === it (BT.iter buf i)
68+
69+t_iter_ :: BPT -> Gen Property
70+t_iter_ (BP _ts t buf) = do
71+ let l = T.lengthWord16 t
72+ i <- choose (0,l-1)
73+ return $ l === 0 .||. T.iter_ t i === BT.iter_ buf i
74+
75+b_unsafeDrop :: BPB -> Gen Property
76+b_unsafeDrop (BP _ts t buf) = do
77+ i <- choose (0, B.length t)
78+ return $ B.unsafeDrop i t === BB.unsafeDrop i buf
79+
80+t_dropWord16 :: BPT -> Gen Property
81+t_dropWord16 (BP _ts t buf) = do
82+ i <- choose (0, T.lengthWord16 t)
83+ return $ T.dropWord16 i t === BT.dropWord16 i buf
84+
85+tests :: [TestTree]
86+tests = [
87+ testProperty "b_unbuffer" b_unbuffer
88+ , testProperty "t_unbuffer" t_unbuffer
89+ , testProperty "b_length" b_length
90+ , testProperty "t_length" t_length
91+ , testProperty "b_unsafeIndex" b_unsafeIndex
92+ , testProperty "t_iter" t_iter
93+ , testProperty "t_iter_" t_iter_
94+ , testProperty "b_unsafeDrop" b_unsafeDrop
95+ , testProperty "t_dropWord16" t_dropWord16
96+ ]
tests/QC/ByteString.hsnew file+187
@@ -0,0 +1,187 @@
1+{-# LANGUAGE BangPatterns, CPP, OverloadedStrings #-}
2+module QC.ByteString (tests) where
3+
4+#if !MIN_VERSION_base(4,8,0)
5+import Control.Applicative ((<*>), (<$>))
6+#endif
7+import Data.Char (chr, ord, toUpper)
8+import Data.Int (Int64)
9+import Data.Word (Word8)
10+import Prelude hiding (take, takeWhile)
11+import QC.Common (ASCII(..), liftOp, parseBS, toStrictBS)
12+import Test.Tasty (TestTree)
13+import Test.Tasty.QuickCheck (testProperty)
14+import Test.QuickCheck
15+import qualified Data.Attoparsec.ByteString as P
16+import qualified Data.Attoparsec.ByteString.Char8 as P8
17+import qualified Data.Attoparsec.ByteString.FastSet as S
18+import qualified Data.Attoparsec.ByteString.Lazy as PL
19+import qualified Data.ByteString as B
20+import qualified Data.ByteString.Char8 as B8
21+import qualified Data.ByteString.Lazy as L
22+import qualified Data.ByteString.Lazy.Char8 as L8
23+
24+-- Basic byte-level combinators.
25+
26+satisfy :: Word8 -> L.ByteString -> Property
27+satisfy w s = parseBS (P.satisfy (<=w)) (L.cons w s) === Just w
28+
29+satisfyWith :: Word8 -> L.ByteString -> Property
30+satisfyWith w s = parseBS (P.satisfyWith (chr . fromIntegral) (<=c))
31+ (L.cons (fromIntegral (ord c)) s) === Just c
32+ where
33+ c = chr (fromIntegral w)
34+
35+word8 :: Word8 -> L.ByteString -> Property
36+word8 w s = parseBS (P.word8 w) (L.cons w s) === Just w
37+
38+skip :: Word8 -> L.ByteString -> Property
39+skip w s =
40+ case (parseBS (P.skip (<w)) s, L.uncons s) of
41+ (Nothing, mcs) -> maybe (property True) (expectFailure . it) mcs
42+ (Just _, mcs) -> maybe (property False) it mcs
43+ where it cs = liftOp "<" (<) (fst cs) w
44+
45+anyWord8 :: L.ByteString -> Property
46+anyWord8 s
47+ | L.null s = p === Nothing
48+ | otherwise = p === Just (L.head s)
49+ where p = parseBS P.anyWord8 s
50+
51+notWord8 :: Word8 -> NonEmptyList Word8 -> Property
52+notWord8 w (NonEmpty s) = parseBS (P.notWord8 w) bs === if v == w
53+ then Nothing
54+ else Just v
55+ where v = L.head bs
56+ bs = L.pack s
57+
58+peekWord8 :: L.ByteString -> Property
59+peekWord8 s
60+ | L.null s = p === Just (Nothing, s)
61+ | otherwise = p === Just (Just (L.head s), s)
62+ where p = parseBS ((,) <$> P.peekWord8 <*> P.takeLazyByteString) s
63+
64+peekWord8' :: L.ByteString -> Property
65+peekWord8' s = parseBS P.peekWord8' s === (fst <$> L.uncons s)
66+
67+string :: L.ByteString -> L.ByteString -> Property
68+string s t = parseBS (P.string s') (s `L.append` t) === Just s'
69+ where s' = toStrictBS s
70+
71+stringCI :: ASCII L.ByteString -> ASCII L.ByteString -> Property
72+stringCI (ASCII s) (ASCII t) =
73+ parseBS (P8.stringCI up) (s `L.append` t) === Just s'
74+ where s' = toStrictBS s
75+ up = B8.map toUpper s'
76+
77+strings :: L.ByteString -> L.ByteString -> L.ByteString -> Property
78+strings s t u =
79+ parseBS (P.string (toStrictBS s) >> P.string t') (L.concat [s,t,u])
80+ === Just t'
81+ where t' = toStrictBS t
82+
83+skipWhile :: Word8 -> L.ByteString -> Property
84+skipWhile w s =
85+ let t = L.dropWhile (<=w) s
86+ in case PL.parse (P.skipWhile (<=w)) s of
87+ PL.Done t' () -> t === t'
88+ _ -> property False
89+
90+takeCount :: Positive Int -> L.ByteString -> Property
91+takeCount (Positive k) s =
92+ case parseBS (P.take k) s of
93+ Nothing -> liftOp ">" (>) (fromIntegral k) (L.length s)
94+ Just _s -> liftOp "<=" (<=) (fromIntegral k) (L.length s)
95+
96+takeWhile :: Word8 -> L.ByteString -> Property
97+takeWhile w s =
98+ let (h,t) = L.span (==w) s
99+ in case PL.parse (P.takeWhile (==w)) s of
100+ PL.Done t' h' -> t === t' .&&. toStrictBS h === h'
101+ _ -> property False
102+
103+take :: Int -> L.ByteString -> Property
104+take n s = maybe (property $ L.length s < fromIntegral n)
105+ (=== B.take n (toStrictBS s)) $
106+ parseBS (P.take n) s
107+
108+takeByteString :: L.ByteString -> Property
109+takeByteString s = maybe (property False) (=== toStrictBS s) .
110+ parseBS P.takeByteString $ s
111+
112+takeLazyByteString :: L.ByteString -> Property
113+takeLazyByteString s = maybe (property False) (=== s) .
114+ parseBS P.takeLazyByteString $ s
115+
116+takeWhile1 :: Word8 -> L.ByteString -> Property
117+takeWhile1 w s =
118+ let s' = L.cons w s
119+ (h,t) = L.span (<=w) s'
120+ in case PL.parse (P.takeWhile1 (<=w)) s' of
121+ PL.Done t' h' -> t === t' .&&. toStrictBS h === h'
122+ _ -> property False
123+
124+takeTill :: Word8 -> L.ByteString -> Property
125+takeTill w s =
126+ let (h,t) = L.break (==w) s
127+ in case PL.parse (P.takeTill (==w)) s of
128+ PL.Done t' h' -> t === t' .&&. toStrictBS h === h'
129+ _ -> property False
130+
131+takeWhile1_empty :: Property
132+takeWhile1_empty = parseBS (P.takeWhile1 undefined) L.empty === Nothing
133+
134+endOfInput :: L.ByteString -> Property
135+endOfInput s = parseBS P.endOfInput s === if L.null s
136+ then Just ()
137+ else Nothing
138+
139+endOfLine :: L.ByteString -> Property
140+endOfLine s =
141+ case (parseBS P8.endOfLine s, L8.uncons s) of
142+ (Nothing, mcs) -> maybe (property True) (expectFailure . eol) mcs
143+ (Just _, mcs) -> maybe (property False) eol mcs
144+ where eol (c,s') = c === '\n' .||.
145+ (c, fst <$> L8.uncons s') === ('\r', Just '\n')
146+
147+scan :: L.ByteString -> Positive Int64 -> Property
148+scan s (Positive k) = parseBS p s === Just (toStrictBS $ L.take k s)
149+ where p = P.scan k $ \ n _ ->
150+ if n > 0 then let !n' = n - 1 in Just n' else Nothing
151+
152+members :: [Word8] -> Property
153+members s = property $ all (`S.memberWord8` set) s
154+ where set = S.fromList s
155+
156+nonmembers :: [Word8] -> [Word8] -> Property
157+nonmembers s s' = property . not . any (`S.memberWord8` set) $ filter (not . (`elem` s)) s'
158+ where set = S.fromList s
159+
160+tests :: [TestTree]
161+tests = [
162+ testProperty "anyWord8" anyWord8
163+ , testProperty "endOfInput" endOfInput
164+ , testProperty "endOfLine" endOfLine
165+ , testProperty "notWord8" notWord8
166+ , testProperty "peekWord8" peekWord8
167+ , testProperty "peekWord8'" peekWord8'
168+ , testProperty "satisfy" satisfy
169+ , testProperty "satisfyWith" satisfyWith
170+ , testProperty "scan" scan
171+ , testProperty "skip" skip
172+ , testProperty "skipWhile" skipWhile
173+ , testProperty "string" string
174+ , testProperty "stringCI" stringCI
175+ , testProperty "strings" strings
176+ , testProperty "take" take
177+ , testProperty "takeByteString" takeByteString
178+ , testProperty "takeCount" takeCount
179+ , testProperty "takeLazyByteString" takeLazyByteString
180+ , testProperty "takeTill" takeTill
181+ , testProperty "takeWhile" takeWhile
182+ , testProperty "takeWhile1" takeWhile1
183+ , testProperty "takeWhile1_empty" takeWhile1_empty
184+ , testProperty "word8" word8
185+ , testProperty "members" members
186+ , testProperty "nonmembers" nonmembers
187+ ]
tests/QC/Combinator.hsnew file+52
@@ -0,0 +1,52 @@
1+{-# LANGUAGE CPP, OverloadedStrings #-}
2+
3+module QC.Combinator where
4+
5+#if !MIN_VERSION_base(4,8,0)
6+import Control.Applicative ((<*>), (<$>), (<*), (*>))
7+#endif
8+import Data.Maybe (fromJust, isJust)
9+import Data.Word (Word8)
10+import QC.Common (Repack, parseBS, repackBS, toLazyBS)
11+import Test.Tasty (TestTree)
12+import Test.Tasty.QuickCheck (testProperty)
13+import Test.QuickCheck
14+import qualified Data.Attoparsec.ByteString.Char8 as P
15+import qualified Data.Attoparsec.Combinator as C
16+import qualified Data.ByteString as B
17+import qualified Data.ByteString.Char8 as B8
18+
19+choice :: NonEmptyList (NonEmptyList Word8) -> Gen Property
20+choice (NonEmpty xs) = do
21+ let ys = map (B.pack . getNonEmpty) xs
22+ return . forAll (repackBS <$> arbitrary <*> elements ys) $
23+ maybe False (`elem` ys) . parseBS (C.choice (map P.string ys))
24+
25+count :: Positive (Small Int) -> Repack -> B.ByteString -> Bool
26+count (Positive (Small n)) rs s =
27+ (length <$> parseBS (C.count n (P.string s)) input) == Just n
28+ where input = repackBS rs (B.concat (replicate (n+1) s))
29+
30+lookAhead :: NonEmptyList Word8 -> Bool
31+lookAhead (NonEmpty xs) =
32+ let ys = B.pack xs
33+ withLookAheadThenConsume = (\x y -> (x, y)) <$> C.lookAhead (P.string ys) <*> P.string ys
34+ mr = parseBS withLookAheadThenConsume $ toLazyBS ys
35+ in isJust mr && fst (fromJust mr) == snd (fromJust mr)
36+
37+match :: Int -> NonNegative Int -> NonNegative Int -> Repack -> Bool
38+match n (NonNegative x) (NonNegative y) rs =
39+ parseBS (P.match parser) (repackBS rs input) == Just (input, n)
40+ where parser = P.skipWhile (=='x') *> P.signed P.decimal <*
41+ P.skipWhile (=='y')
42+ input = B.concat [
43+ B8.replicate x 'x', B8.pack (show n), B8.replicate y 'y'
44+ ]
45+
46+tests :: [TestTree]
47+tests = [
48+ testProperty "choice" choice
49+ , testProperty "count" count
50+ , testProperty "lookAhead" lookAhead
51+ , testProperty "match" match
52+ ]
tests/QC/Common.hsnew file+113
@@ -0,0 +1,113 @@
1+{-# LANGUAGE CPP, FlexibleInstances #-}
2+{-# OPTIONS_GHC -fno-warn-orphans #-}
3+module QC.Common
4+ (
5+ ASCII(..)
6+ , parseBS
7+ , parseT
8+ , toLazyBS
9+ , toStrictBS
10+ , Repack
11+ , repackBS
12+ , repackBS_
13+ , repackT
14+ , repackT_
15+ , liftOp
16+ ) where
17+
18+#if !MIN_VERSION_base(4,8,0)
19+import Control.Applicative ((<*>), (<$>))
20+#endif
21+import Data.Char (isAlpha)
22+import Test.QuickCheck
23+import Test.QuickCheck.Unicode (shrinkChar, string)
24+import qualified Data.ByteString as B
25+import qualified Data.ByteString.Lazy as BL
26+import qualified Data.Text as T
27+import qualified Data.Text.Lazy as TL
28+import qualified Data.Attoparsec.ByteString.Lazy as BL
29+import qualified Data.Attoparsec.Text.Lazy as TL
30+
31+#if !MIN_VERSION_base(4,4,0)
32+-- This should really be a dependency on the random package :-(
33+instance Random Word8 where
34+ randomR = integralRandomR
35+ random = randomR (minBound,maxBound)
36+
37+instance Arbitrary Word8 where
38+ arbitrary = choose (minBound, maxBound)
39+#endif
40+
41+parseBS :: BL.Parser r -> BL.ByteString -> Maybe r
42+parseBS p = BL.maybeResult . BL.parse p
43+
44+parseT :: TL.Parser r -> TL.Text -> Maybe r
45+parseT p = TL.maybeResult . TL.parse p
46+
47+toStrictBS :: BL.ByteString -> B.ByteString
48+toStrictBS = B.concat . BL.toChunks
49+
50+toLazyBS :: B.ByteString -> BL.ByteString
51+toLazyBS = BL.fromChunks . (:[])
52+
53+instance Arbitrary B.ByteString where
54+ arbitrary = B.pack <$> arbitrary
55+ shrink = map B.pack . shrink . B.unpack
56+
57+instance Arbitrary BL.ByteString where
58+ arbitrary = repackBS <$> arbitrary <*> arbitrary
59+ shrink = map BL.pack . shrink . BL.unpack
60+
61+newtype ASCII a = ASCII { fromASCII :: a }
62+ deriving (Eq, Ord, Show)
63+
64+instance Arbitrary (ASCII B.ByteString) where
65+ arbitrary = (ASCII . B.pack) <$> listOf (choose (0,127))
66+ shrink = map (ASCII . B.pack) . shrink . B.unpack . fromASCII
67+
68+instance Arbitrary (ASCII BL.ByteString) where
69+ arbitrary = ASCII <$> (repackBS <$> arbitrary <*> (fromASCII <$> arbitrary))
70+ shrink = map (ASCII . BL.pack) . shrink . BL.unpack . fromASCII
71+
72+type Repack = NonEmptyList (Positive (Small Int))
73+
74+repackBS :: Repack -> B.ByteString -> BL.ByteString
75+repackBS (NonEmpty bs) =
76+ BL.fromChunks . repackBS_ (map (getSmall . getPositive) bs)
77+
78+repackBS_ :: [Int] -> B.ByteString -> [B.ByteString]
79+repackBS_ = go . cycle
80+ where go (b:bs) s
81+ | B.null s = []
82+ | otherwise = let (h,t) = B.splitAt b s
83+ in h : go bs t
84+ go _ _ = error "unpossible"
85+
86+instance Arbitrary T.Text where
87+ arbitrary = T.pack <$> string
88+ shrink = map T.pack . shrinkList shrinkChar . T.unpack
89+
90+instance Arbitrary TL.Text where
91+ arbitrary = TL.pack <$> string
92+ shrink = map TL.pack . shrinkList shrinkChar . TL.unpack
93+
94+repackT :: Repack -> T.Text -> TL.Text
95+repackT (NonEmpty bs) =
96+ TL.fromChunks . repackT_ (map (getSmall . getPositive) bs)
97+
98+repackT_ :: [Int] -> T.Text -> [T.Text]
99+repackT_ = go . cycle
100+ where go (b:bs) s
101+ | T.null s = []
102+ | otherwise = let (h,t) = T.splitAt b s
103+ in h : go bs t
104+ go _ _ = error "unpossible"
105+
106+liftOp :: (Show a, Testable prop) =>
107+ String -> (a -> a -> prop) -> a -> a -> Property
108+liftOp name f x y = counterexample desc (f x y)
109+ where op = case name of
110+ (c:_) | isAlpha c -> " `" ++ name ++ "` "
111+ | otherwise -> " " ++ name ++ " "
112+ _ -> " ??? "
113+ desc = "not (" ++ show x ++ op ++ show y ++ ")"
tests/QC/IPv6/Internal.hsnew file+316
@@ -0,0 +1,316 @@
1+-- -----------------------------------------------------------------------------
2+
3+-- |
4+-- Module : Text.IPv6Addr
5+-- Copyright : Copyright © Michel Boucey 2011-2015
6+-- License : BSD-Style
7+-- Maintainer : michel.boucey@gmail.com
8+--
9+-- Dealing with IPv6 address text representations, canonization and manipulations.
10+--
11+
12+-- -----------------------------------------------------------------------------
13+
14+{-# LANGUAGE OverloadedStrings #-}
15+
16+module QC.IPv6.Internal where {-
17+ ( expandTokens
18+ , macAddr
19+ , maybeIPv6AddrTokens
20+ , ipv4AddrToIPv6AddrTokens
21+ , ipv6TokensToText
22+ , ipv6TokensToIPv6Addr
23+ , isIPv6Addr
24+ , maybeTokIPv6Addr
25+ , maybeTokPureIPv6Addr
26+ , fromDoubleColon
27+ , fromIPv6Addr
28+ , toDoubleColon
29+ ) where -}
30+
31+import Debug.Trace
32+import Control.Monad (replicateM)
33+import Data.Attoparsec.Text
34+import Data.Char (isDigit,isHexDigit,toLower)
35+import Data.Monoid ((<>))
36+import Control.Applicative ((<|>),(<*))
37+import Data.List (group,isSuffixOf,elemIndex,elemIndices,intersperse)
38+import Data.Word (Word32)
39+import Numeric (showHex)
40+import qualified Data.Text as T
41+import qualified Data.Text.Read as R (decimal)
42+import Data.Maybe (fromJust)
43+
44+import QC.IPv6.Types
45+
46+tok0 = "0"
47+
48+-- | Returns the 'T.Text' of an IPv6 address.
49+fromIPv6Addr :: IPv6Addr -> T.Text
50+fromIPv6Addr (IPv6Addr t) = t
51+
52+-- | Given an arbitrary list of 'IPv6AddrToken', returns the corresponding 'T.Text'.
53+ipv6TokensToText :: [IPv6AddrToken] -> T.Text
54+ipv6TokensToText l = T.concat $ map ipv6TokenToText l
55+
56+-- | Returns the corresponding 'T.Text' of an IPv6 address token.
57+ipv6TokenToText :: IPv6AddrToken -> T.Text
58+ipv6TokenToText (SixteenBit s) = s
59+ipv6TokenToText Colon = ":"
60+ipv6TokenToText DoubleColon = "::"
61+ipv6TokenToText AllZeros = tok0 -- "A single 16-bit 0000 field MUST be represented as 0" (RFC 5952, 4.1)
62+ipv6TokenToText (IPv4Addr a) = a
63+
64+-- | Returns 'True' if a list of 'IPv6AddrToken' constitutes a valid IPv6 Address.
65+isIPv6Addr :: [IPv6AddrToken] -> Bool
66+isIPv6Addr [] = False
67+isIPv6Addr [DoubleColon] = True
68+isIPv6Addr [DoubleColon,SixteenBit tok1] = True
69+isIPv6Addr tks =
70+ diffNext tks && (do
71+ let cdctks = countDoubleColon tks
72+ let lentks = length tks
73+ let lasttk = last tks
74+ let lenconst = (lentks == 15 && cdctks == 0) || (lentks < 15 && cdctks == 1)
75+ firstValidToken tks &&
76+ (case countIPv4Addr tks of
77+ 0 -> case lasttk of
78+ SixteenBit _ -> lenconst
79+ DoubleColon -> lenconst
80+ AllZeros -> lenconst
81+ _ -> False
82+ 1 -> case lasttk of
83+ IPv4Addr _ -> (lentks == 13 && cdctks == 0) || (lentks < 12 && cdctks == 1)
84+ _ -> False
85+ otherwise -> False))
86+ where diffNext [] = False
87+ diffNext [_] = True
88+ diffNext (t:ts) = do
89+ let h = head ts
90+ case t of
91+ SixteenBit _ -> case h of
92+ SixteenBit _ -> False
93+ AllZeros -> False
94+ _ -> diffNext ts
95+ AllZeros -> case h of
96+ SixteenBit _ -> False
97+ AllZeros -> False
98+ _ -> diffNext ts
99+ _ -> diffNext ts
100+ firstValidToken l =
101+ case head l of
102+ SixteenBit _ -> True
103+ DoubleColon -> True
104+ AllZeros -> True
105+ _ -> False
106+ countDoubleColon l = length $ elemIndices DoubleColon l
107+ tok1 = "1"
108+
109+countIPv4Addr = foldr oneMoreIPv4Addr 0
110+ where
111+ oneMoreIPv4Addr t c = case t of
112+ IPv4Addr _ -> c + 1
113+ otherwise -> c
114+
115+-- | This is the main function which returns 'Just' the list of a tokenized IPv6
116+-- address text representation validated against RFC 4291 and canonized
117+-- in conformation with RFC 5952, or 'Nothing'.
118+maybeTokIPv6Addr :: T.Text -> Maybe [IPv6AddrToken]
119+maybeTokIPv6Addr t =
120+ case maybeIPv6AddrTokens t of
121+ Just ltks -> if isIPv6Addr ltks
122+ then Just $ (ipv4AddrReplacement . toDoubleColon . fromDoubleColon) ltks
123+ else Nothing
124+ Nothing -> Nothing
125+ where
126+ ipv4AddrReplacement ltks =
127+ if ipv4AddrRewrite ltks
128+ then init ltks ++ ipv4AddrToIPv6AddrTokens (last ltks)
129+ else ltks
130+
131+-- | Returns 'Just' the list of tokenized pure IPv6 address, always rewriting an
132+-- embedded IPv4 address if present.
133+maybeTokPureIPv6Addr :: T.Text -> Maybe [IPv6AddrToken]
134+maybeTokPureIPv6Addr t = do
135+ ltks <- maybeIPv6AddrTokens t
136+ if isIPv6Addr ltks
137+ then Just $ (toDoubleColon . ipv4AddrReplacement . fromDoubleColon) ltks
138+ else Nothing
139+ where
140+ ipv4AddrReplacement ltks' = init ltks' ++ ipv4AddrToIPv6AddrTokens (last ltks')
141+
142+-- | Tokenize a 'T.Text' into 'Just' a list of 'IPv6AddrToken', or 'Nothing'.
143+maybeIPv6AddrTokens :: T.Text -> Maybe [IPv6AddrToken]
144+maybeIPv6AddrTokens s =
145+ case readText s of
146+ Done r l -> traceShow (r,l) $ if r==T.empty then Just l else Nothing
147+ Fail {} -> Nothing
148+ where
149+ readText s = feed (parse (many1 $ ipv4Addr <|> sixteenBit <|> doubleColon <|> colon) s) T.empty
150+
151+-- | An embedded IPv4 address have to be rewritten to output a pure IPv6 Address
152+-- text representation in hexadecimal digits. But some well-known prefixed IPv6
153+-- addresses have to keep visible in their text representation the fact that
154+-- they deals with IPv4 to IPv6 transition process (RFC 5952 Section 5):
155+--
156+-- IPv4-compatible IPv6 address like "::1.2.3.4"
157+--
158+-- IPv4-mapped IPv6 address like "::ffff:1.2.3.4"
159+--
160+-- IPv4-translated address like "::ffff:0:1.2.3.4"
161+--
162+-- IPv4-translatable address like "64:ff9b::1.2.3.4"
163+--
164+-- ISATAP address like "fe80::5efe:1.2.3.4"
165+--
166+ipv4AddrRewrite :: [IPv6AddrToken] -> Bool
167+ipv4AddrRewrite tks =
168+ case last tks of
169+ IPv4Addr _ -> do
170+ let itks = init tks
171+ not (itks == [DoubleColon]
172+ || itks == [DoubleColon,SixteenBit tokffff,Colon]
173+ || itks == [DoubleColon,SixteenBit tokffff,Colon,AllZeros,Colon]
174+ || itks == [SixteenBit "64",Colon,SixteenBit "ff9b",DoubleColon]
175+ || [SixteenBit "200",Colon,SixteenBit tok5efe,Colon] `isSuffixOf` itks
176+ || [AllZeros,Colon,SixteenBit tok5efe,Colon] `isSuffixOf` itks
177+ || [DoubleColon,SixteenBit tok5efe,Colon] `isSuffixOf` itks)
178+ _ -> False
179+ where
180+ tokffff = "ffff"
181+ tok5efe = "5efe"
182+
183+-- | Rewrites an embedded 'IPv4Addr' into the corresponding list of pure 'IPv6Addr' tokens.
184+--
185+-- > ipv4AddrToIPv6AddrTokens (IPv4Addr "127.0.0.1") == [SixteenBits "7f0",Colon,SixteenBits "1"]
186+--
187+ipv4AddrToIPv6AddrTokens :: IPv6AddrToken -> [IPv6AddrToken]
188+ipv4AddrToIPv6AddrTokens t =
189+ case t of
190+ IPv4Addr a -> do
191+ let m = toHex a
192+ [ SixteenBit ((!!) m 0 <> addZero ((!!) m 1))
193+ , Colon
194+ , SixteenBit ((!!) m 2 <> addZero ((!!) m 3)) ]
195+ _ -> [t]
196+ where
197+ toHex a = map (\x -> T.pack $ showHex (read (T.unpack x)::Int) "") $ T.split (=='.') a
198+ addZero d = if T.length d == 1 then tok0 <> d else d
199+
200+expandTokens :: [IPv6AddrToken] -> [IPv6AddrToken]
201+expandTokens = map expandToken
202+ where expandToken (SixteenBit s) = SixteenBit $ T.justifyRight 4 '0' s
203+ expandToken AllZeros = SixteenBit "0000"
204+ expandToken t = t
205+
206+fromDoubleColon :: [IPv6AddrToken] -> [IPv6AddrToken]
207+fromDoubleColon tks =
208+ if DoubleColon `notElem` tks
209+ then tks
210+ else do let s = splitAt (fromJust $ elemIndex DoubleColon tks) tks
211+ let fsts = fst s
212+ let snds = if not (null (snd s)) then tail(snd s) else []
213+ let fste = if null fsts then [] else fsts ++ [Colon]
214+ let snde = if null snds then [] else Colon : snds
215+ fste ++ allZerosTokensReplacement(quantityOfAllZerosTokenToReplace tks) ++ snde
216+ where
217+ allZerosTokensReplacement x = intersperse Colon (replicate x AllZeros)
218+ quantityOfAllZerosTokenToReplace x =
219+ ntks tks - foldl (\c x -> if (x /= DoubleColon) && (x /= Colon) then c+1 else c) 0 x
220+ where
221+ ntks tks = if countIPv4Addr tks == 1 then 7 else 8
222+
223+toDoubleColon :: [IPv6AddrToken] -> [IPv6AddrToken]
224+toDoubleColon tks =
225+ zerosToDoubleColon tks (zerosRunToReplace $ zerosRunsList tks)
226+ where
227+ zerosToDoubleColon :: [IPv6AddrToken] -> (Int,Int) -> [IPv6AddrToken]
228+ -- No all zeros token, so no double colon replacement...
229+ zerosToDoubleColon ls (_,0) = ls
230+ -- "The symbol '::' MUST NOT be used to shorten just one 16-bit 0 field" (RFC 5952 4.2.2)
231+ zerosToDoubleColon ls (_,1) = ls
232+ zerosToDoubleColon ls (i,l) =
233+ let ls' = filter (/= Colon) ls
234+ in intersperse Colon (Prelude.take i ls') ++ [DoubleColon] ++ intersperse Colon (drop (i+l) ls')
235+ zerosRunToReplace t =
236+ let l = longestLengthZerosRun t
237+ in (firstLongestZerosRunIndex t l,l)
238+ where
239+ firstLongestZerosRunIndex x y = sum . snd . unzip $ Prelude.takeWhile (/=(True,y)) x
240+ longestLengthZerosRun x =
241+ maximum $ map longest x
242+ where longest t = case t of
243+ (True,i) -> i
244+ _ -> 0
245+ zerosRunsList x = map helper $ groupZerosRuns x
246+ where
247+ helper h = (head h == AllZeros, lh) where lh = length h
248+ groupZerosRuns = group . filter (/= Colon)
249+
250+ipv6TokensToIPv6Addr :: [IPv6AddrToken] -> Maybe IPv6Addr
251+ipv6TokensToIPv6Addr l = Just $ IPv6Addr $ ipv6TokensToText l
252+
253+fullSixteenBit :: T.Text -> Maybe IPv6AddrToken
254+fullSixteenBit t =
255+ case parse ipv6AddrFullChunk t of
256+ Done a b -> if a==T.empty then Just $ SixteenBit $ T.pack b else Nothing
257+ _ -> Nothing
258+
259+macAddr :: Parser (Maybe [IPv6AddrToken])
260+macAddr = do
261+ n1 <- count 2 hexaChar <* ":"
262+ n2 <- count 2 hexaChar <* ":"
263+ n3 <- count 2 hexaChar <* ":"
264+ n4 <- count 2 hexaChar <* ":"
265+ n5 <- count 2 hexaChar <* ":"
266+ n6 <- count 2 hexaChar
267+ return $ maybeIPv6AddrTokens $ T.pack $ concat [n1,n2,n3,n4,n5,n6]
268+
269+sixteenBit :: Parser IPv6AddrToken
270+sixteenBit = do
271+ r <- ipv6AddrFullChunk <|> count 3 hexaChar <|> count 2 hexaChar <|> count 1 hexaChar
272+ -- "Leading zeros MUST be suppressed" (RFC 5952, 4.1)
273+ let r' = T.dropWhile (=='0') $ T.pack r
274+ return $ if T.null r'
275+ then AllZeros
276+ -- Hexadecimal digits MUST be in lowercase (RFC 5952 4.3)
277+ else SixteenBit $ T.toLower r'
278+
279+ipv4Addr :: Parser IPv6AddrToken
280+ipv4Addr = do
281+ n1 <- manyDigits <* "."
282+ if n1 /= T.empty
283+ then do n2 <- manyDigits <* "."
284+ if n2 /= T.empty
285+ then do n3 <- manyDigits <* "."
286+ if n3 /= T.empty
287+ then do n4 <- manyDigits
288+ if n4 /= T.empty
289+ then return $ IPv4Addr $ T.intercalate "." [n1,n2,n3,n4]
290+ else parserFailure
291+ else parserFailure
292+ else parserFailure
293+ else parserFailure
294+ where
295+ parserFailure = fail "ipv4Addr parsing failure"
296+ manyDigits = do
297+ ds <- takeWhile1 isDigit
298+ case R.decimal ds of
299+ Right (n,_) -> return (if n < 256 then T.pack $ show n else T.empty)
300+ Left _ -> return T.empty
301+
302+doubleColon :: Parser IPv6AddrToken
303+doubleColon = do
304+ string "::"
305+ return DoubleColon
306+
307+colon :: Parser IPv6AddrToken
308+colon = do
309+ string ":"
310+ return Colon
311+
312+ipv6AddrFullChunk :: Parser String
313+ipv6AddrFullChunk = count 4 hexaChar
314+
315+hexaChar :: Parser Char
316+hexaChar = satisfy (inClass "0-9a-fA-F")
tests/QC/IPv6/Types.hsnew file+29
@@ -0,0 +1,29 @@
1+-- -----------------------------------------------------------------------------
2+
3+-- |
4+-- Module : Text.IPv6Addr
5+-- Copyright : Copyright © Michel Boucey 2011-2015
6+-- License : BSD-Style
7+-- Maintainer : michel.boucey@gmail.com
8+--
9+-- Dealing with IPv6 address text representations, canonization and manipulations.
10+--
11+
12+-- -----------------------------------------------------------------------------
13+
14+module QC.IPv6.Types where
15+
16+import qualified Data.Text as T
17+
18+data IPv6Addr = IPv6Addr T.Text
19+
20+instance Show IPv6Addr where
21+ show (IPv6Addr addr) = T.unpack addr
22+
23+data IPv6AddrToken
24+ = SixteenBit T.Text -- ^ A four hexadecimal digits group representing a 16-Bit chunk
25+ | AllZeros -- ^ An all zeros 16-Bit chunk
26+ | Colon -- ^ A separator between 16-Bit chunks
27+ | DoubleColon -- ^ A double-colon stands for a unique compression of many consecutive 16-Bit chunks
28+ | IPv4Addr T.Text -- ^ An embedded IPv4 address as representation of the last 32-Bit
29+ deriving (Eq,Show)
tests/QC/Rechunked.hsnew file+56
@@ -0,0 +1,56 @@
1+{-# LANGUAGE BangPatterns #-}
2+
3+module QC.Rechunked (
4+ rechunkBS
5+ , rechunkT
6+ ) where
7+
8+import Control.Monad (forM, forM_)
9+import Control.Monad.ST (ST, runST)
10+import Data.List (unfoldr)
11+import Test.QuickCheck (Gen, choose)
12+import qualified Data.ByteString as B
13+import qualified Data.Text as T
14+import qualified Data.Vector as V
15+import qualified Data.Vector.Generic as G
16+import qualified Data.Vector.Generic.Mutable as M
17+
18+rechunkBS :: B.ByteString -> Gen [B.ByteString]
19+rechunkBS = fmap (map B.copy) . rechunk_ B.splitAt B.length
20+
21+rechunkT :: T.Text -> Gen [T.Text]
22+rechunkT = fmap (map T.copy) . rechunk_ T.splitAt T.length
23+
24+rechunk_ :: (Int -> a -> (a,a)) -> (a -> Int) -> a -> Gen [a]
25+rechunk_ split len xs = (unfoldr go . (,) xs) `fmap` rechunkSizes (len xs)
26+ where go (b,r:rs) = Just (h, (t,rs))
27+ where (h,t) = split r b
28+ go (_,_) = Nothing
29+
30+rechunkSizes :: Int -> Gen [Int]
31+rechunkSizes n0 = shuffle =<< loop [] (0:repeat 1) n0
32+ where loop _ [] _ = error "it's 2015, where's my Stream type?"
33+ loop acc (lb:lbs) n
34+ | n <= 0 = shuffle (reverse acc)
35+ | otherwise = do
36+ !i <- choose (lb,n)
37+ loop (i:acc) lbs (n-i)
38+
39+shuffle :: [Int] -> Gen [Int]
40+shuffle (0:xs) = (0:) `fmap` shuffle xs
41+shuffle xs = fisherYates xs
42+
43+fisherYates :: [a] -> Gen [a]
44+fisherYates xs = (V.toList . V.backpermute v) `fmap` swapIndices (G.length v)
45+ where
46+ v = V.fromList xs
47+ swapIndices n0 = do
48+ swaps <- forM [0..n] $ \i -> ((,) i) `fmap` choose (i,n)
49+ return (runST (swapAll swaps))
50+ where
51+ n = n0 - 1
52+ swapAll :: [(Int,Int)] -> ST s (V.Vector Int)
53+ swapAll ijs = do
54+ mv <- G.unsafeThaw (G.enumFromTo 0 n :: V.Vector Int)
55+ forM_ ijs $ uncurry (M.swap mv)
56+ G.unsafeFreeze mv
tests/QC/Simple.hsnew file+37
@@ -0,0 +1,37 @@
1+{-# LANGUAGE OverloadedStrings #-}
2+{-# OPTIONS_GHC -fno-warn-missing-signatures #-}
3+
4+module QC.Simple (
5+ tests
6+ ) where
7+
8+import Control.Applicative ((<|>))
9+import Data.ByteString (ByteString)
10+import Data.List (foldl')
11+import Data.Maybe (fromMaybe)
12+import QC.Rechunked (rechunkBS)
13+import Test.Tasty (TestTree)
14+import Test.Tasty.QuickCheck (testProperty)
15+import Test.QuickCheck (Property, counterexample, forAll)
16+import qualified Data.Attoparsec.ByteString.Char8 as A
17+
18+t_issue75 = expect issue75 "ab" (A.Done "" "b")
19+
20+issue75 :: A.Parser ByteString
21+issue75 = "a" >> ("b" <|> "")
22+
23+expect :: (Show r, Eq r) => A.Parser r -> ByteString -> A.Result r -> Property
24+expect p input wanted =
25+ forAll (rechunkBS input) $ \in' ->
26+ let result = parse p in'
27+ in counterexample (show result ++ " /= " ++ show wanted) $
28+ fromMaybe False (A.compareResults result wanted)
29+
30+parse :: A.Parser r -> [ByteString] -> A.Result r
31+parse p (x:xs) = foldl' A.feed (A.parse p x) xs
32+parse p [] = A.parse p ""
33+
34+tests :: [TestTree]
35+tests = [
36+ testProperty "issue75" t_issue75
37+ ]
tests/QC/Text.hsnew file+203
@@ -0,0 +1,203 @@
1+{-# LANGUAGE BangPatterns, CPP, OverloadedStrings #-}
2+{-# OPTIONS_GHC -fno-warn-warnings-deprecations #-}
3+module QC.Text (tests) where
4+
5+#if !MIN_VERSION_base(4,8,0)
6+import Control.Applicative ((<*>), (<$>))
7+#endif
8+import Data.Int (Int64)
9+import Data.Word (Word8)
10+import Prelude hiding (take, takeWhile)
11+import QC.Common (liftOp, parseT)
12+import qualified QC.Text.FastSet as FastSet
13+import qualified QC.Text.Regressions as Regressions
14+import Test.Tasty (TestTree, testGroup)
15+import Test.Tasty.QuickCheck (testProperty)
16+import Test.QuickCheck
17+import qualified Data.Attoparsec.Text as P
18+import qualified Data.Attoparsec.Text.Lazy as PL
19+import qualified Data.Attoparsec.Text.FastSet as S
20+import qualified Data.ByteString as BS
21+import qualified Data.Char as Char
22+import qualified Data.Text as T
23+import qualified Data.Text.Encoding as TE
24+import qualified Data.Text.Lazy as L
25+
26+-- Basic byte-level combinators.
27+
28+satisfy :: Char -> L.Text -> Property
29+satisfy w s = parseT (P.satisfy (<=w)) (L.cons w s) === Just w
30+
31+satisfyWith :: Char -> L.Text -> Property
32+satisfyWith c s = parseT (P.satisfyWith id (<=c)) (L.cons c s) === Just c
33+
34+char :: Char -> L.Text -> Property
35+char w s = parseT (P.char w) (L.cons w s) === Just w
36+
37+skip :: Char -> L.Text -> Property
38+skip w s =
39+ case (parseT (P.skip (<w)) s, L.uncons s) of
40+ (Nothing, mcs) -> maybe (property True) (expectFailure . it) mcs
41+ (Just _, mcs) -> maybe (property False) it mcs
42+ where it cs = liftOp "<" (<) (fst cs) w
43+
44+anyChar :: L.Text -> Property
45+anyChar s
46+ | L.null s = p === Nothing
47+ | otherwise = p === Just (L.head s)
48+ where p = parseT P.anyChar s
49+
50+notChar :: Char -> NonEmptyList Char -> Property
51+notChar w (NonEmpty s) = parseT (P.notChar w) bs === if v == w
52+ then Nothing
53+ else Just v
54+ where v = L.head bs
55+ bs = L.pack s
56+
57+peekChar :: L.Text -> Property
58+peekChar s
59+ | L.null s = p === Just (Nothing, s)
60+ | otherwise = p === Just (Just (L.head s), s)
61+ where p = parseT ((,) <$> P.peekChar <*> P.takeLazyText) s
62+
63+peekChar' :: L.Text -> Property
64+peekChar' s = parseT P.peekChar' s === (fst <$> L.uncons s)
65+
66+string :: L.Text -> L.Text -> Property
67+string s t = parseT (P.string s') (s `L.append` t) === Just s'
68+ where s' = toStrict s
69+
70+strings :: L.Text -> L.Text -> L.Text -> Property
71+strings s t u =
72+ parseT (P.string (toStrict s) >> P.string t') (L.concat [s,t,u])
73+ === Just t'
74+ where t' = toStrict t
75+
76+-- | Note: "simple, and efficient" works for well formed input...
77+-- i.e. e.g. Latin1 texts
78+stringCI :: [Word8] -> Property
79+stringCI ws = P.parseOnly (P.stringCI fs) s === Right s
80+ where fs = T.toCaseFold s
81+ s = TE.decodeLatin1 (BS.pack ws)
82+
83+asciiCI :: T.Text -> Gen Bool
84+asciiCI x =
85+ (\s i -> P.parseOnly (P.asciiCI s) i == Right i)
86+ <$> maybeModifyCase x
87+ <*> maybeModifyCase x
88+ where
89+ maybeModifyCase s = elements [s, toLower s, toUpper s]
90+ toLower = T.map (\c -> if c < Char.chr 127 then Char.toLower c else c)
91+ toUpper = T.map (\c -> if c < Char.chr 127 then Char.toUpper c else c)
92+
93+toStrict :: L.Text -> T.Text
94+toStrict = T.concat . L.toChunks
95+
96+skipWhile :: Char -> L.Text -> Property
97+skipWhile w s =
98+ let t = L.dropWhile (<=w) s
99+ in case PL.parse (P.skipWhile (<=w)) s of
100+ PL.Done t' () -> t === t'
101+ _ -> property False
102+
103+take :: Int -> L.Text -> Property
104+take n s = maybe (liftOp "<" (<) (L.length s) (fromIntegral n))
105+ (=== T.take n (toStrict s)) $
106+ parseT (P.take n) s
107+
108+takeText :: L.Text -> Property
109+takeText s = maybe (property False) (=== toStrict s) . parseT P.takeText $ s
110+
111+takeLazyText :: L.Text -> Property
112+takeLazyText s = maybe (property False) (=== s) . parseT P.takeLazyText $ s
113+
114+takeCount :: Positive Int -> L.Text -> Property
115+takeCount (Positive k) s =
116+ case parseT (P.take k) s of
117+ Nothing -> liftOp ">" (>) (fromIntegral k) (L.length s)
118+ Just _s -> liftOp "<=" (<=) (fromIntegral k) (L.length s)
119+
120+takeWhile :: Char -> L.Text -> Property
121+takeWhile w s =
122+ let (h,t) = L.span (==w) s
123+ in case PL.parse (P.takeWhile (==w)) s of
124+ PL.Done t' h' -> t === t' .&&. toStrict h === h'
125+ _ -> property False
126+
127+takeWhile1 :: Char -> L.Text -> Property
128+takeWhile1 w s =
129+ let s' = L.cons w s
130+ (h,t) = L.span (<=w) s'
131+ in case PL.parse (P.takeWhile1 (<=w)) s' of
132+ PL.Done t' h' -> t === t' .&&. toStrict h === h'
133+ _ -> property False
134+
135+takeTill :: Char -> L.Text -> Property
136+takeTill w s =
137+ let (h,t) = L.break (==w) s
138+ in case PL.parse (P.takeTill (==w)) s of
139+ PL.Done t' h' -> t === t' .&&. toStrict h === h'
140+ _ -> property False
141+
142+takeWhile1_empty :: Property
143+takeWhile1_empty = parseT (P.takeWhile1 undefined) L.empty === Nothing
144+
145+endOfInput :: L.Text -> Property
146+endOfInput s = parseT P.endOfInput s === if L.null s
147+ then Just ()
148+ else Nothing
149+
150+endOfLine :: L.Text -> Property
151+endOfLine s =
152+ case (parseT P.endOfLine s, L.uncons s) of
153+ (Nothing, mcs) -> maybe (property True) (expectFailure . eol) mcs
154+ (Just _, mcs) -> maybe (property False) eol mcs
155+ where eol (c,s') = c === '\n' .||.
156+ (c, fst <$> L.uncons s') === ('\r', Just '\n')
157+
158+scan :: L.Text -> Positive Int64 -> Property
159+-- for some reason, if counterexample is removed, this test fails?
160+scan s (Positive k) = counterexample (show s)
161+ $ parseT p s === Just (toStrict $ L.take k s)
162+ where p = P.scan k $ \ n _ ->
163+ if n > 0 then let !n' = n - 1 in Just n' else Nothing
164+
165+members :: String -> Property
166+members s = property $ all (`S.member` set) s
167+ where set = S.fromList s
168+
169+nonmembers :: String -> String -> Property
170+nonmembers s s' = property . not . any (`S.member` set) $ filter (not . (`elem` s)) s'
171+ where set = S.fromList s
172+
173+tests :: [TestTree]
174+tests = [
175+ testProperty "anyChar" anyChar
176+ , testProperty "asciiCI" asciiCI
177+ , testProperty "char" char
178+ , testProperty "endOfInput" endOfInput
179+ , testProperty "endOfLine" endOfLine
180+ , testProperty "notChar" notChar
181+ , testProperty "peekChar" peekChar
182+ , testProperty "peekChar'" peekChar'
183+ , testProperty "satisfy" satisfy
184+ , testProperty "satisfyWith" satisfyWith
185+ , testProperty "scan" scan
186+ , testProperty "skip" skip
187+ , testProperty "skipWhile" skipWhile
188+ , testProperty "string" string
189+ , testProperty "strings" strings
190+ , testProperty "stringCI" stringCI
191+ , testProperty "take" take
192+ , testProperty "takeText" takeText
193+ , testProperty "takeCount" takeCount
194+ , testProperty "takeLazyText" takeLazyText
195+ , testProperty "takeTill" takeTill
196+ , testProperty "takeWhile" takeWhile
197+ , testProperty "takeWhile1" takeWhile1
198+ , testProperty "takeWhile1_empty" takeWhile1_empty
199+ , testProperty "members" members
200+ , testProperty "nonmembers" nonmembers
201+ , testGroup "FastSet" FastSet.tests
202+ , testGroup "Regressions" Regressions.tests
203+ ]
tests/QC/Text/FastSet.hsnew file+15
@@ -0,0 +1,15 @@
1+module QC.Text.FastSet where
2+
3+import Test.Tasty (TestTree)
4+import Test.Tasty.QuickCheck (testProperty)
5+import Test.QuickCheck
6+import qualified Data.Attoparsec.Text.FastSet as FastSet
7+
8+membershipCorrect :: String -> String -> Property
9+membershipCorrect members others =
10+ let fs = FastSet.fromList members
11+ correct c = (c `FastSet.member` fs) == (c `elem` members)
12+ in property $ all correct (members ++ others)
13+
14+tests :: [TestTree]
15+tests = [ testProperty "membership is correct" membershipCorrect ]
tests/QC/Text/Regressions.hsnew file+54
@@ -0,0 +1,54 @@
1+{-# LANGUAGE OverloadedStrings #-}
2+
3+module QC.Text.Regressions (
4+ tests
5+ ) where
6+
7+import Data.Text (Text)
8+import qualified Data.Text as T
9+import Data.List (foldl')
10+import Data.Maybe (fromMaybe)
11+import Data.Char (isLower)
12+import Data.Monoid ((<>))
13+import QC.Rechunked (rechunkT)
14+import Test.Tasty (TestTree)
15+import Test.Tasty.QuickCheck (testProperty)
16+import Test.QuickCheck (Property, counterexample, forAll)
17+import qualified Data.Attoparsec.Text as A
18+
19+
20+--------------------------------------------------------------------------------
21+-- 105 was about runScanner not always returning the final state. The result
22+-- did depend on how the data was fed to the parser.
23+
24+t_issue105 :: Property
25+t_issue105 = expect issue105 "lowER" (A.Done "ER" "low")
26+
27+issue105 :: A.Parser Text
28+issue105 = do
29+ (_, firstFourLowercaseLetters) <- A.runScanner "" f
30+ return $ firstFourLowercaseLetters
31+
32+ where
33+ f :: Text -> Char -> Maybe Text
34+ f acc c = if T.length acc < 4 && isLower c
35+ then Just $ acc <> T.singleton c
36+ else Nothing
37+
38+
39+expect :: (Show r, Eq r) => A.Parser r -> Text -> A.Result r -> Property
40+expect p input wanted =
41+ forAll (rechunkT input) $ \in' ->
42+ let result = parse p in'
43+ in counterexample (show result ++ " /= " ++ show wanted) $
44+ fromMaybe False (A.compareResults result wanted)
45+
46+parse :: A.Parser r -> [Text] -> A.Result r
47+parse p (x:xs) = foldl' A.feed (A.parse p x) xs
48+parse p [] = A.parse p ""
49+
50+
51+tests :: [TestTree]
52+tests = [
53+ testProperty "issue105" t_issue105
54+ ]
tests/TestFastSet.hsdeleted−25
@@ -1,25 +0,0 @@
1−module Main (main) where
2−
3−import Data.Word (Word8)
4−import qualified Data.Attoparsec.FastSet as F
5−import System.Random (Random(..), RandomGen)
6−import Test.QuickCheck
7−
8−integralRandomR :: (Integral a, RandomGen g) => (a, a) -> g -> (a, g)
9−integralRandomR (a,b) g = case randomR (fromIntegral a :: Int,
10− fromIntegral b :: Int) g
11− of (x,g') -> (fromIntegral x, g')
12−
13−instance Random Word8 where
14− randomR = integralRandomR
15− random = randomR (minBound,maxBound)
16−
17−instance Arbitrary Word8 where
18− arbitrary = choose (minBound, maxBound)
19−
20−prop_AllMembers s =
21− let set = F.fromList s
22− in all (`F.memberWord8` set) s
23−
24−main = do
25− quickCheck prop_AllMembers