master..4e443c8 · typeable/attoparsec

.ghcideleted−1

since splitsnapshots

unifiedsplit

@@ -1 +0,0 @@

1−:set -fobject-code -optP-include -optPdist/build/autogen/cabal_macros.h -itests

.gitignoredeleted−6

@@ -1,6 +0,0 @@

1−*.hi

2−*.o

3−/dist/

4−.cabal-sandbox

5−cabal.sandbox.config

6−*.sw[op]

.hgignore+2−9

@@ -1,16 +1,9 @@

1+^(?:cabal-dev|dist)$

1−\.(?:aux|eventlog|h[ip]|hs.html|log|[mt]ix|[oa]|orig|prof|ps|rej|swp)$

2+\.(?:aux|eventlog|h[ip]|log|[oa]|orig|prof|ps|rej|swp)$

2~$

3~$

3−^(?:.+/|)\.cabal-sandbox/

4−^(?:.+/|)dist/

5benchmarks/Arse

4benchmarks/Arse

6−benchmarks/dist

7benchmarks/med.txt

5benchmarks/med.txt

8benchmarks/tiny

6benchmarks/tiny

9−benchmarks/warp-[0-9]*

10−cabal.sandbox.config

11−examples/c-http

12−examples/http_parser.[ch]

13−hpc.*\.html$

14

7

15syntax: glob

8syntax: glob

16.\#*

9.\#*

.hgtags−30

@@ -31,33 +31,3 @@ cbfbab5a33eb7522af4dd16b4306ef848b5b2350 0.8.6.1

3130d71153204a79666638fcb4765115cbfc8d2d93 0.9.1.0

3261f6daa5cd357349143e57b8530bd9ba7f55fdf6 0.9.1.1

33e539c7f6c6ceaa79318177cc3bc149d7b6e7c6c1 0.9.1.2

34−3033c0af33fa3b83d002eb9150acf8949e56f19f 0.10.0.0

35−3033c0af33fa3b83d002eb9150acf8949e56f19f 0.10.0.0

36−d39f15e57df591fb785272ba5d3acf0d70fcb0ff 0.10.0.0

37−33c33d8467265f9f2226a351a59b616a5ace9fbb 0.10.0.1

38−066fc7a19fc07c3b7c50e9b591af3dc5591742a1 0.10.0.2

39−80fa1e1f6e122d3de65ce3d6cd9f3aceaa108977 0.10.0.3

40−80fa1e1f6e122d3de65ce3d6cd9f3aceaa108977 0.10.0.3

41−940330f992c8130d8e17b99f93d570d454c0fa4d 0.10.0.3

42−5702ca99c6ac5cfdd8a864c0e4c61a4db1158d7a 0.10.1.0

43−e8bc38ea66812bf5f24599d3f33480411084affb 0.10.1.1

44−f0bc0f79b70b97a856042386aa8856ac1cad88f1 0.10.2.0

45−030191aa39c97afcad17d365ed114a2eedc04ad4 0.10.3.0

46−ec23283e88c00af34c3144a8775ca4358daea3f7 0.10.4.0

47−6f4b317a12acdd05d67fd9ec55d3defaf37a01eb 0.11.1.0

48−48809d7716468fe2bbc47b191b1d64358daaf6d1 0.11.2.1

49−856a772f83a6e382bbcfe53e221a5a92623b107c 0.11.3.0

50−a3c7a521fd58595d6a470ab890cc54a80dd45bd7 0.11.3.1

51−38326ce07aca6c8c3a014b0d454d2a5bfdbd6a52 0.11.3.2

52−694039f4fc157a8ca5dce37959391615b6c3f535 0.11.3.3

53−1fe92d1838fb1b1afcee1ca18d4970cf7e01956e 0.11.3.4

54−68203a4cb847da905fa44b5aa1942b99d5867ab4 0.12.0.0

55−c9c2b05707b2fffcd749d5817e3e0d04e6ad6d0d 0.12.1.0

56−9157c2b4c35aa5f683b4ac51e6ff52c696bc22e2 0.12.1.1

57−682ba515f7ba62500ad79371b37b90932e0c0e3d 0.12.1.2

58−2066a72b79b478f59a9c7f1839c522fc59ba9af7 0.12.1.3

59−ef875ad3bebef2b6fb1bd7063de6a46a06d0d4b4 0.12.1.4

60−dc1fcff28d13a508f677c7b06af6420877842493 0.12.1.5

61−013e04e4526bfd5e9e4a611b42e6f03c413bea91 0.12.1.6

62−0ddbce995b77b8db391b4d6519f13feddf4b5bf3 0.13.0.0

63−46c16463ec20ad46c9cd0bfb1050c4268f34b749 0.13.0.1

.travis.ymldeleted−161

@@ -1,161 +0,0 @@

1−# This Travis job script has been generated by a script via

2−#

3−# haskell-ci '--tests-jobs=>=7.4' '--no-benchmarks' 'attoparsec.cabal'

4−#

5−# For more information, see https://github.com/haskell-CI/haskell-ci

6−#

7−# version: 0.3.20190815

8−#

9−language: c

10−dist: xenial

11−git:

12− # whether to recursively clone submodules

13− submodules: false

14−cache:

15− directories:

16− - $HOME/.cabal/packages

17− - $HOME/.cabal/store

18−before_cache:

19− - rm -fv $CABALHOME/packages/hackage.haskell.org/build-reports.log

20− # remove files that are regenerated by 'cabal update'

21− - rm -fv $CABALHOME/packages/hackage.haskell.org/00-index.*

22− - rm -fv $CABALHOME/packages/hackage.haskell.org/*.json

23− - rm -fv $CABALHOME/packages/hackage.haskell.org/01-index.cache

24− - rm -fv $CABALHOME/packages/hackage.haskell.org/01-index.tar

25− - rm -fv $CABALHOME/packages/hackage.haskell.org/01-index.tar.idx

26− - rm -rfv $CABALHOME/packages/head.hackage

27−matrix:

28− include:

29− - compiler: ghc-8.8.1

30− addons: {"apt":{"sources":["hvr-ghc"],"packages":["ghc-8.8.1","cabal-install-3.0"]}}

31− - compiler: ghc-8.6.5

32− addons: {"apt":{"sources":["hvr-ghc"],"packages":["ghc-8.6.5","cabal-install-2.4"]}}

33− - compiler: ghc-8.4.4

34− addons: {"apt":{"sources":["hvr-ghc"],"packages":["ghc-8.4.4","cabal-install-2.4"]}}

35− - compiler: ghc-8.2.2

36− addons: {"apt":{"sources":["hvr-ghc"],"packages":["ghc-8.2.2","cabal-install-2.4"]}}

37− - compiler: ghc-8.0.2

38− addons: {"apt":{"sources":["hvr-ghc"],"packages":["ghc-8.0.2","cabal-install-2.4"]}}

39− - compiler: ghc-7.10.3

40− addons: {"apt":{"sources":["hvr-ghc"],"packages":["ghc-7.10.3","cabal-install-2.4"]}}

41− - compiler: ghc-7.8.4

42− addons: {"apt":{"sources":["hvr-ghc"],"packages":["ghc-7.8.4","cabal-install-2.4"]}}

43− - compiler: ghc-7.6.3

44− addons: {"apt":{"sources":["hvr-ghc"],"packages":["ghc-7.6.3","cabal-install-2.4"]}}

45− - compiler: ghc-7.4.2

46− addons: {"apt":{"sources":["hvr-ghc"],"packages":["ghc-7.4.2","cabal-install-2.4"]}}

47− - compiler: ghc-7.2.2

48− addons: {"apt":{"sources":["hvr-ghc"],"packages":["ghc-7.2.2","cabal-install-2.4"]}}

49− - compiler: ghc-7.0.4

50− addons: {"apt":{"sources":["hvr-ghc"],"packages":["ghc-7.0.4","cabal-install-2.4"]}}

51−before_install:

52− - HC=$(echo "/opt/$CC/bin/ghc" | sed 's/-/\//')

53− - WITHCOMPILER="-w $HC"

54− - HCPKG="$HC-pkg"

55− - unset CC

56− - CABAL=/opt/ghc/bin/cabal

57− - CABALHOME=$HOME/.cabal

58− - export PATH="$CABALHOME/bin:$PATH"

59− - TOP=$(pwd)

60− - "HCNUMVER=$(${HC} --numeric-version|perl -ne '/^(\\d+)\\.(\\d+)\\.(\\d+)(\\.(\\d+))?$/; print(10000 * $1 + 100 * $2 + ($3 == 0 ? $5 != 1 : $3))')"

61− - echo $HCNUMVER

62− - CABAL="$CABAL -vnormal+nowrap+markoutput"

63− - set -o pipefail

64− - |

65− echo 'function blue(s) { printf "\033[0;34m" s "\033[0m " }' >> .colorful.awk

66− echo 'BEGIN { state = "output"; }' >> .colorful.awk

67− echo '/^-----BEGIN CABAL OUTPUT-----$/ { state = "cabal" }' >> .colorful.awk

68− echo '/^-----END CABAL OUTPUT-----$/ { state = "output" }' >> .colorful.awk

69− echo '!/^(-----BEGIN CABAL OUTPUT-----|-----END CABAL OUTPUT-----)/ {' >> .colorful.awk

70− echo ' if (state == "cabal") {' >> .colorful.awk

71− echo ' print blue($0)' >> .colorful.awk

72− echo ' } else {' >> .colorful.awk

73− echo ' print $0' >> .colorful.awk

74− echo ' }' >> .colorful.awk

75− echo '}' >> .colorful.awk

76− - cat .colorful.awk

77− - |

78− color_cabal_output () {

79− awk -f $TOP/.colorful.awk

80− }

81− - echo text | color_cabal_output

82−install:

83− - ${CABAL} --version

84− - echo "$(${HC} --version) [$(${HC} --print-project-git-commit-id 2> /dev/null || echo '?')]"

85− - TEST=--enable-tests

86− - if [ $HCNUMVER -lt 70400 ] ; then TEST=--disable-tests ; fi

87− - BENCH=--enable-benchmarks

88− - BENCH=--disable-benchmarks

89− - HEADHACKAGE=false

90− - rm -f $CABALHOME/config

91− - |

92− echo "verbose: normal +nowrap +markoutput" >> $CABALHOME/config

93− echo "remote-build-reporting: anonymous" >> $CABALHOME/config

94− echo "write-ghc-environment-files: always" >> $CABALHOME/config

95− echo "remote-repo-cache: $CABALHOME/packages" >> $CABALHOME/config

96− echo "logs-dir: $CABALHOME/logs" >> $CABALHOME/config

97− echo "world-file: $CABALHOME/world" >> $CABALHOME/config

98− echo "extra-prog-path: $CABALHOME/bin" >> $CABALHOME/config

99− echo "symlink-bindir: $CABALHOME/bin" >> $CABALHOME/config

100− echo "installdir: $CABALHOME/bin" >> $CABALHOME/config

101− echo "build-summary: $CABALHOME/logs/build.log" >> $CABALHOME/config

102− echo "store-dir: $CABALHOME/store" >> $CABALHOME/config

103− echo "install-dirs user" >> $CABALHOME/config

104− echo " prefix: $CABALHOME" >> $CABALHOME/config

105− echo "repository hackage.haskell.org" >> $CABALHOME/config

106− echo " url: http://hackage.haskell.org/" >> $CABALHOME/config

107− - cat $CABALHOME/config

108− - rm -fv cabal.project cabal.project.local cabal.project.freeze

109− - travis_retry ${CABAL} v2-update -v

110− # Generate cabal.project

111− - rm -rf cabal.project cabal.project.local cabal.project.freeze

112− - touch cabal.project

113− - |

114− echo "packages: ." >> cabal.project

115− - |

116− - "for pkg in $($HCPKG list --simple-output); do echo $pkg | sed 's/-[^-]*$//' | (grep -vE -- '^(attoparsec)$' || true) | sed 's/^/constraints: /' | sed 's/$/ installed/' >> cabal.project.local; done"

117− - cat cabal.project || true

118− - cat cabal.project.local || true

119− - if [ -f "./configure.ac" ]; then (cd "." && autoreconf -i); fi

120− - ${CABAL} v2-freeze $WITHCOMPILER ${TEST} ${BENCH} | color_cabal_output

121− - "cat cabal.project.freeze | sed -E 's/^(constraints: *| *)//' | sed 's/any.//'"

122− - rm cabal.project.freeze

123− - ${CABAL} v2-build $WITHCOMPILER ${TEST} ${BENCH} --dep -j2 all | color_cabal_output

124− - ${CABAL} v2-build $WITHCOMPILER --disable-tests --disable-benchmarks --dep -j2 all | color_cabal_output

125−script:

126− - DISTDIR=$(mktemp -d /tmp/dist-test.XXXX)

127− # Packaging...

128− - ${CABAL} v2-sdist all | color_cabal_output

129− # Unpacking...

130− - mv dist-newstyle/sdist/*.tar.gz ${DISTDIR}/

131− - cd ${DISTDIR} || false

132− - find . -maxdepth 1 -type f -name '*.tar.gz' -exec tar -xvf '{}' \;

133− - find . -maxdepth 1 -type f -name '*.tar.gz' -exec rm '{}' \;

134− - PKGDIR_attoparsec="$(find . -maxdepth 1 -type d -regex '.*/attoparsec-[0-9.]*')"

135− # Generate cabal.project

136− - rm -rf cabal.project cabal.project.local cabal.project.freeze

137− - touch cabal.project

138− - |

139− echo "packages: ${PKGDIR_attoparsec}" >> cabal.project

140− - |

141− - "for pkg in $($HCPKG list --simple-output); do echo $pkg | sed 's/-[^-]*$//' | (grep -vE -- '^(attoparsec)$' || true) | sed 's/^/constraints: /' | sed 's/$/ installed/' >> cabal.project.local; done"

142− - cat cabal.project || true

143− - cat cabal.project.local || true

144− # Building...

145− # this builds all libraries and executables (without tests/benchmarks)

146− - ${CABAL} v2-build $WITHCOMPILER --disable-tests --disable-benchmarks all | color_cabal_output

147− # Building with tests and benchmarks...

148− # build & run tests, build benchmarks

149− - ${CABAL} v2-build $WITHCOMPILER ${TEST} ${BENCH} all | color_cabal_output

150− # Testing...

151− - if [ $HCNUMVER -ge 70400 ] ; then ${CABAL} v2-test $WITHCOMPILER ${TEST} ${BENCH} all | color_cabal_output ; fi

152− # cabal check...

153− - (cd ${PKGDIR_attoparsec} && ${CABAL} -vnormal check)

154− # haddock...

155− - ${CABAL} v2-haddock $WITHCOMPILER ${TEST} ${BENCH} all | color_cabal_output

156− # Building without installed constraints for packages in global-db...

157− - rm -f cabal.project.local

158− - ${CABAL} v2-build $WITHCOMPILER --disable-tests --disable-benchmarks all | color_cabal_output

159−

160−# REGENDATA ["--tests-jobs=>=7.4","--no-benchmarks","attoparsec.cabal"]

161−# EOF

Data/Attoparsec.hs+4−9

@@ -1,21 +1,16 @@

1-- |

2-- Module : Data.Attoparsec

3−-- Copyright : Bryan O'Sullivan 2007-2015

3+-- Copyright : Bryan O'Sullivan 2007-2011

4-- License : BSD3

5−--

5+--

6-- Maintainer : bos@serpentine.com

7-- Stability : experimental

8-- Portability : unknown

9--

10−-- Simple, efficient combinator parsing for

10+-- Simple, efficient combinator parsing for 'ByteString' strings,

11−-- 'Data.ByteString.ByteString' strings, loosely based on the Parsec

11+-- loosely based on the Parsec library.

12−-- library.

13−--

14−-- This module is deprecated. Use "Data.Attoparsec.ByteString"

15−-- instead.

16

12

17module Data.Attoparsec

13module Data.Attoparsec

18− {-# DEPRECATED "This module will be removed in the next major release." #-}

19 (

14 (

20 module Data.Attoparsec.ByteString

15 module Data.Attoparsec.ByteString

21 ) where

16 ) where

Data/Attoparsec/ByteString.hs+35−63

@@ -1,12 +1,8 @@

1−{-# LANGUAGE CPP #-}

2−#if __GLASGOW_HASKELL__ >= 702

3−{-# LANGUAGE Trustworthy #-}

4−#endif

5-- |

1-- |

6-- Module : Data.Attoparsec.ByteString

2-- Module : Data.Attoparsec.ByteString

7−-- Copyright : Bryan O'Sullivan 2007-2015

3+-- Copyright : Bryan O'Sullivan 2007-2011

8-- License : BSD3

4-- License : BSD3

9−--

5+--

10-- Maintainer : bos@serpentine.com

6-- Maintainer : bos@serpentine.com

11-- Stability : experimental

7-- Stability : experimental

12-- Portability : unknown

8-- Portability : unknown

@@ -29,7 +25,6 @@ module Data.Attoparsec.ByteString

29 I.Parser

25 I.Parser

30 , Result

26 , Result

31 , T.IResult(..)

27 , T.IResult(..)

32− , I.compareResults

33

28

34 -- * Running parsers

29 -- * Running parsers

35 , parse

30 , parse

@@ -42,6 +37,11 @@ module Data.Attoparsec.ByteString

42 , maybeResult

37 , maybeResult

43 , eitherResult

38 , eitherResult

44

39

40+ -- * Combinators

41+ , (I.<?>)

42+ , I.try

43+ , module Data.Attoparsec.Combinator

44+

45 -- * Parsing individual bytes

46 , I.word8

47 , I.anyWord8

@@ -50,10 +50,6 @@ module Data.Attoparsec.ByteString

50 , I.satisfyWith

51 , I.skip

52

53− -- ** Lookahead

54− , I.peekWord8

55− , I.peekWord8'

56−

57 -- ** Byte classes

53 -- ** Byte classes

58 , I.inClass

54 , I.inClass

59 , I.notInClass

55 , I.notInClass

@@ -63,7 +59,6 @@ module Data.Attoparsec.ByteString

63 , I.skipWhile

59 , I.skipWhile

64 , I.take

60 , I.take

65 , I.scan

61 , I.scan

66− , I.runScanner

67 , I.takeWhile

62 , I.takeWhile

68 , I.takeWhile1

63 , I.takeWhile1

69 , I.takeTill

64 , I.takeTill

@@ -72,85 +67,62 @@ module Data.Attoparsec.ByteString

72 , I.takeByteString

67 , I.takeByteString

73 , I.takeLazyByteString

68 , I.takeLazyByteString

74

69

75− -- * Combinators

76− , try

77− , (<?>)

78− , choice

79− , count

80− , option

81− , many'

82− , many1

83− , many1'

84− , manyTill

85− , manyTill'

86− , sepBy

87− , sepBy'

88− , sepBy1

89− , sepBy1'

90− , skipMany

91− , skipMany1

92− , eitherP

93− , I.match

94 -- * State observation and manipulation functions

70 -- * State observation and manipulation functions

95 , I.endOfInput

71 , I.endOfInput

96 , I.atEnd

72 , I.atEnd

97 ) where

73 ) where

98

74

99import Data.Attoparsec.Combinator

75import Data.Attoparsec.Combinator

100−import Data.List (intercalate)

101import qualified Data.Attoparsec.ByteString.Internal as I

76import qualified Data.Attoparsec.ByteString.Internal as I

102−import qualified Data.Attoparsec.Internal as I

103import qualified Data.ByteString as B

77import qualified Data.ByteString as B

104import Data.Attoparsec.ByteString.Internal (Result, parse)

78import Data.Attoparsec.ByteString.Internal (Result, parse)

105import qualified Data.Attoparsec.Internal.Types as T

79import qualified Data.Attoparsec.Internal.Types as T

106

80

107-- $parsec

81-- $parsec

108--

82--

109−-- Compared to Parsec 3, attoparsec makes several tradeoffs. It is

83+-- Compared to Parsec 3, Attoparsec makes several tradeoffs. It is

110-- not intended for, or ideal for, all possible uses.

84-- not intended for, or ideal for, all possible uses.

111--

85--

112−-- * While attoparsec can consume input incrementally, Parsec cannot.

86+-- * While Attoparsec can consume input incrementally, Parsec cannot.

113-- Incremental input is a huge deal for efficient and secure network

87-- Incremental input is a huge deal for efficient and secure network

114-- and system programming, since it gives much more control to users

88-- and system programming, since it gives much more control to users

115-- of the library over matters such as resource usage and the I/O

89-- of the library over matters such as resource usage and the I/O

116-- model to use.

90-- model to use.

117--

91--

118−-- * Much of the performance advantage of attoparsec is gained via

92+-- * Much of the performance advantage of Attoparsec is gained via

119-- high-performance parsers such as 'I.takeWhile' and 'I.string'.

93-- high-performance parsers such as 'I.takeWhile' and 'I.string'.

120-- If you use complicated combinators that return lists of bytes or

94-- If you use complicated combinators that return lists of bytes or

121-- characters, there is less performance difference between the two

95-- characters, there is less performance difference between the two

122-- libraries.

96-- libraries.

123--

97--

124−-- * Unlike Parsec 3, attoparsec does not support being used as a

98+-- * Unlike Parsec 3, Attoparsec does not support being used as a

125-- monad transformer.

99-- monad transformer.

126--

100--

127−-- * attoparsec is specialised to deal only with strict 'B.ByteString'

101+-- * Attoparsec is specialised to deal only with strict 'B.ByteString'

128-- input. Efficiency concerns rule out both lists and lazy

102-- input. Efficiency concerns rule out both lists and lazy

129-- bytestrings. The usual use for lazy bytestrings would be to

103-- bytestrings. The usual use for lazy bytestrings would be to

130-- allow consumption of very large input without a large footprint.

104-- allow consumption of very large input without a large footprint.

131−-- For this need, attoparsec's incremental input provides an

105+-- For this need, Attoparsec's incremental input provides an

132-- excellent substitute, with much more control over when input

106-- excellent substitute, with much more control over when input

133−-- takes place. If you must use lazy bytestrings, see the

107+-- takes place. If you must use lazy bytestrings, see the 'Lazy'

134−-- "Data.Attoparsec.ByteString.Lazy" module, which feeds lazy chunks

135−-- to a regular parser.

108+-- module, which feeds lazy chunks to a regular parser.

136--

109--

137-- * Parsec parsers can produce more helpful error messages than

110-- * Parsec parsers can produce more helpful error messages than

138−-- attoparsec parsers. This is a matter of focus: attoparsec avoids

111+-- Attoparsec parsers. This is a matter of focus: Attoparsec avoids

139-- the extra book-keeping in favour of higher performance.

112-- the extra book-keeping in favour of higher performance.

140

113

141-- $incremental

114-- $incremental

142--

115--

143−-- attoparsec supports incremental input, meaning that you can feed it

116+-- Attoparsec supports incremental input, meaning that you can feed it

144-- a bytestring that represents only part of the expected total amount

117-- a bytestring that represents only part of the expected total amount

145-- of data to parse. If your parser reaches the end of a fragment of

118-- of data to parse. If your parser reaches the end of a fragment of

146-- input and could consume more input, it will suspend parsing and

119-- input and could consume more input, it will suspend parsing and

147-- return a 'T.Partial' continuation.

120-- return a 'T.Partial' continuation.

148--

121--

149−-- Supplying the 'T.Partial' continuation with a bytestring will

122+-- Supplying the 'T.Partial' continuation with another bytestring will

150−-- resume parsing at the point where it was suspended, with the

123+-- resume parsing at the point where it was suspended. You must be

151−-- bytestring you supplied used as new input at the end of the

152−-- existing input. You must be prepared for the result of the resumed

124+-- prepared for the result of the resumed parse to be another

153−-- parse to be another 'T.Partial' continuation.

125+-- 'T.Partial' continuation.

154--

126--

155-- To indicate that you have no more input, supply the 'T.Partial'

127-- To indicate that you have no more input, supply the 'T.Partial'

156-- continuation with an empty bytestring.

128-- continuation with an empty bytestring.

@@ -162,19 +134,12 @@ import qualified Data.Attoparsec.Internal.Types as T

162-- If you do not need support for incremental input, consider using

134-- If you do not need support for incremental input, consider using

163-- the 'I.parseOnly' function to run your parser. It will never

135-- the 'I.parseOnly' function to run your parser. It will never

164-- prompt for more input.

136-- prompt for more input.

165−--

166−-- /Note/: incremental input does /not/ imply that attoparsec will

167−-- release portions of its internal state for garbage collection as it

168−-- proceeds. Its internal representation is equivalent to a single

169−-- 'ByteString': if you feed incremental input to a parser, it will

170−-- require memory proportional to the amount of input you supply.

171−-- (This is necessary to support arbitrary backtracking.)

172

137

173-- $performance

138-- $performance

174--

139--

175−-- If you write an attoparsec-based parser carefully, it can be

140+-- If you write an Attoparsec-based parser carefully, it can be

176−-- realistic to expect it to perform similarly to a hand-rolled C

141+-- realistic to expect it to perform within a factor of 2 of a

177−-- parser (measuring megabytes parsed per second).

142+-- hand-rolled C parser (measuring megabytes parsed per second).

178--

143--

179-- To actually achieve high performance, there are a few guidelines

144-- To actually achieve high performance, there are a few guidelines

180-- that it is useful to follow.

145-- that it is useful to follow.

@@ -195,6 +160,14 @@ import qualified Data.Attoparsec.Internal.Types as T

195-- Make active use of benchmarking and profiling tools to measure,

160-- Make active use of benchmarking and profiling tools to measure,

196-- find the problems with, and improve the performance of your parser.

161-- find the problems with, and improve the performance of your parser.

197

162

163+-- | If a parser has returned a 'T.Partial' result, supply it with more

164+-- input.

165+feed :: Result r -> B.ByteString -> Result r

166+feed f@(T.Fail _ _ _) _ = f

167+feed (T.Partial k) d = k d

168+feed (T.Done bs r) d = T.Done (B.append bs d) r

169+{-# INLINE feed #-}

170+

198-- | Run a parser and print its result to standard output.

171-- | Run a parser and print its result to standard output.

199parseTest :: (Show a) => I.Parser a -> B.ByteString -> IO ()

172parseTest :: (Show a) => I.Parser a -> B.ByteString -> IO ()

200parseTest p s = print (parse p s)

173parseTest p s = print (parse p s)

@@ -224,7 +197,6 @@ maybeResult _ = Nothing

224-- | Convert a 'Result' value to an 'Either' value. A 'T.Partial'

197-- | Convert a 'Result' value to an 'Either' value. A 'T.Partial'

225-- result is treated as failure.

198-- result is treated as failure.

226eitherResult :: Result r -> Either String r

199eitherResult :: Result r -> Either String r

227−eitherResult (T.Done _ r) = Right r

200+eitherResult (T.Done _ r) = Right r

228−eitherResult (T.Fail _ [] msg) = Left msg

201+eitherResult (T.Fail _ _ msg) = Left msg

229−eitherResult (T.Fail _ ctxs msg) = Left (intercalate " > " ctxs ++ ": " ++ msg)

230−eitherResult _ = Left "Result: incomplete input"

202+eitherResult _ = Left "Result: incomplete input"

Data/Attoparsec/ByteString/Buffer.hsdeleted−156

@@ -1,156 +0,0 @@

1−{-# LANGUAGE BangPatterns #-}

2−-- |

3−-- Module : Data.Attoparsec.ByteString.Buffer

4−-- Copyright : Bryan O'Sullivan 2007-2015

5−-- License : BSD3

6−--

7−-- Maintainer : bos@serpentine.com

8−-- Stability : experimental

9−-- Portability : GHC

10−--

11−-- An "immutable" buffer that supports cheap appends.

12−--

13−-- A Buffer is divided into an immutable read-only zone, followed by a

14−-- mutable area that we've preallocated, but not yet written to.

15−--

16−-- We overallocate at the end of a Buffer so that we can cheaply

17−-- append. Since a user of an existing Buffer cannot see past the end

18−-- of its immutable zone into the data that will change during an

19−-- append, this is safe.

20−--

21−-- Once we run out of space at the end of a Buffer, we do the usual

22−-- doubling of the buffer size.

23−--

24−-- The fact of having a mutable buffer really helps with performance,

25−-- but it does have a consequence: if someone misuses the Partial API

26−-- that attoparsec uses by calling the same continuation repeatedly

27−-- (which never makes sense in practice), they could overwrite data.

28−--

29−-- Since the API *looks* pure, it should *act* pure, too, so we use

30−-- two generation counters (one mutable, one immutable) to track the

31−-- number of appends to a mutable buffer. If the counters ever get out

32−-- of sync, someone is appending twice to a mutable buffer, so we

33−-- duplicate the entire buffer in order to preserve the immutability

34−-- of its older self.

35−--

36−-- While we could go a step further and gain protection against API

37−-- abuse on a multicore system, by use of an atomic increment

38−-- instruction to bump the mutable generation counter, that would be

39−-- very expensive, and feels like it would also be in the realm of the

40−-- ridiculous. Clients should never call a continuation more than

41−-- once; we lack a linear type system that could enforce this; and

42−-- there's only so far we should go to accommodate broken uses.

43−

44−module Data.Attoparsec.ByteString.Buffer

45− (

46− Buffer

47− , buffer

48− , unbuffer

49− , pappend

50− , length

51− , unsafeIndex

52− , substring

53− , unsafeDrop

54− ) where

55−

56−import Control.Exception (assert)

57−import Data.ByteString.Internal (ByteString(..), memcpy, nullForeignPtr)

58−import Data.Attoparsec.Internal.Fhthagn (inlinePerformIO)

59−import Data.List (foldl1')

60−import Data.Monoid as Mon (Monoid(..))

61−import Data.Semigroup (Semigroup(..))

62−import Data.Word (Word8)

63−import Foreign.ForeignPtr (ForeignPtr, withForeignPtr)

64−import Foreign.Ptr (castPtr, plusPtr)

65−import Foreign.Storable (peek, peekByteOff, poke, sizeOf)

66−import GHC.ForeignPtr (mallocPlainForeignPtrBytes)

67−import Prelude hiding (length)

68−

69−-- If _cap is zero, this buffer is empty.

70−data Buffer = Buf {

71− _fp :: {-# UNPACK #-} !(ForeignPtr Word8)

72− , _off :: {-# UNPACK #-} !Int

73− , _len :: {-# UNPACK #-} !Int

74− , _cap :: {-# UNPACK #-} !Int

75− , _gen :: {-# UNPACK #-} !Int

76− }

77−

78−instance Show Buffer where

79− showsPrec p = showsPrec p . unbuffer

80−

81−-- | The initial 'Buffer' has no mutable zone, so we can avoid all

82−-- copies in the (hopefully) common case of no further input being fed

83−-- to us.

84−buffer :: ByteString -> Buffer

85−buffer (PS fp off len) = Buf fp off len len 0

86−

87−unbuffer :: Buffer -> ByteString

88−unbuffer (Buf fp off len _ _) = PS fp off len

89−

90−instance Semigroup Buffer where

91− (Buf _ _ _ 0 _) <> b = b

92− a <> (Buf _ _ _ 0 _) = a

93− buf <> (Buf fp off len _ _) = append buf fp off len

94−

95−instance Monoid Buffer where

96− mempty = Buf nullForeignPtr 0 0 0 0

97−

98− mappend = (<>)

99−

100− mconcat [] = Mon.mempty

101− mconcat xs = foldl1' mappend xs

102−

103−pappend :: Buffer -> ByteString -> Buffer

104−pappend (Buf _ _ _ 0 _) bs = buffer bs

105−pappend buf (PS fp off len) = append buf fp off len

106−

107−append :: Buffer -> ForeignPtr a -> Int -> Int -> Buffer

108−append (Buf fp0 off0 len0 cap0 gen0) !fp1 !off1 !len1 =

109− inlinePerformIO . withForeignPtr fp0 $ \ptr0 ->

110− withForeignPtr fp1 $ \ptr1 -> do

111− let genSize = sizeOf (0::Int)

112− newlen = len0 + len1

113− gen <- if gen0 == 0

114− then return 0

115− else peek (castPtr ptr0)

116− if gen == gen0 && newlen <= cap0

117− then do

118− let newgen = gen + 1

119− poke (castPtr ptr0) newgen

120− memcpy (ptr0 `plusPtr` (off0+len0))

121− (ptr1 `plusPtr` off1)

122− (fromIntegral len1)

123− return (Buf fp0 off0 newlen cap0 newgen)

124− else do

125− let newcap = newlen * 2

126− fp <- mallocPlainForeignPtrBytes (newcap + genSize)

127− withForeignPtr fp $ \ptr_ -> do

128− let ptr = ptr_ `plusPtr` genSize

129− newgen = 1

130− poke (castPtr ptr_) newgen

131− memcpy ptr (ptr0 `plusPtr` off0) (fromIntegral len0)

132− memcpy (ptr `plusPtr` len0) (ptr1 `plusPtr` off1)

133− (fromIntegral len1)

134− return (Buf fp genSize newlen newcap newgen)

135−

136−length :: Buffer -> Int

137−length (Buf _ _ len _ _) = len

138−{-# INLINE length #-}

139−

140−unsafeIndex :: Buffer -> Int -> Word8

141−unsafeIndex (Buf fp off len _ _) i = assert (i >= 0 && i < len) .

142− inlinePerformIO . withForeignPtr fp $ flip peekByteOff (off+i)

143−{-# INLINE unsafeIndex #-}

144−

145−substring :: Int -> Int -> Buffer -> ByteString

146−substring s l (Buf fp off len _ _) =

147− assert (s >= 0 && s <= len) .

148− assert (l >= 0 && l <= len-s) $

149− PS fp (off+s) l

150−{-# INLINE substring #-}

151−

152−unsafeDrop :: Int -> Buffer -> ByteString

153−unsafeDrop s (Buf fp off len _ _) =

154− assert (s >= 0 && s <= len) $

155− PS fp (off+s) (len-s)

156−{-# INLINE unsafeDrop #-}

Data/Attoparsec/ByteString/Char8.hs+104−174

@@ -1,15 +1,11 @@

1−{-# LANGUAGE BangPatterns, CPP, FlexibleInstances, TypeFamilies,

1+{-# LANGUAGE BangPatterns, FlexibleInstances, TypeSynonymInstances #-}

2− TypeSynonymInstances, GADTs #-}

3−#if __GLASGOW_HASKELL__ >= 702

4−{-# LANGUAGE Trustworthy #-} -- Imports internal modules

5−#endif

6−{-# OPTIONS_GHC -fno-warn-orphans -fno-warn-warnings-deprecations #-}

2+{-# OPTIONS_GHC -fno-warn-orphans #-}

7

3

8-- |

4-- |

9-- Module : Data.Attoparsec.ByteString.Char8

5-- Module : Data.Attoparsec.ByteString.Char8

10−-- Copyright : Bryan O'Sullivan 2007-2015

6+-- Copyright : Bryan O'Sullivan 2007-2011

11-- License : BSD3

7-- License : BSD3

12−--

8+--

13-- Maintainer : bos@serpentine.com

9-- Maintainer : bos@serpentine.com

14-- Stability : experimental

10-- Stability : experimental

15-- Portability : unknown

11-- Portability : unknown

@@ -25,20 +21,23 @@ module Data.Attoparsec.ByteString.Char8

25 -- * Parser types

21 -- * Parser types

26 Parser

22 Parser

27 , A.Result

23 , A.Result

28− , A.IResult(..)

29− , I.compareResults

30

24

31 -- * Running parsers

25 -- * Running parsers

32 , A.parse

26 , A.parse

33 , A.feed

27 , A.feed

34 , A.parseOnly

28 , A.parseOnly

35− , A.parseWith

36 , A.parseTest

29 , A.parseTest

30+ , A.parseWith

37

31

38 -- ** Result conversion

32 -- ** Result conversion

39 , A.maybeResult

33 , A.maybeResult

40 , A.eitherResult

34 , A.eitherResult

41

35

36+ -- * Combinators

37+ , (I.<?>)

38+ , I.try

39+ , module Data.Attoparsec.Combinator

40+

42 -- * Parsing individual characters

41 -- * Parsing individual characters

43 , char

42 , char

44 , char8

43 , char8

@@ -46,10 +45,6 @@ module Data.Attoparsec.ByteString.Char8

46 , notChar

45 , notChar

47 , satisfy

46 , satisfy

48

47

49− -- ** Lookahead

50− , peekChar

51− , peekChar'

52−

53 -- ** Special character parsers

48 -- ** Special character parsers

54 , digit

49 , digit

55 , letter_iso8859_15

50 , letter_iso8859_15

@@ -70,7 +65,7 @@ module Data.Attoparsec.ByteString.Char8

70

65

71 -- * Efficient string handling

66 -- * Efficient string handling

72 , I.string

67 , I.string

73− , I.stringCI

68+ , stringCI

74 , skipSpace

69 , skipSpace

75 , skipWhile

70 , skipWhile

76 , I.take

71 , I.take

@@ -79,11 +74,6 @@ module Data.Attoparsec.ByteString.Char8

79 , takeWhile1

74 , takeWhile1

80 , takeTill

75 , takeTill

81

76

82− -- ** String combinators

83− -- $specalt

84− , (.*>)

85− , (<*.)

86−

87 -- ** Consume all remaining input

77 -- ** Consume all remaining input

88 , I.takeByteString

78 , I.takeByteString

89 , I.takeLazyByteString

79 , I.takeLazyByteString

@@ -101,57 +91,30 @@ module Data.Attoparsec.ByteString.Char8

101 , Number(..)

91 , Number(..)

102 , number

92 , number

103 , rational

93 , rational

104− , scientific

105

94

106− -- * Combinators

107− , try

108− , (<?>)

109− , choice

110− , count

111− , option

112− , many'

113− , many1

114− , many1'

115− , manyTill

116− , manyTill'

117− , sepBy

118− , sepBy'

119− , sepBy1

120− , sepBy1'

121− , skipMany

122− , skipMany1

123− , eitherP

124− , I.match

125 -- * State observation and manipulation functions

95 -- * State observation and manipulation functions

126 , I.endOfInput

96 , I.endOfInput

127 , I.atEnd

97 , I.atEnd

128 ) where

98 ) where

129

99

130−#if !MIN_VERSION_base(4,8,0)

131−import Control.Applicative (pure, (*>), (<*), (<$>))

100+import Control.Applicative ((*>), (<$>), (<|>))

132−import Data.Word (Word)

133−#endif

134−import Control.Applicative ((<|>))

135−import Control.Monad (void, when)

136import Data.Attoparsec.ByteString.FastSet (charClass, memberChar)

101import Data.Attoparsec.ByteString.FastSet (charClass, memberChar)

137−import Data.Attoparsec.ByteString.Internal (Parser)

102+import Data.Attoparsec.ByteString.Internal (Parser, (<?>))

138import Data.Attoparsec.Combinator

103import Data.Attoparsec.Combinator

139import Data.Attoparsec.Number (Number(..))

104import Data.Attoparsec.Number (Number(..))

140import Data.Bits (Bits, (.|.), shiftL)

105import Data.Bits (Bits, (.|.), shiftL)

141import Data.ByteString.Internal (c2w, w2c)

106import Data.ByteString.Internal (c2w, w2c)

142import Data.Int (Int8, Int16, Int32, Int64)

107import Data.Int (Int8, Int16, Int32, Int64)

108+import Data.Ratio ((%))

143import Data.String (IsString(..))

109import Data.String (IsString(..))

144−import Data.Scientific (Scientific)

145−import qualified Data.Scientific as Sci

146−import Data.Word (Word8, Word16, Word32, Word64)

110+import Data.Word (Word8, Word16, Word32, Word64, Word)

147import Prelude hiding (takeWhile)

111import Prelude hiding (takeWhile)

148import qualified Data.Attoparsec.ByteString as A

112import qualified Data.Attoparsec.ByteString as A

149import qualified Data.Attoparsec.ByteString.Internal as I

113import qualified Data.Attoparsec.ByteString.Internal as I

150−import qualified Data.Attoparsec.Internal as I

151import qualified Data.ByteString as B8

114import qualified Data.ByteString as B8

152import qualified Data.ByteString.Char8 as B

115import qualified Data.ByteString.Char8 as B

153

116

154−instance (a ~ B.ByteString) => IsString (Parser a) where

117+instance IsString (Parser B.ByteString) where

155 fromString = I.string . B.pack

118 fromString = I.string . B.pack

156

119

157-- $encodings

120-- $encodings

@@ -169,6 +132,16 @@ instance (a ~ B.ByteString) => IsString (Parser a) where

169-- currency sign in ISO-8859-1). Haskell 'Char' values above U+00FF

132-- currency sign in ISO-8859-1). Haskell 'Char' values above U+00FF

170-- are truncated, so e.g. U+1D6B7 is truncated to the byte @0xB7@.

133-- are truncated, so e.g. U+1D6B7 is truncated to the byte @0xB7@.

171

134

135+-- ASCII-specific but fast, oh yes.

136+toLower :: Word8 -> Word8

137+toLower w | w >= 65 && w <= 90 = w + 32

138+ | otherwise = w

139+

140+-- | Satisfy a literal string, ignoring case.

141+stringCI :: B.ByteString -> Parser B.ByteString

142+stringCI = I.stringTransform (B8.map toLower)

143+{-# INLINE stringCI #-}

144+

172-- | Consume input as long as the predicate returns 'True', and return

145-- | Consume input as long as the predicate returns 'True', and return

173-- the consumed input.

146-- the consumed input.

174--

147--

@@ -232,7 +205,7 @@ isDigit c = c >= '0' && c <= '9'

232

205

233-- | A fast digit predicate.

206-- | A fast digit predicate.

234isDigit_w8 :: Word8 -> Bool

207isDigit_w8 :: Word8 -> Bool

235−isDigit_w8 w = w - 48 <= 9

208+isDigit_w8 w = w >= 48 && w <= 57

236{-# INLINE isDigit_w8 #-}

209{-# INLINE isDigit_w8 #-}

237

210

238-- | Match any character.

211-- | Match any character.

@@ -240,22 +213,6 @@ anyChar :: Parser Char

240anyChar = satisfy $ const True

213anyChar = satisfy $ const True

241{-# INLINE anyChar #-}

214{-# INLINE anyChar #-}

242

215

243−-- | Match any character, to perform lookahead. Returns 'Nothing' if

244−-- end of input has been reached. Does not consume any input.

245−--

246−-- /Note/: Because this parser does not fail, do not use it with

247−-- combinators such as 'many', because such parsers loop until a

248−-- failure occurs. Careless use will thus result in an infinite loop.

249−peekChar :: Parser (Maybe Char)

250−peekChar = (fmap w2c) `fmap` I.peekWord8

251−{-# INLINE peekChar #-}

252−

253−-- | Match any character, to perform lookahead. Does not consume any

254−-- input, but will fail if end of input has been reached.

255−peekChar' :: Parser Char

256−peekChar' = w2c `fmap` I.peekWord8'

257−{-# INLINE peekChar' #-}

258−

259-- | Fast predicate for matching ASCII space characters.

216-- | Fast predicate for matching ASCII space characters.

260--

217--

261-- /Note/: This predicate only gives correct answers for the ASCII

218-- /Note/: This predicate only gives correct answers for the ASCII

@@ -269,7 +226,7 @@ isSpace c = (c == ' ') || ('\t' <= c && c <= '\r')

269

226

270-- | Fast 'Word8' predicate for matching ASCII space characters.

227-- | Fast 'Word8' predicate for matching ASCII space characters.

271isSpace_w8 :: Word8 -> Bool

228isSpace_w8 :: Word8 -> Bool

272−isSpace_w8 w = w == 32 || w - 9 <= 4

229+isSpace_w8 w = (w == 32) || (9 <= w && w <= 13)

273{-# INLINE isSpace_w8 #-}

230{-# INLINE isSpace_w8 #-}

274

231

275

232

@@ -369,42 +326,6 @@ skipSpace :: Parser ()

369skipSpace = I.skipWhile isSpace_w8

326skipSpace = I.skipWhile isSpace_w8

370{-# INLINE skipSpace #-}

327{-# INLINE skipSpace #-}

371

328

372−-- $specalt

373−--

374−-- If you enable the @OverloadedStrings@ language extension, you can

375−-- use the '*>' and '<*' combinators to simplify the common task of

376−-- matching a statically known string, then immediately parsing

377−-- something else.

378−--

379−-- Instead of writing something like this:

380−--

381−-- @

382−--'I.string' \"foo\" '*>' wibble

383−-- @

384−--

385−-- Using @OverloadedStrings@, you can omit the explicit use of

386−-- 'I.string', and write a more compact version:

387−--

388−-- @

389−-- \"foo\" '*>' wibble

390−-- @

391−--

392−-- (Note: the '.*>' and '<*.' combinators that were originally

393−-- provided for this purpose are obsolete and unnecessary, and will be

394−-- removed in the next major version.)

395−

396−-- | /Obsolete/. A type-specialized version of '*>' for

397−-- 'B.ByteString'. Use '*>' instead.

398−(.*>) :: B.ByteString -> Parser a -> Parser a

399−s .*> f = I.string s *> f

400−{-# DEPRECATED (.*>) "This is no longer necessary, and will be removed. Use '*>' instead." #-}

401−

402−-- | /Obsolete/. A type-specialized version of '<*' for

403−-- 'B.ByteString'. Use '<*' instead.

404−(<*.) :: Parser a -> B.ByteString -> Parser a

405−f <*. s = f <* I.string s

406−{-# DEPRECATED (<*.) "This is no longer necessary, and will be removed. Use '<*' instead." #-}

407−

408-- | A predicate that matches either a carriage return @\'\\r\'@ or

329-- | A predicate that matches either a carriage return @\'\\r\'@ or

409-- newline @\'\\n\'@ character.

330-- newline @\'\\n\'@ character.

410isEndOfLine :: Word8 -> Bool

331isEndOfLine :: Word8 -> Bool

@@ -426,7 +347,7 @@ hexadecimal = B8.foldl' step 0 `fmap` I.takeWhile1 isHexDigit

426 where

347 where

427 isHexDigit w = (w >= 48 && w <= 57) ||

348 isHexDigit w = (w >= 48 && w <= 57) ||

428 (w >= 97 && w <= 102) ||

349 (w >= 97 && w <= 102) ||

429− (w >= 65 && w <= 70)

350+ (w >= 65 && w <= 90)

430 step a w | w >= 48 && w <= 57 = (a `shiftL` 4) .|. fromIntegral (w - 48)

351 step a w | w >= 48 && w <= 57 = (a `shiftL` 4) .|. fromIntegral (w - 48)

431 | w >= 97 = (a `shiftL` 4) .|. fromIntegral (w - 87)

352 | w >= 97 = (a `shiftL` 4) .|. fromIntegral (w - 87)

432 | otherwise = (a `shiftL` 4) .|. fromIntegral (w - 55)

353 | otherwise = (a `shiftL` 4) .|. fromIntegral (w - 55)

@@ -444,8 +365,9 @@ hexadecimal = B8.foldl' step 0 `fmap` I.takeWhile1 isHexDigit

444

365

445-- | Parse and decode an unsigned decimal number.

366-- | Parse and decode an unsigned decimal number.

446decimal :: Integral a => Parser a

367decimal :: Integral a => Parser a

447−decimal = B8.foldl' step 0 `fmap` I.takeWhile1 isDigit_w8

368+decimal = B8.foldl' step 0 `fmap` I.takeWhile1 isDig

369+ where isDig w = w >= 48 && w <= 57

448− where step a w = a * 10 + fromIntegral (w - 48)

370+ step a w = a * 10 + fromIntegral (w - 48)

449{-# SPECIALISE decimal :: Parser Int #-}

371{-# SPECIALISE decimal :: Parser Int #-}

450{-# SPECIALISE decimal :: Parser Int8 #-}

372{-# SPECIALISE decimal :: Parser Int8 #-}

451{-# SPECIALISE decimal :: Parser Int16 #-}

373{-# SPECIALISE decimal :: Parser Int16 #-}

@@ -471,24 +393,6 @@ signed p = (negate <$> (char8 '-' *> p))

471 <|> (char8 '+' *> p)

393 <|> (char8 '+' *> p)

472 <|> p

394 <|> p

473

395

474−-- | Parse a rational number.

475−--

476−-- The syntax accepted by this parser is the same as for 'double'.

477−--

478−-- /Note/: this parser is not safe for use with inputs from untrusted

479−-- sources. An input with a suitably large exponent such as

480−-- @"1e1000000000"@ will cause a huge 'Integer' to be allocated,

481−-- resulting in what is effectively a denial-of-service attack.

482−--

483−-- In most cases, it is better to use 'double' or 'scientific'

484−-- instead.

485−rational :: Fractional a => Parser a

486−{-# SPECIALIZE rational :: Parser Double #-}

487−{-# SPECIALIZE rational :: Parser Float #-}

488−{-# SPECIALIZE rational :: Parser Rational #-}

489−{-# SPECIALIZE rational :: Parser Scientific #-}

490−rational = scientifically realToFrac

491−

492-- | Parse a rational number.

396-- | Parse a rational number.

493--

397--

494-- This parser accepts an optional leading sign character, followed by

398-- This parser accepts an optional leading sign character, followed by

@@ -503,7 +407,7 @@ rational = scientifically realToFrac

503-- >rational "3.1" == Done 3.1 ""

407-- >rational "3.1" == Done 3.1 ""

504-- >rational "3e4" == Done 30000.0 ""

408-- >rational "3e4" == Done 30000.0 ""

505-- >rational "3.1e4" == Done 31000.0, ""

409-- >rational "3.1e4" == Done 31000.0, ""

506−--

410+

507-- Examples with behaviour identical to 'read':

411-- Examples with behaviour identical to 'read':

508--

412--

509-- >rational ".3" == Fail "input does not start with a digit"

413-- >rational ".3" == Fail "input does not start with a digit"

@@ -516,57 +420,83 @@ rational = scientifically realToFrac

516--

420--

517-- This function does not accept string representations of \"NaN\" or

421-- This function does not accept string representations of \"NaN\" or

518-- \"Infinity\".

422-- \"Infinity\".

423+rational :: Fractional a => Parser a

424+{-# SPECIALIZE rational :: Parser Double #-}

425+{-# SPECIALIZE rational :: Parser Float #-}

426+{-# SPECIALIZE rational :: Parser Rational #-}

427+rational = floaty $ \real frac fracDenom -> fromRational $

428+ real % 1 + frac % fracDenom

429+

430+-- | Parse a rational number.

431+--

432+-- The syntax accepted by this parser is the same as for 'rational'.

433+--

434+-- /Note/: This function is almost ten times faster than 'rational',

435+-- but is slightly less accurate.

436+--

437+-- The 'Double' type supports about 16 decimal places of accuracy.

438+-- For 94.2% of numbers, this function and 'rational' give identical

439+-- results, but for the remaining 5.8%, this function loses precision

440+-- around the 15th decimal place. For 0.001% of numbers, this

441+-- function will lose precision at the 13th or 14th decimal place.

442+--

443+-- This function does not accept string representations of \"NaN\" or

444+-- \"Infinity\".

519double :: Parser Double

445double :: Parser Double

520−double = scientifically Sci.toRealFloat

446+double = floaty asDouble

447+

448+asDouble :: Integer -> Integer -> Integer -> Double

449+asDouble real frac fracDenom =

450+ fromIntegral real + fromIntegral frac / fromIntegral fracDenom

451+{-# INLINE asDouble #-}

521

452

522-- | Parse a number, attempting to preserve both speed and precision.

453-- | Parse a number, attempting to preserve both speed and precision.

523--

454--

524−-- The syntax accepted by this parser is the same as for 'double'.

455+-- The syntax accepted by this parser is the same as for 'rational'.

456+--

457+-- /Note/: This function is almost ten times faster than 'rational'.

458+-- On integral inputs, it gives perfectly accurate answers, and on

459+-- floating point inputs, it is slightly less accurate than

460+-- 'rational'.

461+--

462+-- This function does not accept string representations of \"NaN\" or

463+-- \"Infinity\".

525number :: Parser Number

464number :: Parser Number

526−number = scientifically $ \s ->

465+number = floaty $ \real frac fracDenom ->

527− let e = Sci.base10Exponent s

466+ if frac == 0 && fracDenom == 0

528− c = Sci.coefficient s

529− in if e >= 0

530− then I (c * 10 ^ e)

467+ then I real

531− else D (Sci.toRealFloat s)

468+ else D (asDouble real frac fracDenom)

532−{-# DEPRECATED number "Use 'scientific' instead." #-}

469+{-# INLINE number #-}

533−

534−-- | Parse a scientific number.

535−--

536−-- The syntax accepted by this parser is the same as for 'double'.

537−scientific :: Parser Scientific

538−scientific = scientifically id

539−

540−-- A strict pair

541−data SP = SP !Integer {-# UNPACK #-}!Int

542−

543−{-# INLINE scientifically #-}

544−scientifically :: (Scientific -> a) -> Parser a

545−scientifically h = do

546− let minus = 45

547− plus = 43

548− sign <- I.peekWord8'

549− let !positive = sign == plus || sign /= minus

550− when (sign == plus || sign == minus) $

551− void $ I.anyWord8

552−

553− n <- decimal

554−

555− let f fracDigits = SP (B8.foldl' step n fracDigits)

556− (negate $ B8.length fracDigits)

557− step a w = a * 10 + fromIntegral (w - 48)

558

470

559− dotty <- I.peekWord8

471+data T = T !Integer !Int

560− -- '.' -> ascii 46

561− SP c e <- case dotty of

562− Just 46 -> I.anyWord8 *> (f <$> I.takeWhile isDigit_w8)

563− _ -> pure (SP n 0)

564−

565− let !signedCoeff | positive = c

566− | otherwise = -c

567

472

473+floaty :: Fractional a => (Integer -> Integer -> Integer -> a) -> Parser a

474+{-# INLINE floaty #-}

475+floaty f = do

476+ let minus = 45

477+ plus = 43

478+ !positive <- ((== plus) <$> I.satisfy (\c -> c == minus || c == plus)) <|>

479+ return True

480+ real <- decimal

481+ let tryFraction = do

482+ let dot = 46

483+ _ <- I.satisfy (==dot)

484+ ds <- I.takeWhile isDigit_w8

485+ case I.parseOnly decimal ds of

486+ Right n -> return $ T n (B.length ds)

487+ _ -> fail "no digits after decimal"

488+ T fraction fracDigits <- tryFraction <|> return (T 0 0)

568 let littleE = 101

489 let littleE = 101

569 bigE = 69

490 bigE = 69

570− (I.satisfy (\ex -> ex == littleE || ex == bigE) *>

491+ e w = w == littleE || w == bigE

571− fmap (h . Sci.scientific signedCoeff . (e +)) (signed decimal)) <|>

492+ power <- (I.satisfy e *> signed decimal) <|> return (0::Int)

572− return (h $ Sci.scientific signedCoeff e)

493+ let n = if fracDigits == 0

494+ then if power == 0

495+ then fromIntegral real

496+ else fromIntegral real * (10 ^^ power)

497+ else if power == 0

498+ then f real fraction (10 ^ fracDigits)

499+ else f real fraction (10 ^ fracDigits) * (10 ^^ power)

500+ return $ if positive

501+ then n

502+ else -n

Data/Attoparsec/ByteString/FastSet.hs+4−4

@@ -3,9 +3,9 @@

3-----------------------------------------------------------------------------

4-- |

5-- Module : Data.Attoparsec.ByteString.FastSet

6−-- Copyright : Bryan O'Sullivan 2007-2015

6+-- Copyright : Bryan O'Sullivan 2008

7-- License : BSD3

8−--

8+--

9-- Maintainer : bos@serpentine.com

10-- Stability : experimental

11-- Portability : unknown

@@ -14,7 +14,7 @@

14-- set representation is unboxed for efficiency. For small sets, we

15-- test for membership using a binary search. For larger sets, we use

16-- a lookup table.

17−--

17+--

18-----------------------------------------------------------------------------

19module Data.Attoparsec.ByteString.FastSet

20 (

@@ -83,7 +83,7 @@ memberWord8 w (Sorted s) = search 0 (B.length s - 1)

83 where search lo hi

84 | hi < lo = False

85 | otherwise =

86− let mid = (lo + hi) `quot` 2

86+ let mid = (lo + hi) `div` 2

87 in case compare w (U.unsafeIndex s mid) of

88 GT -> search (mid + 1) hi

89 LT -> search lo (mid - 1)

Data/Attoparsec/ByteString/Internal.hs+211−288

@@ -1,15 +1,14 @@

1−{-# LANGUAGE BangPatterns, CPP, GADTs, OverloadedStrings, RankNTypes,

1+{-# LANGUAGE BangPatterns, Rank2Types, OverloadedStrings, RecordWildCards #-}

2− RecordWildCards #-}

3-- |

2-- |

4-- Module : Data.Attoparsec.ByteString.Internal

3-- Module : Data.Attoparsec.ByteString.Internal

5−-- Copyright : Bryan O'Sullivan 2007-2015

4+-- Copyright : Bryan O'Sullivan 2007-2011

6-- License : BSD3

5-- License : BSD3

7--

6--

8-- Maintainer : bos@serpentine.com

7-- Maintainer : bos@serpentine.com

9-- Stability : experimental

8-- Stability : experimental

10-- Portability : unknown

9-- Portability : unknown

11--

10--

12−-- Simple, efficient parser combinators for 'ByteString' strings,

11+-- Simple, efficient parser combinators for 'B.ByteString' strings,

13-- loosely based on the Parsec library.

12-- loosely based on the Parsec library.

14

13

15module Data.Attoparsec.ByteString.Internal

14module Data.Attoparsec.ByteString.Internal

@@ -23,6 +22,8 @@ module Data.Attoparsec.ByteString.Internal

23 , parseOnly

22 , parseOnly

24

23

25 -- * Combinators

24 -- * Combinators

25+ , (<?>)

26+ , try

26 , module Data.Attoparsec.Combinator

27 , module Data.Attoparsec.Combinator

27

28

28 -- * Parsing individual bytes

29 -- * Parsing individual bytes

@@ -33,10 +34,6 @@ module Data.Attoparsec.ByteString.Internal

33 , word8

34 , word8

34 , notWord8

35 , notWord8

35

36

36− -- ** Lookahead

37− , peekWord8

38− , peekWord8'

39−

40 -- ** Byte classes

37 -- ** Byte classes

41 , inClass

38 , inClass

42 , notInClass

39 , notInClass

@@ -47,10 +44,9 @@ module Data.Attoparsec.ByteString.Internal

47 -- * Efficient string handling

44 -- * Efficient string handling

48 , skipWhile

45 , skipWhile

49 , string

46 , string

50− , stringCI

47+ , stringTransform

51 , take

48 , take

52 , scan

49 , scan

53− , runScanner

54 , takeWhile

50 , takeWhile

55 , takeWhile1

51 , takeWhile1

56 , takeTill

52 , takeTill

@@ -59,32 +55,27 @@ module Data.Attoparsec.ByteString.Internal

59 , takeByteString

55 , takeByteString

60 , takeLazyByteString

56 , takeLazyByteString

61

57

62− -- * Utilities

58+ -- * State observation and manipulation functions

63− , endOfLine

64 , endOfInput

59 , endOfInput

65− , match

66 , atEnd

60 , atEnd

61+ , ensure

62+

63+ -- * Utilities

64+ , endOfLine

67 ) where

65 ) where

68

66

69−#if !MIN_VERSION_base(4,8,0)

70−import Control.Applicative ((<$>))

67+import Control.Applicative ((<|>), (<$>))

71−#endif

72−import Control.Applicative ((<|>))

73import Control.Monad (when)

68import Control.Monad (when)

74−import Data.Attoparsec.ByteString.Buffer (Buffer, buffer)

75import Data.Attoparsec.ByteString.FastSet (charClass, memberWord8)

69import Data.Attoparsec.ByteString.FastSet (charClass, memberWord8)

76−import Data.Attoparsec.Combinator ((<?>))

70+import Data.Attoparsec.Combinator

77−import Data.Attoparsec.Internal

78−import Data.Attoparsec.Internal.Fhthagn (inlinePerformIO)

79−import Data.Attoparsec.Internal.Types hiding (Parser, Failure, Success)

71+import Data.Attoparsec.Internal.Types

80−import Data.ByteString (ByteString)

72+ hiding (Parser, Input, Added, Failure, Success)

81−import Data.List (intercalate)

82import Data.Word (Word8)

73import Data.Word (Word8)

83import Foreign.ForeignPtr (withForeignPtr)

74import Foreign.ForeignPtr (withForeignPtr)

84import Foreign.Ptr (castPtr, minusPtr, plusPtr)

75import Foreign.Ptr (castPtr, minusPtr, plusPtr)

85import Foreign.Storable (Storable(peek, sizeOf))

76import Foreign.Storable (Storable(peek, sizeOf))

86−import Prelude hiding (getChar, succ, take, takeWhile)

77+import Prelude hiding (getChar, take, takeWhile)

87−import qualified Data.Attoparsec.ByteString.Buffer as Buf

78+import System.IO.Unsafe (unsafePerformIO)

88import qualified Data.Attoparsec.Internal.Types as T

79import qualified Data.Attoparsec.Internal.Types as T

89import qualified Data.ByteString as B8

80import qualified Data.ByteString as B8

90import qualified Data.ByteString.Char8 as B

81import qualified Data.ByteString.Char8 as B

@@ -92,10 +83,68 @@ import qualified Data.ByteString.Internal as B

92import qualified Data.ByteString.Lazy as L

83import qualified Data.ByteString.Lazy as L

93import qualified Data.ByteString.Unsafe as B

84import qualified Data.ByteString.Unsafe as B

94

85

95−type Parser = T.Parser ByteString

86+type Parser a = T.Parser B.ByteString a

96−type Result = IResult ByteString

87+type Result a = IResult B.ByteString a

88+type Input = T.Input B.ByteString

89+type Added = T.Added B.ByteString

97−type Failure r = T.Failure ByteString Buffer r

90+type Failure r = T.Failure B.ByteString r

98−type Success a r = T.Success ByteString Buffer a r

91+type Success a r = T.Success B.ByteString a r

92+

93+-- | If at least @n@ bytes of input are available, return the current

94+-- input, otherwise fail.

95+ensure :: Int -> Parser B.ByteString

96+ensure !n = T.Parser $ \i0 a0 m0 kf ks ->

97+ if B.length (unI i0) >= n

98+ then ks i0 a0 m0 (unI i0)

99+ else T.runParser (demandInput >> ensure n) i0 a0 m0 kf ks

100+

101+-- | Ask for input. If we receive any, pass it to a success

102+-- continuation, otherwise to a failure continuation.

103+prompt :: Input -> Added -> More

104+ -> (Input -> Added -> More -> Result r)

105+ -> (Input -> Added -> More -> Result r)

106+ -> Result r

107+prompt i0 a0 _m0 kf ks = Partial $ \s ->

108+ if B.null s

109+ then kf i0 a0 Complete

110+ else ks (I (unI i0 <> s)) (A (unA a0 <> s)) Incomplete

111+

112+-- | Immediately demand more input via a 'Partial' continuation

113+-- result.

114+demandInput :: Parser ()

115+demandInput = T.Parser $ \i0 a0 m0 kf ks ->

116+ if m0 == Complete

117+ then kf i0 a0 m0 ["demandInput"] "not enough bytes"

118+ else let kf' i a m = kf i a m ["demandInput"] "not enough bytes"

119+ ks' i a m = ks i a m ()

120+ in prompt i0 a0 m0 kf' ks'

121+

122+-- | This parser always succeeds. It returns 'True' if any input is

123+-- available either immediately or on demand, and 'False' if the end

124+-- of all input has been reached.

125+wantInput :: Parser Bool

126+wantInput = T.Parser $ \i0 a0 m0 _kf ks ->

127+ case () of

128+ _ | not (B.null (unI i0)) -> ks i0 a0 m0 True

129+ | m0 == Complete -> ks i0 a0 m0 False

130+ | otherwise -> let kf' i a m = ks i a m False

131+ ks' i a m = ks i a m True

132+ in prompt i0 a0 m0 kf' ks'

133+

134+get :: Parser B.ByteString

135+get = T.Parser $ \i0 a0 m0 _kf ks -> ks i0 a0 m0 (unI i0)

136+

137+put :: B.ByteString -> Parser ()

138+put s = T.Parser $ \_i0 a0 m0 _kf ks -> ks (I s) a0 m0 ()

139+

140+-- | Attempt a parse, and if it fails, rewind the input so that no

141+-- input appears to have been consumed.

142+--

143+-- This combinator is provided for compatibility with Parsec.

144+-- Attoparsec parsers always backtrack on failure.

145+try :: Parser a -> Parser a

146+try p = p

147+{-# INLINE try #-}

99

148

100-- | The parser @satisfy p@ succeeds for any byte for which the

149-- | The parser @satisfy p@ succeeds for any byte for which the

101-- predicate @p@ returns 'True'. Returns the byte that is actually

150-- predicate @p@ returns 'True'. Returns the byte that is actually

@@ -105,11 +154,11 @@ type Success a r = T.Success ByteString Buffer a r

105-- > where isDigit w = w >= 48 && w <= 57

154-- > where isDigit w = w >= 48 && w <= 57

106satisfy :: (Word8 -> Bool) -> Parser Word8

155satisfy :: (Word8 -> Bool) -> Parser Word8

107satisfy p = do

156satisfy p = do

108− h <- peekWord8'

157+ s <- ensure 1

158+ let w = B.unsafeHead s

109− if p h

159+ if p w

110− then advance 1 >> return h

160+ then put (B.unsafeTail s) >> return w

111 else fail "satisfy"

161 else fail "satisfy"

112−{-# INLINE satisfy #-}

113

162

114-- | The parser @skip p@ succeeds for any byte for which the predicate

163-- | The parser @skip p@ succeeds for any byte for which the predicate

115-- @p@ returns 'True'.

164-- @p@ returns 'True'.

@@ -118,9 +167,9 @@ satisfy p = do

118-- > where isDigit w = w >= 48 && w <= 57

167-- > where isDigit w = w >= 48 && w <= 57

119skip :: (Word8 -> Bool) -> Parser ()

168skip :: (Word8 -> Bool) -> Parser ()

120skip p = do

169skip p = do

121− h <- peekWord8'

170+ s <- ensure 1

122− if p h

171+ if p (B.unsafeHead s)

123− then advance 1

172+ then put (B.unsafeTail s)

124 else fail "skip"

173 else fail "skip"

125

174

126-- | The parser @satisfyWith f p@ transforms a byte, and succeeds if

175-- | The parser @satisfyWith f p@ transforms a byte, and succeeds if

@@ -128,12 +177,11 @@ skip p = do

128-- parser returns the transformed byte that was parsed.

177-- parser returns the transformed byte that was parsed.

129satisfyWith :: (Word8 -> a) -> (a -> Bool) -> Parser a

178satisfyWith :: (Word8 -> a) -> (a -> Bool) -> Parser a

130satisfyWith f p = do

179satisfyWith f p = do

131− h <- peekWord8'

180+ s <- ensure 1

132− let c = f h

181+ let c = f (B.unsafeHead s)

133 if p c

182 if p c

134− then advance 1 >> return c

183+ then put (B.unsafeTail s) >> return c

135 else fail "satisfyWith"

184 else fail "satisfyWith"

136−{-# INLINE satisfyWith #-}

137

185

138storable :: Storable a => Parser a

186storable :: Storable a => Parser a

139storable = hack undefined

187storable = hack undefined

@@ -141,15 +189,23 @@ storable = hack undefined

141 hack :: Storable b => b -> Parser b

189 hack :: Storable b => b -> Parser b

142 hack dummy = do

190 hack dummy = do

143 (fp,o,_) <- B.toForeignPtr `fmap` take (sizeOf dummy)

191 (fp,o,_) <- B.toForeignPtr `fmap` take (sizeOf dummy)

144− return . inlinePerformIO . withForeignPtr fp $ \p ->

192+ return . B.inlinePerformIO . withForeignPtr fp $ \p ->

145 peek (castPtr $ p `plusPtr` o)

193 peek (castPtr $ p `plusPtr` o)

146

194

147−-- | Consume exactly @n@ bytes of input.

195+-- | Consume @n@ bytes of input, but succeed only if the predicate

196+-- returns 'True'.

148−take :: Int -> Parser ByteString

197+takeWith :: Int -> (B.ByteString -> Bool) -> Parser B.ByteString

149−take n0 = do

198+takeWith n p = do

150− let n = max n0 0

151 s <- ensure n

199 s <- ensure n

200+ let h = B.unsafeTake n s

201+ t = B.unsafeDrop n s

202+ if p h

152− advance n >> return s

203+ then put t >> return h

204+ else fail "takeWith"

205+

206+-- | Consume exactly @n@ bytes of input.

207+take :: Int -> Parser B.ByteString

208+take n = takeWith n (const True)

153{-# INLINE take #-}

209{-# INLINE take #-}

154

210

155-- | @string s@ parses a sequence of bytes that identically match

211-- | @string s@ parses a sequence of bytes that identically match

@@ -159,77 +215,33 @@ take n0 = do

159-- /Note/: The behaviour of this parser is different to that of the

215-- /Note/: The behaviour of this parser is different to that of the

160-- similarly-named parser in Parsec, as this one is all-or-nothing.

216-- similarly-named parser in Parsec, as this one is all-or-nothing.

161-- To illustrate the difference, the following parser will fail under

217-- To illustrate the difference, the following parser will fail under

162−-- Parsec given an input of @\"for\"@:

218+-- Parsec given an input of @"for"@:

163--

219--

164-- >string "foo" <|> string "for"

220-- >string "foo" <|> string "for"

165--

221--

166−-- The reason for its failure is that the first branch is a

222+-- The reason for its failure is that that the first branch is a

167-- partial match, and will consume the letters @\'f\'@ and @\'o\'@

223-- partial match, and will consume the letters @\'f\'@ and @\'o\'@

168−-- before failing. In attoparsec, the above parser will /succeed/ on

224+-- before failing. In Attoparsec, the above parser will /succeed/ on

169-- that input, because the failed first branch will consume nothing.

225-- that input, because the failed first branch will consume nothing.

170−string :: ByteString -> Parser ByteString

226+string :: B.ByteString -> Parser B.ByteString

171−string s = string_ (stringSuspended id) id s

227+string s = takeWith (B.length s) (==s)

172{-# INLINE string #-}

228{-# INLINE string #-}

173

229

174−-- ASCII-specific but fast, oh yes.

230+stringTransform :: (B.ByteString -> B.ByteString) -> B.ByteString

175−toLower :: Word8 -> Word8

231+ -> Parser B.ByteString

176−toLower w | w >= 65 && w <= 90 = w + 32

232+stringTransform f s = takeWith (B.length s) ((==f s) . f)

177− | otherwise = w

233+{-# INLINE stringTransform #-}

178−

179−-- | Satisfy a literal string, ignoring case.

180−stringCI :: ByteString -> Parser ByteString

181−stringCI s = string_ (stringSuspended lower) lower s

182− where lower = B8.map toLower

183−{-# INLINE stringCI #-}

184−

185−string_ :: (forall r. ByteString -> ByteString -> Buffer -> Pos -> More

186− -> Failure r -> Success ByteString r -> Result r)

187− -> (ByteString -> ByteString)

188− -> ByteString -> Parser ByteString

189−string_ suspended f s0 = T.Parser $ \t pos more lose succ ->

190− let n = B.length s

191− s = f s0

192− in if lengthAtLeast pos n t

193− then let t' = substring pos (Pos n) t

194− in if s == f t'

195− then succ t (pos + Pos n) more t'

196− else lose t pos more [] "string"

197− else let t' = Buf.unsafeDrop (fromPos pos) t

198− in if f t' `B.isPrefixOf` s

199− then suspended s (B.drop (B.length t') s) t pos more lose succ

200− else lose t pos more [] "string"

201−{-# INLINE string_ #-}

202−

203−stringSuspended :: (ByteString -> ByteString)

204− -> ByteString -> ByteString -> Buffer -> Pos -> More

205− -> Failure r

206− -> Success ByteString r

207− -> Result r

208−stringSuspended f s0 s t pos more lose succ =

209− runParser (demandInput_ >>= go) t pos more lose succ

210− where go s'0 = T.Parser $ \t' pos' more' lose' succ' ->

211− let m = B.length s

212− s' = f s'0

213− n = B.length s'

214− in if n >= m

215− then if B.unsafeTake m s' == s

216− then let o = Pos (B.length s0)

217− in succ' t' (pos' + o) more'

218− (substring pos' o t')

219− else lose' t' pos' more' [] "string"

220− else if s' == B.unsafeTake n s

221− then stringSuspended f s0 (B.unsafeDrop n s)

222− t' pos' more' lose' succ'

223− else lose' t' pos' more' [] "string"

224

234

225-- | Skip past input for as long as the predicate returns 'True'.

235-- | Skip past input for as long as the predicate returns 'True'.

226skipWhile :: (Word8 -> Bool) -> Parser ()

236skipWhile :: (Word8 -> Bool) -> Parser ()

227skipWhile p = go

237skipWhile p = go

228 where

238 where

229 go = do

239 go = do

230− t <- B8.takeWhile p <$> get

240+ t <- B8.dropWhile p <$> get

231− continue <- inputSpansChunks (B.length t)

241+ put t

242+ when (B.null t) $ do

243+ input <- wantInput

232− when continue go

244+ when input go

233{-# INLINE skipWhile #-}

245{-# INLINE skipWhile #-}

234

246

235-- | Consume input as long as the predicate returns 'False'

247-- | Consume input as long as the predicate returns 'False'

@@ -239,10 +251,9 @@ skipWhile p = go

239-- predicate returns 'True' on the first byte of input.

251-- predicate returns 'True' on the first byte of input.

240--

252--

241-- /Note/: Because this parser does not fail, do not use it with

253-- /Note/: Because this parser does not fail, do not use it with

242−-- combinators such as 'Control.Applicative.many', because such

254+-- combinators such as 'many', because such parsers loop until a

243−-- parsers loop until a failure occurs. Careless use will thus result

255+-- failure occurs. Careless use will thus result in an infinite loop.

244−-- in an infinite loop.

245−takeTill :: (Word8 -> Bool) -> Parser ByteString

256+takeTill :: (Word8 -> Bool) -> Parser B.ByteString

246takeTill p = takeWhile (not . p)

257takeTill p = takeWhile (not . p)

247{-# INLINE takeTill #-}

258{-# INLINE takeTill #-}

248

259

@@ -253,30 +264,23 @@ takeTill p = takeWhile (not . p)

253-- predicate returns 'False' on the first byte of input.

264-- predicate returns 'False' on the first byte of input.

254--

265--

255-- /Note/: Because this parser does not fail, do not use it with

266-- /Note/: Because this parser does not fail, do not use it with

256−-- combinators such as 'Control.Applicative.many', because such

267+-- combinators such as 'many', because such parsers loop until a

257−-- parsers loop until a failure occurs. Careless use will thus result

268+-- failure occurs. Careless use will thus result in an infinite loop.

258−-- in an infinite loop.

259−takeWhile :: (Word8 -> Bool) -> Parser ByteString

269+takeWhile :: (Word8 -> Bool) -> Parser B.ByteString

260−takeWhile p = do

270+takeWhile p = (B.concat . reverse) `fmap` go []

261− s <- B8.takeWhile p <$> get

262− continue <- inputSpansChunks (B.length s)

263− if continue

264− then takeWhileAcc p [s]

265− else return s

266−{-# INLINE takeWhile #-}

267−

268−takeWhileAcc :: (Word8 -> Bool) -> [ByteString] -> Parser ByteString

269−takeWhileAcc p = go

270 where

271 where

271 go acc = do

272 go acc = do

272− s <- B8.takeWhile p <$> get

273+ (h,t) <- B8.span p <$> get

273− continue <- inputSpansChunks (B.length s)

274+ put t

274− if continue

275+ if B.null t

276+ then do

277+ input <- wantInput

278+ if input

275− then go (s:acc)

279+ then go (h:acc)

276− else return $ concatReverse (s:acc)

280+ else return (h:acc)

277−{-# INLINE takeWhileAcc #-}

281+ else return (h:acc)

278−

282+

279−takeRest :: Parser [ByteString]

283+takeRest :: Parser [B.ByteString]

280takeRest = go []

284takeRest = go []

281 where

285 where

282 go acc = do

286 go acc = do

@@ -284,12 +288,12 @@ takeRest = go []

284 if input

288 if input

285 then do

289 then do

286 s <- get

290 s <- get

287− advance (B.length s)

291+ put B.empty

288 go (s:acc)

292 go (s:acc)

289 else return (reverse acc)

293 else return (reverse acc)

290

294

291-- | Consume all remaining input and return it as a single string.

295-- | Consume all remaining input and return it as a single string.

292−takeByteString :: Parser ByteString

296+takeByteString :: Parser B.ByteString

293takeByteString = B.concat `fmap` takeRest

297takeByteString = B.concat `fmap` takeRest

294

298

295-- | Consume all remaining input and return it as a single string.

299-- | Consume all remaining input and return it as a single string.

@@ -298,9 +302,23 @@ takeLazyByteString = L.fromChunks `fmap` takeRest

298

302

299data T s = T {-# UNPACK #-} !Int s

303data T s = T {-# UNPACK #-} !Int s

300

304

301−scan_ :: (s -> [ByteString] -> Parser r) -> s -> (s -> Word8 -> Maybe s)

305+-- | A stateful scanner. The predicate consumes and transforms a

302− -> Parser r

306+-- state argument, and each transformed state is passed to successive

303−scan_ f s0 p = go [] s0

307+-- invocations of the predicate on each byte of the input until one

308+-- returns 'Nothing' or the input ends.

309+--

310+-- This parser does not fail. It will return an empty string if the

311+-- predicate returns 'Nothing' on the first byte of input.

312+--

313+-- /Note/: Because this parser does not fail, do not use it with

314+-- combinators such as 'many', because such parsers loop until a

315+-- failure occurs. Careless use will thus result in an infinite loop.

316+scan :: s -> (s -> Word8 -> Maybe s) -> Parser B.ByteString

317+scan s0 p = do

318+ chunks <- go [] s0

319+ case chunks of

320+ [x] -> return x

321+ xs -> return . B.concat . reverse $ xs

304 where

322 where

305 go acc s1 = do

323 go acc s1 = do

306 let scanner (B.PS fp off len) =

324 let scanner (B.PS fp off len) =

@@ -317,56 +335,34 @@ scan_ f s0 p = go [] s0

317 done !i !s = return (T i s)

335 done !i !s = return (T i s)

318 inner start s1

336 inner start s1

319 bs <- get

337 bs <- get

320− let T i s' = inlinePerformIO $ scanner bs

338+ let T i s' = unsafePerformIO $ scanner bs

321− !h = B.unsafeTake i bs

339+ h = B.unsafeTake i bs

322− continue <- inputSpansChunks i

340+ t = B.unsafeDrop i bs

323− if continue

341+ put t

342+ if B.null t

343+ then do

344+ input <- wantInput

345+ if input

324− then go (h:acc) s'

346+ then go (h:acc) s'

325− else f s' (h:acc)

347+ else return (h:acc)

326−{-# INLINE scan_ #-}

348+ else return (h:acc)

327−

328−-- | A stateful scanner. The predicate consumes and transforms a

329−-- state argument, and each transformed state is passed to successive

330−-- invocations of the predicate on each byte of the input until one

331−-- returns 'Nothing' or the input ends.

332−--

333−-- This parser does not fail. It will return an empty string if the

334−-- predicate returns 'Nothing' on the first byte of input.

335−--

336−-- /Note/: Because this parser does not fail, do not use it with

337−-- combinators such as 'Control.Applicative.many', because such

338−-- parsers loop until a failure occurs. Careless use will thus result

339−-- in an infinite loop.

340−scan :: s -> (s -> Word8 -> Maybe s) -> Parser ByteString

341−scan = scan_ $ \_ chunks -> return $! concatReverse chunks

342{-# INLINE scan #-}

349{-# INLINE scan #-}

343

350

344−-- | Like 'scan', but generalized to return the final state of the

345−-- scanner.

346−runScanner :: s -> (s -> Word8 -> Maybe s) -> Parser (ByteString, s)

347−runScanner = scan_ $ \s xs -> let !sx = concatReverse xs in return (sx, s)

348−{-# INLINE runScanner #-}

349−

350-- | Consume input as long as the predicate returns 'True', and return

351-- | Consume input as long as the predicate returns 'True', and return

351-- the consumed input.

352-- the consumed input.

352--

353--

353-- This parser requires the predicate to succeed on at least one byte

354-- This parser requires the predicate to succeed on at least one byte

354-- of input: it will fail if the predicate never returns 'True' or if

355-- of input: it will fail if the predicate never returns 'True' or if

355-- there is no input left.

356-- there is no input left.

356−takeWhile1 :: (Word8 -> Bool) -> Parser ByteString

357+takeWhile1 :: (Word8 -> Bool) -> Parser B.ByteString

357takeWhile1 p = do

358takeWhile1 p = do

358− (`when` demandInput) =<< endOfChunk

359+ (`when` demandInput) =<< B.null <$> get

359− s <- B8.takeWhile p <$> get

360+ (h,t) <- B8.span p <$> get

360− let len = B.length s

361− if len == 0

362− then fail "takeWhile1"

361+ when (B.null h) $ fail "takeWhile1"

363− else do

362+ put t

364− advance len

363+ if B.null t

365− eoc <- endOfChunk

364+ then (h<>) `fmap` takeWhile p

366− if eoc

367− then takeWhileAcc p [s]

368− else return s

365+ else return h

369−{-# INLINE takeWhile1 #-}

370

366

371-- | Match any byte in a set.

367-- | Match any byte in a set.

372--

368--

@@ -404,133 +400,60 @@ notWord8 :: Word8 -> Parser Word8

404notWord8 c = satisfy (/= c) <?> "not " ++ show c

400notWord8 c = satisfy (/= c) <?> "not " ++ show c

405{-# INLINE notWord8 #-}

401{-# INLINE notWord8 #-}

406

402

407−-- | Match any byte, to perform lookahead. Returns 'Nothing' if end of

403+-- | Match only if all input has been consumed.

408−-- input has been reached. Does not consume any input.

404+endOfInput :: Parser ()

409−--

405+endOfInput = T.Parser $ \i0 a0 m0 kf ks ->

410−-- /Note/: Because this parser does not fail, do not use it with

406+ if B.null (unI i0)

411−-- combinators such as 'Control.Applicative.many', because such

412−-- parsers loop until a failure occurs. Careless use will thus result

413−-- in an infinite loop.

414−peekWord8 :: Parser (Maybe Word8)

415−peekWord8 = T.Parser $ \t pos@(Pos pos_) more _lose succ ->

416− case () of

417− _| pos_ < Buf.length t ->

418− let !w = Buf.unsafeIndex t pos_

419− in succ t pos more (Just w)

420− | more == Complete ->

407+ then if m0 == Complete

421− succ t pos more Nothing

408+ then ks i0 a0 m0 ()

422− | otherwise ->

409+ else let kf' i1 a1 m1 _ _ = addS i0 a0 m0 i1 a1 m1 $

423− let succ' t' pos' more' = let !w = Buf.unsafeIndex t' pos_

410+ \ i2 a2 m2 -> ks i2 a2 m2 ()

424− in succ t' pos' more' (Just w)

411+ ks' i1 a1 m1 _ = addS i0 a0 m0 i1 a1 m1 $

425− lose' t' pos' more' = succ t' pos' more' Nothing

412+ \ i2 a2 m2 -> kf i2 a2 m2 []

426− in prompt t pos more lose' succ'

413+ "endOfInput"

427−{-# INLINE peekWord8 #-}

414+ in T.runParser demandInput i0 a0 m0 kf' ks'

428−

415+ else kf i0 a0 m0 [] "endOfInput"

429−-- | Match any byte, to perform lookahead. Does not consume any

416+

430−-- input, but will fail if end of input has been reached.

417+-- | Return an indication of whether the end of input has been

431−peekWord8' :: Parser Word8

418+-- reached.

432−peekWord8' = T.Parser $ \t pos more lose succ ->

419+atEnd :: Parser Bool

433− if lengthAtLeast pos 1 t

420+atEnd = not <$> wantInput

434− then succ t pos more (Buf.unsafeIndex t (fromPos pos))

435− else let succ' t' pos' more' bs' = succ t' pos' more' $! B.unsafeHead bs'

436− in ensureSuspended 1 t pos more lose succ'

437−{-# INLINE peekWord8' #-}

421+{-# INLINE atEnd #-}

438

422

439-- | Match either a single newline character @\'\\n\'@, or a carriage

423-- | Match either a single newline character @\'\\n\'@, or a carriage

440-- return followed by a newline character @\"\\r\\n\"@.

424-- return followed by a newline character @\"\\r\\n\"@.

441endOfLine :: Parser ()

425endOfLine :: Parser ()

442endOfLine = (word8 10 >> return ()) <|> (string "\r\n" >> return ())

426endOfLine = (word8 10 >> return ()) <|> (string "\r\n" >> return ())

443

427

428+--- | Name the parser, in case failure occurs.

429+(<?>) :: Parser a

430+ -> String -- ^ the name to use if parsing fails

431+ -> Parser a

432+p <?> msg0 = T.Parser $ \i0 a0 m0 kf ks ->

433+ let kf' i a m strs msg = kf i a m (msg0:strs) msg

434+ in T.runParser p i0 a0 m0 kf' ks

435+{-# INLINE (<?>) #-}

436+infix 0 <?>

437+

444-- | Terminal failure continuation.

438-- | Terminal failure continuation.

445failK :: Failure a

439failK :: Failure a

446−failK t (Pos pos) _more stack msg = Fail (Buf.unsafeDrop pos t) stack msg

440+failK i0 _a0 _m0 stack msg = Fail (unI i0) stack msg

447{-# INLINE failK #-}

441{-# INLINE failK #-}

448

442

449-- | Terminal success continuation.

443-- | Terminal success continuation.

450successK :: Success a a

444successK :: Success a a

451−successK t (Pos pos) _more a = Done (Buf.unsafeDrop pos t) a

445+successK i0 _a0 _m0 a = Done (unI i0) a

452{-# INLINE successK #-}

446{-# INLINE successK #-}

453

447

454-- | Run a parser.

448-- | Run a parser.

455−parse :: Parser a -> ByteString -> Result a

449+parse :: Parser a -> B.ByteString -> Result a

456−parse m s = T.runParser m (buffer s) (Pos 0) Incomplete failK successK

450+parse m s = T.runParser m (I s) (A B.empty) Incomplete failK successK

457{-# INLINE parse #-}

451{-# INLINE parse #-}

458

452

459-- | Run a parser that cannot be resupplied via a 'Partial' result.

453-- | Run a parser that cannot be resupplied via a 'Partial' result.

460−--

461−-- This function does not force a parser to consume all of its input.

462−-- Instead, any residual input will be discarded. To force a parser

463−-- to consume all of its input, use something like this:

464−--

465−-- @

466−--'parseOnly' (myParser 'Control.Applicative.<*' 'endOfInput')

467−-- @

468−parseOnly :: Parser a -> ByteString -> Either String a

454+parseOnly :: Parser a -> B.ByteString -> Either String a

469−parseOnly m s = case T.runParser m (buffer s) (Pos 0) Complete failK successK of

455+parseOnly m s = case T.runParser m (I s) (A B.empty) Complete failK successK of

470− Fail _ [] err -> Left err

471− Fail _ ctxs err -> Left (intercalate " > " ctxs ++ ": " ++ err)

456+ Fail _ _ err -> Left err

472− Done _ a -> Right a

457+ Done _ a -> Right a

473− _ -> error "parseOnly: impossible error!"

458+ _ -> error "parseOnly: impossible error!"

474{-# INLINE parseOnly #-}

459{-# INLINE parseOnly #-}

475−

476−get :: Parser ByteString

477−get = T.Parser $ \t pos more _lose succ ->

478− succ t pos more (Buf.unsafeDrop (fromPos pos) t)

479−{-# INLINE get #-}

480−

481−endOfChunk :: Parser Bool

482−endOfChunk = T.Parser $ \t pos more _lose succ ->

483− succ t pos more (fromPos pos == Buf.length t)

484−{-# INLINE endOfChunk #-}

485−

486−inputSpansChunks :: Int -> Parser Bool

487−inputSpansChunks i = T.Parser $ \t pos_ more _lose succ ->

488− let pos = pos_ + Pos i

489− in if fromPos pos < Buf.length t || more == Complete

490− then succ t pos more False

491− else let lose' t' pos' more' = succ t' pos' more' False

492− succ' t' pos' more' = succ t' pos' more' True

493− in prompt t pos more lose' succ'

494−{-# INLINE inputSpansChunks #-}

495−

496−advance :: Int -> Parser ()

497−advance n = T.Parser $ \t pos more _lose succ ->

498− succ t (pos + Pos n) more ()

499−{-# INLINE advance #-}

500−

501−ensureSuspended :: Int -> Buffer -> Pos -> More

502− -> Failure r

503− -> Success ByteString r

504− -> Result r

505−ensureSuspended n t pos more lose succ =

506− runParser (demandInput >> go) t pos more lose succ

507− where go = T.Parser $ \t' pos' more' lose' succ' ->

508− if lengthAtLeast pos' n t'

509− then succ' t' pos' more' (substring pos (Pos n) t')

510− else runParser (demandInput >> go) t' pos' more' lose' succ'

511−

512−-- | If at least @n@ elements of input are available, return the

513−-- current input, otherwise fail.

514−ensure :: Int -> Parser ByteString

515−ensure n = T.Parser $ \t pos more lose succ ->

516− if lengthAtLeast pos n t

517− then succ t pos more (substring pos (Pos n) t)

518− -- The uncommon case is kept out-of-line to reduce code size:

519− else ensureSuspended n t pos more lose succ

520−{-# INLINE ensure #-}

521−

522−-- | Return both the result of a parse and the portion of the input

523−-- that was consumed while it was being parsed.

524−match :: Parser a -> Parser (ByteString, a)

525−match p = T.Parser $ \t pos more lose succ ->

526− let succ' t' pos' more' a =

527− succ t' pos' more' (substring pos (pos'-pos) t', a)

528− in runParser p t pos more lose succ'

529−

530−lengthAtLeast :: Pos -> Int -> Buffer -> Bool

531−lengthAtLeast (Pos pos) n bs = Buf.length bs >= pos + n

532−{-# INLINE lengthAtLeast #-}

533−

534−substring :: Pos -> Pos -> Buffer -> ByteString

535−substring (Pos pos) (Pos n) = Buf.substring pos n

536−{-# INLINE substring #-}

Data/Attoparsec/ByteString/Lazy.hs+10−29

@@ -1,19 +1,14 @@

1−{-# LANGUAGE CPP #-}

2−#if __GLASGOW_HASKELL__ >= 702

3−{-# LANGUAGE Trustworthy #-} -- Imports internal modules

4−#endif

5−

6-- |

1-- |

7-- Module : Data.Attoparsec.ByteString.Lazy

2-- Module : Data.Attoparsec.ByteString.Lazy

8−-- Copyright : Bryan O'Sullivan 2007-2015

3+-- Copyright : Bryan O'Sullivan 2010, 2011

9-- License : BSD3

4-- License : BSD3

10−--

5+--

11-- Maintainer : bos@serpentine.com

6-- Maintainer : bos@serpentine.com

12-- Stability : experimental

7-- Stability : experimental

13-- Portability : unknown

8-- Portability : unknown

14--

9--

15−-- Simple, efficient combinator parsing that can consume lazy

10+-- Simple, efficient combinator parsing for lazy 'ByteString'

16−-- 'ByteString' strings, loosely based on the Parsec library.

11+-- strings, loosely based on the Parsec library.

17--

12--

18-- This is essentially the same code as in the 'Data.Attoparsec'

13-- This is essentially the same code as in the 'Data.Attoparsec'

19-- module, only with a 'parse' function that can consume a lazy

14-- module, only with a 'parse' function that can consume a lazy

@@ -21,11 +16,10 @@

21-- more input to be fed in. Think of this as suitable for use with a

16-- more input to be fed in. Think of this as suitable for use with a

22-- lazily read file, e.g. via 'L.readFile' or 'L.hGetContents'.

17-- lazily read file, e.g. via 'L.readFile' or 'L.hGetContents'.

23--

18--

24−-- /Note:/ The various parser functions and combinators such as

25−-- 'string' still expect /strict/ 'B.ByteString' parameters, and

26−-- return strict 'B.ByteString' results. Behind the scenes, strict

27−-- 'B.ByteString' values are still used internally to store parser

19+-- Behind the scenes, strict 'B.ByteString' values are still used

28−-- input and manipulate it efficiently.

20+-- internally to store parser input and manipulate it efficiently.

21+-- High-performance parsers such as 'string' still expect strict

22+-- 'B.ByteString' parameters.

29

23

30module Data.Attoparsec.ByteString.Lazy

24module Data.Attoparsec.ByteString.Lazy

31 (

25 (

@@ -39,9 +33,7 @@ module Data.Attoparsec.ByteString.Lazy

39 , eitherResult

33 , eitherResult

40 ) where

34 ) where

41

35

42−import Control.DeepSeq (NFData(rnf))

43import Data.ByteString.Lazy.Internal (ByteString(..), chunk)

36import Data.ByteString.Lazy.Internal (ByteString(..), chunk)

44−import Data.List (intercalate)

45import qualified Data.ByteString as B

37import qualified Data.ByteString as B

46import qualified Data.Attoparsec.ByteString as A

38import qualified Data.Attoparsec.ByteString as A

47import qualified Data.Attoparsec.Internal.Types as T

39import qualified Data.Attoparsec.Internal.Types as T

@@ -61,16 +53,6 @@ data Result r = Fail ByteString [String] String

61 -- input that had not yet been consumed (if any) when

53 -- input that had not yet been consumed (if any) when

62 -- the parse succeeded.

54 -- the parse succeeded.

63

55

64−instance NFData r => NFData (Result r) where

65− rnf (Fail bs ctxs msg) = rnfBS bs `seq` rnf ctxs `seq` rnf msg

66− rnf (Done bs r) = rnfBS bs `seq` rnf r

67− {-# INLINE rnf #-}

68−

69−rnfBS :: ByteString -> ()

70−rnfBS (Chunk _ xs) = rnfBS xs

71−rnfBS Empty = ()

72−{-# INLINE rnfBS #-}

73−

74instance Show r => Show (Result r) where

56instance Show r => Show (Result r) where

75 show (Fail bs stk msg) =

57 show (Fail bs stk msg) =

76 "Fail " ++ show bs ++ " " ++ show stk ++ " " ++ show msg

58 "Fail " ++ show bs ++ " " ++ show stk ++ " " ++ show msg

@@ -105,6 +87,5 @@ maybeResult _ = Nothing

105

87

106-- | Convert a 'Result' value to an 'Either' value.

88-- | Convert a 'Result' value to an 'Either' value.

107eitherResult :: Result r -> Either String r

89eitherResult :: Result r -> Either String r

108−eitherResult (Done _ r) = Right r

90+eitherResult (Done _ r) = Right r

109−eitherResult (Fail _ [] msg) = Left msg

91+eitherResult (Fail _ _ msg) = Left msg

110−eitherResult (Fail _ ctxs msg) = Left (intercalate " > " ctxs ++ ": " ++ msg)

Data/Attoparsec/Char8.hs+3−8

@@ -1,21 +1,16 @@

1-- |

2-- Module : Data.Attoparsec.Char8

3−-- Copyright : Bryan O'Sullivan 2007-2015

3+-- Copyright : Bryan O'Sullivan 2007-2011

4-- License : BSD3

5−--

5+--

6-- Maintainer : bos@serpentine.com

7-- Stability : experimental

8-- Portability : unknown

9--

10-- Simple, efficient, character-oriented combinator parsing for

11−-- 'Data.ByteString.ByteString' strings, loosely based on the Parsec

11+-- 'ByteString' strings, loosely based on the Parsec library.

12−-- library.

13−--

14−-- This module is deprecated. Use "Data.Attoparsec.ByteString.Char8"

15−-- instead.

16

12

17module Data.Attoparsec.Char8

13module Data.Attoparsec.Char8

18− {-# DEPRECATED "This module will be removed in the next major release." #-}

19 (

14 (

20 module Data.Attoparsec.ByteString.Char8

15 module Data.Attoparsec.ByteString.Char8

21 ) where

16 ) where

Data/Attoparsec/Combinator.hs+29−145

@@ -1,12 +1,9 @@

1{-# LANGUAGE BangPatterns, CPP #-}

2−#if __GLASGOW_HASKELL__ >= 702

3−{-# LANGUAGE Trustworthy #-} -- Imports internal modules

4−#endif

5-- |

2-- |

6-- Module : Data.Attoparsec.Combinator

3-- Module : Data.Attoparsec.Combinator

7−-- Copyright : Daan Leijen 1999-2001, Bryan O'Sullivan 2007-2015

4+-- Copyright : Daan Leijen 1999-2001, Bryan O'Sullivan 2009-2010

8-- License : BSD3

5-- License : BSD3

9−--

6+--

10-- Maintainer : bos@serpentine.com

7-- Maintainer : bos@serpentine.com

11-- Stability : experimental

8-- Stability : experimental

12-- Portability : portable

9-- Portability : portable

@@ -14,72 +11,37 @@

14-- Useful parser combinators, similar to those provided by Parsec.

11-- Useful parser combinators, similar to those provided by Parsec.

15module Data.Attoparsec.Combinator

12module Data.Attoparsec.Combinator

16 (

13 (

17− -- * Combinators

18− try

19− , (<?>)

20− , choice

14+ choice

21 , count

15 , count

22 , option

16 , option

23− , many'

24 , many1

17 , many1

25− , many1'

26 , manyTill

18 , manyTill

27− , manyTill'

28 , sepBy

19 , sepBy

29− , sepBy'

30 , sepBy1

20 , sepBy1

31− , sepBy1'

32 , skipMany

21 , skipMany

33 , skipMany1

22 , skipMany1

34 , eitherP

23 , eitherP

35− , feed

36− , satisfyElem

37− , endOfInput

38− , atEnd

39− , lookAhead

40 ) where

24 ) where

41

25

42−#if !MIN_VERSION_base(4,8,0)

43−import Control.Applicative (Applicative(..), (<$>))

44−import Data.Monoid (Monoid(mappend))

45−#endif

46−import Control.Applicative (Alternative(..), empty, liftA2, many, (<|>))

26+import Control.Applicative (Alternative(..), Applicative(..), empty, liftA2,

47−import Control.Monad (MonadPlus(..))

27+ (<|>), (*>), (<$>))

28+#if __GLASGOW_HASKELL__ >= 700

48−import Data.Attoparsec.Internal.Types (Parser(..), IResult(..))

29+import Data.Attoparsec.Internal.Types (Parser)

49−import Data.Attoparsec.Internal (endOfInput, atEnd, satisfyElem)

30+import qualified Data.Attoparsec.Zepto as Z

50import Data.ByteString (ByteString)

31import Data.ByteString (ByteString)

51import Data.Text (Text)

32import Data.Text (Text)

52−import qualified Data.Attoparsec.Zepto as Z

33+#endif

53−import Prelude hiding (succ)

54−

55−-- | Attempt a parse, and if it fails, rewind the input so that no

56−-- input appears to have been consumed.

57−--

58−-- This combinator is provided for compatibility with Parsec.

59−-- attoparsec parsers always backtrack on failure.

60−try :: Parser i a -> Parser i a

61−try p = p

62−{-# INLINE try #-}

63−

64−-- | Name the parser, in case failure occurs.

65−(<?>) :: Parser i a

66− -> String -- ^ the name to use if parsing fails

67− -> Parser i a

68−p <?> msg0 = Parser $ \t pos more lose succ ->

69− let lose' t' pos' more' strs msg = lose t' pos' more' (msg0:strs) msg

70− in runParser p t pos more lose' succ

71−{-# INLINE (<?>) #-}

72−infix 0 <?>

73

34

74-- | @choice ps@ tries to apply the actions in the list @ps@ in order,

35-- | @choice ps@ tries to apply the actions in the list @ps@ in order,

75-- until one of them succeeds. Returns the value of the succeeding

36-- until one of them succeeds. Returns the value of the succeeding

76-- action.

37-- action.

77choice :: Alternative f => [f a] -> f a

38choice :: Alternative f => [f a] -> f a

78choice = foldr (<|>) empty

39choice = foldr (<|>) empty

40+#if __GLASGOW_HASKELL__ >= 700

79−{-# SPECIALIZE choice :: [Parser ByteString a]

41+{-# SPECIALIZE choice :: [Parser ByteString a] -> Parser ByteString a #-}

80− -> Parser ByteString a #-}

81{-# SPECIALIZE choice :: [Parser Text a] -> Parser Text a #-}

42{-# SPECIALIZE choice :: [Parser Text a] -> Parser Text a #-}

82{-# SPECIALIZE choice :: [Z.Parser a] -> Z.Parser a #-}

43{-# SPECIALIZE choice :: [Z.Parser a] -> Z.Parser a #-}

44+#endif

83

45

84-- | @option x p@ tries to apply action @p@. If @p@ fails without

46-- | @option x p@ tries to apply action @p@. If @p@ fails without

85-- consuming input, it returns the value @x@, otherwise the value

47-- consuming input, it returns the value @x@, otherwise the value

@@ -88,29 +50,11 @@ choice = foldr (<|>) empty

88-- > priority = option 0 (digitToInt <$> digit)

50-- > priority = option 0 (digitToInt <$> digit)

89option :: Alternative f => a -> f a -> f a

51option :: Alternative f => a -> f a -> f a

90option x p = p <|> pure x

52option x p = p <|> pure x

53+#if __GLASGOW_HASKELL__ >= 700

91{-# SPECIALIZE option :: a -> Parser ByteString a -> Parser ByteString a #-}

54{-# SPECIALIZE option :: a -> Parser ByteString a -> Parser ByteString a #-}

92{-# SPECIALIZE option :: a -> Parser Text a -> Parser Text a #-}

55{-# SPECIALIZE option :: a -> Parser Text a -> Parser Text a #-}

93{-# SPECIALIZE option :: a -> Z.Parser a -> Z.Parser a #-}

56{-# SPECIALIZE option :: a -> Z.Parser a -> Z.Parser a #-}

94−

57+#endif

95−-- | A version of 'liftM2' that is strict in the result of its first

96−-- action.

97−liftM2' :: (Monad m) => (a -> b -> c) -> m a -> m b -> m c

98−liftM2' f a b = do

99− !x <- a

100− y <- b

101− return (f x y)

102−{-# INLINE liftM2' #-}

103−

104−-- | @many' p@ applies the action @p@ /zero/ or more times. Returns a

105−-- list of the returned values of @p@. The value returned by @p@ is

106−-- forced to WHNF.

107−--

108−-- > word = many' letter

109−many' :: (MonadPlus m) => m a -> m [a]

110−many' p = many_p

111− where many_p = some_p `mplus` return []

112− some_p = liftM2' (:) p many_p

113−{-# INLINE many' #-}

114

58

115-- | @many1 p@ applies the action @p@ /one/ or more times. Returns a

59-- | @many1 p@ applies the action @p@ /one/ or more times. Returns a

116-- list of the returned values of @p@.

60-- list of the returned values of @p@.

@@ -120,114 +64,69 @@ many1 :: Alternative f => f a -> f [a]

120many1 p = liftA2 (:) p (many p)

64many1 p = liftA2 (:) p (many p)

121{-# INLINE many1 #-}

65{-# INLINE many1 #-}

122

66

123−-- | @many1' p@ applies the action @p@ /one/ or more times. Returns a

124−-- list of the returned values of @p@. The value returned by @p@ is

125−-- forced to WHNF.

126−--

127−-- > word = many1' letter

128−many1' :: (MonadPlus m) => m a -> m [a]

129−many1' p = liftM2' (:) p (many' p)

130−{-# INLINE many1' #-}

131−

132-- | @sepBy p sep@ applies /zero/ or more occurrences of @p@, separated

67-- | @sepBy p sep@ applies /zero/ or more occurrences of @p@, separated

133-- by @sep@. Returns a list of the values returned by @p@.

68-- by @sep@. Returns a list of the values returned by @p@.

134--

69--

135−-- > commaSep p = p `sepBy` (char ',')

70+-- > commaSep p = p `sepBy` (symbol ",")

136sepBy :: Alternative f => f a -> f s -> f [a]

71sepBy :: Alternative f => f a -> f s -> f [a]

137sepBy p s = liftA2 (:) p ((s *> sepBy1 p s) <|> pure []) <|> pure []

72sepBy p s = liftA2 (:) p ((s *> sepBy1 p s) <|> pure []) <|> pure []

73+#if __GLASGOW_HASKELL__ >= 700

138{-# SPECIALIZE sepBy :: Parser ByteString a -> Parser ByteString s

74{-# SPECIALIZE sepBy :: Parser ByteString a -> Parser ByteString s

139 -> Parser ByteString [a] #-}

75 -> Parser ByteString [a] #-}

140{-# SPECIALIZE sepBy :: Parser Text a -> Parser Text s -> Parser Text [a] #-}

76{-# SPECIALIZE sepBy :: Parser Text a -> Parser Text s -> Parser Text [a] #-}

141{-# SPECIALIZE sepBy :: Z.Parser a -> Z.Parser s -> Z.Parser [a] #-}

77{-# SPECIALIZE sepBy :: Z.Parser a -> Z.Parser s -> Z.Parser [a] #-}

142−

78+#endif

143−-- | @sepBy' p sep@ applies /zero/ or more occurrences of @p@, separated

144−-- by @sep@. Returns a list of the values returned by @p@. The value

145−-- returned by @p@ is forced to WHNF.

146−--

147−-- > commaSep p = p `sepBy'` (char ',')

148−sepBy' :: (MonadPlus m) => m a -> m s -> m [a]

149−sepBy' p s = scan `mplus` return []

150− where scan = liftM2' (:) p ((s >> sepBy1' p s) `mplus` return [])

151−{-# SPECIALIZE sepBy' :: Parser ByteString a -> Parser ByteString s

152− -> Parser ByteString [a] #-}

153−{-# SPECIALIZE sepBy' :: Parser Text a -> Parser Text s -> Parser Text [a] #-}

154−{-# SPECIALIZE sepBy' :: Z.Parser a -> Z.Parser s -> Z.Parser [a] #-}

155

79

156-- | @sepBy1 p sep@ applies /one/ or more occurrences of @p@, separated

80-- | @sepBy1 p sep@ applies /one/ or more occurrences of @p@, separated

157-- by @sep@. Returns a list of the values returned by @p@.

81-- by @sep@. Returns a list of the values returned by @p@.

158--

82--

159−-- > commaSep p = p `sepBy1` (char ',')

83+-- > commaSep p = p `sepBy` (symbol ",")

160sepBy1 :: Alternative f => f a -> f s -> f [a]

84sepBy1 :: Alternative f => f a -> f s -> f [a]

161sepBy1 p s = scan

85sepBy1 p s = scan

162 where scan = liftA2 (:) p ((s *> scan) <|> pure [])

86 where scan = liftA2 (:) p ((s *> scan) <|> pure [])

87+#if __GLASGOW_HASKELL__ >= 700

163{-# SPECIALIZE sepBy1 :: Parser ByteString a -> Parser ByteString s

88{-# SPECIALIZE sepBy1 :: Parser ByteString a -> Parser ByteString s

164 -> Parser ByteString [a] #-}

89 -> Parser ByteString [a] #-}

165{-# SPECIALIZE sepBy1 :: Parser Text a -> Parser Text s -> Parser Text [a] #-}

90{-# SPECIALIZE sepBy1 :: Parser Text a -> Parser Text s -> Parser Text [a] #-}

166{-# SPECIALIZE sepBy1 :: Z.Parser a -> Z.Parser s -> Z.Parser [a] #-}

91{-# SPECIALIZE sepBy1 :: Z.Parser a -> Z.Parser s -> Z.Parser [a] #-}

167−

92+#endif

168−-- | @sepBy1' p sep@ applies /one/ or more occurrences of @p@, separated

169−-- by @sep@. Returns a list of the values returned by @p@. The value

170−-- returned by @p@ is forced to WHNF.

171−--

172−-- > commaSep p = p `sepBy1'` (char ',')

173−sepBy1' :: (MonadPlus m) => m a -> m s -> m [a]

174−sepBy1' p s = scan

175− where scan = liftM2' (:) p ((s >> scan) `mplus` return [])

176−{-# SPECIALIZE sepBy1' :: Parser ByteString a -> Parser ByteString s

177− -> Parser ByteString [a] #-}

178−{-# SPECIALIZE sepBy1' :: Parser Text a -> Parser Text s -> Parser Text [a] #-}

179−{-# SPECIALIZE sepBy1' :: Z.Parser a -> Z.Parser s -> Z.Parser [a] #-}

180

93

181-- | @manyTill p end@ applies action @p@ /zero/ or more times until

94-- | @manyTill p end@ applies action @p@ /zero/ or more times until

182-- action @end@ succeeds, and returns the list of values returned by

95-- action @end@ succeeds, and returns the list of values returned by

183-- @p@. This can be used to scan comments:

96-- @p@. This can be used to scan comments:

184--

97--

185−-- > simpleComment = string "")

98+-- > simpleComment = string ""))

186--

99--

187−-- (Note the overlapping parsers @anyChar@ and @string \"-->\"@.

100+-- Note the overlapping parsers @anyChar@ and @string \"<!--\"@, and

188−-- While this will work, it is not very efficient, as it will cause a

101+-- therefore the use of the 'try' combinator.

189−-- lot of backtracking.)

190manyTill :: Alternative f => f a -> f b -> f [a]

102manyTill :: Alternative f => f a -> f b -> f [a]

191manyTill p end = scan

103manyTill p end = scan

192 where scan = (end *> pure []) <|> liftA2 (:) p scan

104 where scan = (end *> pure []) <|> liftA2 (:) p scan

105+#if __GLASGOW_HASKELL__ >= 700

193{-# SPECIALIZE manyTill :: Parser ByteString a -> Parser ByteString b

106{-# SPECIALIZE manyTill :: Parser ByteString a -> Parser ByteString b

194 -> Parser ByteString [a] #-}

107 -> Parser ByteString [a] #-}

195{-# SPECIALIZE manyTill :: Parser Text a -> Parser Text b -> Parser Text [a] #-}

108{-# SPECIALIZE manyTill :: Parser Text a -> Parser Text b -> Parser Text [a] #-}

196{-# SPECIALIZE manyTill :: Z.Parser a -> Z.Parser b -> Z.Parser [a] #-}

109{-# SPECIALIZE manyTill :: Z.Parser a -> Z.Parser b -> Z.Parser [a] #-}

197−

110+#endif

198−-- | @manyTill' p end@ applies action @p@ /zero/ or more times until

199−-- action @end@ succeeds, and returns the list of values returned by

200−-- @p@. This can be used to scan comments:

201−--

202−-- > simpleComment = string "")

203−--

204−-- (Note the overlapping parsers @anyChar@ and @string \"-->\"@.

205−-- While this will work, it is not very efficient, as it will cause a

206−-- lot of backtracking.)

207−--

208−-- The value returned by @p@ is forced to WHNF.

209−manyTill' :: (MonadPlus m) => m a -> m b -> m [a]

210−manyTill' p end = scan

211− where scan = (end >> return []) `mplus` liftM2' (:) p scan

212−{-# SPECIALIZE manyTill' :: Parser ByteString a -> Parser ByteString b

213− -> Parser ByteString [a] #-}

214−{-# SPECIALIZE manyTill' :: Parser Text a -> Parser Text b -> Parser Text [a] #-}

215−{-# SPECIALIZE manyTill' :: Z.Parser a -> Z.Parser b -> Z.Parser [a] #-}

216

111

217-- | Skip zero or more instances of an action.

112-- | Skip zero or more instances of an action.

218skipMany :: Alternative f => f a -> f ()

113skipMany :: Alternative f => f a -> f ()

219skipMany p = scan

114skipMany p = scan

220 where scan = (p *> scan) <|> pure ()

115 where scan = (p *> scan) <|> pure ()

116+#if __GLASGOW_HASKELL__ >= 700

221{-# SPECIALIZE skipMany :: Parser ByteString a -> Parser ByteString () #-}

117{-# SPECIALIZE skipMany :: Parser ByteString a -> Parser ByteString () #-}

222{-# SPECIALIZE skipMany :: Parser Text a -> Parser Text () #-}

118{-# SPECIALIZE skipMany :: Parser Text a -> Parser Text () #-}

223{-# SPECIALIZE skipMany :: Z.Parser a -> Z.Parser () #-}

119{-# SPECIALIZE skipMany :: Z.Parser a -> Z.Parser () #-}

120+#endif

224

121

225-- | Skip one or more instances of an action.

122-- | Skip one or more instances of an action.

226skipMany1 :: Alternative f => f a -> f ()

123skipMany1 :: Alternative f => f a -> f ()

227skipMany1 p = p *> skipMany p

124skipMany1 p = p *> skipMany p

125+#if __GLASGOW_HASKELL__ >= 700

228{-# SPECIALIZE skipMany1 :: Parser ByteString a -> Parser ByteString () #-}

126{-# SPECIALIZE skipMany1 :: Parser ByteString a -> Parser ByteString () #-}

229{-# SPECIALIZE skipMany1 :: Parser Text a -> Parser Text () #-}

127{-# SPECIALIZE skipMany1 :: Parser Text a -> Parser Text () #-}

230{-# SPECIALIZE skipMany1 :: Z.Parser a -> Z.Parser () #-}

128{-# SPECIALIZE skipMany1 :: Z.Parser a -> Z.Parser () #-}

129+#endif

231

130

232-- | Apply the given action repeatedly, returning every result.

131-- | Apply the given action repeatedly, returning every result.

233count :: Monad m => Int -> m a -> m [a]

132count :: Monad m => Int -> m a -> m [a]

@@ -238,18 +137,3 @@ count n p = sequence (replicate n p)

238eitherP :: (Alternative f) => f a -> f b -> f (Either a b)

137eitherP :: (Alternative f) => f a -> f b -> f (Either a b)

239eitherP a b = (Left <$> a) <|> (Right <$> b)

138eitherP a b = (Left <$> a) <|> (Right <$> b)

240{-# INLINE eitherP #-}

139{-# INLINE eitherP #-}

241−

242−-- | If a parser has returned a 'T.Partial' result, supply it with more

243−-- input.

244−feed :: Monoid i => IResult i r -> i -> IResult i r

245−feed (Fail t ctxs msg) d = Fail (mappend t d) ctxs msg

246−feed (Partial k) d = k d

247−feed (Done t r) d = Done (mappend t d) r

248−{-# INLINE feed #-}

249−

250−-- | Apply a parser without consuming any input.

251−lookAhead :: Parser i a -> Parser i a

252−lookAhead p = Parser $ \t pos more lose succ ->

253− let succ' t' _pos' more' = succ t' pos more'

254− in runParser p t pos more lose succ'

255−{-# INLINE lookAhead #-}

Data/Attoparsec/Internal.hsdeleted−171

@@ -1,171 +0,0 @@

1−{-# LANGUAGE BangPatterns, CPP, ScopedTypeVariables #-}

2−-- |

3−-- Module : Data.Attoparsec.Internal

4−-- Copyright : Bryan O'Sullivan 2007-2015

5−-- License : BSD3

6−--

7−-- Maintainer : bos@serpentine.com

8−-- Stability : experimental

9−-- Portability : unknown

10−--

11−-- Simple, efficient parser combinators, loosely based on the Parsec

12−-- library.

13−

14−module Data.Attoparsec.Internal

15− ( compareResults

16− , prompt

17− , demandInput

18− , demandInput_

19− , wantInput

20− , endOfInput

21− , atEnd

22− , satisfyElem

23− , concatReverse

24− ) where

25−

26−#if !MIN_VERSION_base(4,8,0)

27−import Control.Applicative ((<$>))

28−import Data.Monoid (Monoid, mconcat)

29−#endif

30−import Data.Attoparsec.Internal.Types

31−import Data.ByteString (ByteString)

32−import Data.Text (Text)

33−import Prelude hiding (succ)

34−

35−-- | Compare two 'IResult' values for equality.

36−--

37−-- If both 'IResult's are 'Partial', the result will be 'Nothing', as

38−-- they are incomplete and hence their equality cannot be known.

39−-- (This is why there is no 'Eq' instance for 'IResult'.)

40−compareResults :: (Eq i, Eq r) => IResult i r -> IResult i r -> Maybe Bool

41−compareResults (Fail t0 ctxs0 msg0) (Fail t1 ctxs1 msg1) =

42− Just (t0 == t1 && ctxs0 == ctxs1 && msg0 == msg1)

43−compareResults (Done t0 r0) (Done t1 r1) =

44− Just (t0 == t1 && r0 == r1)

45−compareResults (Partial _) (Partial _) = Nothing

46−compareResults _ _ = Just False

47−

48−-- | Ask for input. If we receive any, pass the augmented input to a

49−-- success continuation, otherwise to a failure continuation.

50−prompt :: Chunk t

51− => State t -> Pos -> More

52− -> (State t -> Pos -> More -> IResult t r)

53− -> (State t -> Pos -> More -> IResult t r)

54− -> IResult t r

55−prompt t pos _more lose succ = Partial $ \s ->

56− if nullChunk s

57− then lose t pos Complete

58− else succ (pappendChunk t s) pos Incomplete

59−{-# SPECIALIZE prompt :: State ByteString -> Pos -> More

60− -> (State ByteString -> Pos -> More

61− -> IResult ByteString r)

62− -> (State ByteString -> Pos -> More

63− -> IResult ByteString r)

64− -> IResult ByteString r #-}

65−{-# SPECIALIZE prompt :: State Text -> Pos -> More

66− -> (State Text -> Pos -> More -> IResult Text r)

67− -> (State Text -> Pos -> More -> IResult Text r)

68− -> IResult Text r #-}

69−

70−-- | Immediately demand more input via a 'Partial' continuation

71−-- result.

72−demandInput :: Chunk t => Parser t ()

73−demandInput = Parser $ \t pos more lose succ ->

74− case more of

75− Complete -> lose t pos more [] "not enough input"

76− _ -> let lose' _ pos' more' = lose t pos' more' [] "not enough input"

77− succ' t' pos' more' = succ t' pos' more' ()

78− in prompt t pos more lose' succ'

79−{-# SPECIALIZE demandInput :: Parser ByteString () #-}

80−{-# SPECIALIZE demandInput :: Parser Text () #-}

81−

82−-- | Immediately demand more input via a 'Partial' continuation

83−-- result. Return the new input.

84−demandInput_ :: Chunk t => Parser t t

85−demandInput_ = Parser $ \t pos more lose succ ->

86− case more of

87− Complete -> lose t pos more [] "not enough input"

88− _ -> Partial $ \s ->

89− if nullChunk s

90− then lose t pos Complete [] "not enough input"

91− else succ (pappendChunk t s) pos more s

92−{-# SPECIALIZE demandInput_ :: Parser ByteString ByteString #-}

93−{-# SPECIALIZE demandInput_ :: Parser Text Text #-}

94−

95−-- | This parser always succeeds. It returns 'True' if any input is

96−-- available either immediately or on demand, and 'False' if the end

97−-- of all input has been reached.

98−wantInput :: forall t . Chunk t => Parser t Bool

99−wantInput = Parser $ \t pos more _lose succ ->

100− case () of

101− _ | pos < atBufferEnd (undefined :: t) t -> succ t pos more True

102− | more == Complete -> succ t pos more False

103− | otherwise -> let lose' t' pos' more' = succ t' pos' more' False

104− succ' t' pos' more' = succ t' pos' more' True

105− in prompt t pos more lose' succ'

106−{-# INLINE wantInput #-}

107−

108−-- | Match only if all input has been consumed.

109−endOfInput :: forall t . Chunk t => Parser t ()

110−endOfInput = Parser $ \t pos more lose succ ->

111− case () of

112− _| pos < atBufferEnd (undefined :: t) t -> lose t pos more [] "endOfInput"

113− | more == Complete -> succ t pos more ()

114− | otherwise ->

115− let lose' t' pos' more' _ctx _msg = succ t' pos' more' ()

116− succ' t' pos' more' _a = lose t' pos' more' [] "endOfInput"

117− in runParser demandInput t pos more lose' succ'

118−{-# SPECIALIZE endOfInput :: Parser ByteString () #-}

119−{-# SPECIALIZE endOfInput :: Parser Text () #-}

120−

121−-- | Return an indication of whether the end of input has been

122−-- reached.

123−atEnd :: Chunk t => Parser t Bool

124−atEnd = not <$> wantInput

125−{-# INLINE atEnd #-}

126−

127−satisfySuspended :: forall t r . Chunk t

128− => (ChunkElem t -> Bool)

129− -> State t -> Pos -> More

130− -> Failure t (State t) r

131− -> Success t (State t) (ChunkElem t) r

132− -> IResult t r

133−satisfySuspended p t pos more lose succ =

134− runParser (demandInput >> go) t pos more lose succ

135− where go = Parser $ \t' pos' more' lose' succ' ->

136− case bufferElemAt (undefined :: t) pos' t' of

137− Just (e, l) | p e -> succ' t' (pos' + Pos l) more' e

138− | otherwise -> lose' t' pos' more' [] "satisfyElem"

139− Nothing -> runParser (demandInput >> go) t' pos' more' lose' succ'

140−{-# SPECIALIZE satisfySuspended :: (ChunkElem ByteString -> Bool)

141− -> State ByteString -> Pos -> More

142− -> Failure ByteString (State ByteString) r

143− -> Success ByteString (State ByteString)

144− (ChunkElem ByteString) r

145− -> IResult ByteString r #-}

146−{-# SPECIALIZE satisfySuspended :: (ChunkElem Text -> Bool)

147− -> State Text -> Pos -> More

148− -> Failure Text (State Text) r

149− -> Success Text (State Text)

150− (ChunkElem Text) r

151− -> IResult Text r #-}

152−

153−-- | The parser @satisfyElem p@ succeeds for any chunk element for which the

154−-- predicate @p@ returns 'True'. Returns the element that is

155−-- actually parsed.

156−satisfyElem :: forall t . Chunk t

157− => (ChunkElem t -> Bool) -> Parser t (ChunkElem t)

158−satisfyElem p = Parser $ \t pos more lose succ ->

159− case bufferElemAt (undefined :: t) pos t of

160− Just (e, l) | p e -> succ t (pos + Pos l) more e

161− | otherwise -> lose t pos more [] "satisfyElem"

162− Nothing -> satisfySuspended p t pos more lose succ

163−{-# INLINE satisfyElem #-}

164−

165−-- | Concatenate a monoid after reversing its elements. Used to

166−-- glue together a series of textual chunks that have been accumulated

167−-- \"backwards\".

168−concatReverse :: Monoid m => [m] -> m

169−concatReverse [x] = x

170−concatReverse xs = mconcat (reverse xs)

171−{-# INLINE concatReverse #-}

Data/Attoparsec/Internal/Fhthagn.hsdeleted−18

@@ -1,18 +0,0 @@

1−{-# LANGUAGE BangPatterns, Rank2Types, OverloadedStrings,

2− RecordWildCards, MagicHash, UnboxedTuples #-}

3−

4−module Data.Attoparsec.Internal.Fhthagn

5− (

6− inlinePerformIO

7− ) where

8−

9−import GHC.Base (realWorld#)

10−import GHC.IO (IO(IO))

11−

12−-- | Just like unsafePerformIO, but we inline it. Big performance gains as

13−-- it exposes lots of things to further inlining. /Very unsafe/. In

14−-- particular, you should do no memory allocation inside an

15−-- 'inlinePerformIO' block. On Hugs this is just @unsafePerformIO@.

16−inlinePerformIO :: IO a -> a

17−inlinePerformIO (IO m) = case m realWorld# of (# _, r #) -> r

18−{-# INLINE inlinePerformIO #-}

Data/Attoparsec/Internal/Types.hs+133−182

@@ -1,96 +1,80 @@

1−{-# LANGUAGE CPP, BangPatterns, GeneralizedNewtypeDeriving, OverloadedStrings,

2− Rank2Types, RecordWildCards, TypeFamilies #-}

1+{-# LANGUAGE BangPatterns, Rank2Types, OverloadedStrings, RecordWildCards #-}

3-- |

2-- |

4-- Module : Data.Attoparsec.Internal.Types

3-- Module : Data.Attoparsec.Internal.Types

5−-- Copyright : Bryan O'Sullivan 2007-2015

4+-- Copyright : Bryan O'Sullivan 2007-2011

6-- License : BSD3

5-- License : BSD3

7--

6--

8-- Maintainer : bos@serpentine.com

7-- Maintainer : bos@serpentine.com

9-- Stability : experimental

8-- Stability : experimental

10-- Portability : unknown

9-- Portability : unknown

11--

10--

12−-- Simple, efficient parser combinators, loosely based on the Parsec

11+-- Simple, efficient parser combinators for strings, loosely based on

13−-- library.

12+-- the Parsec library.

14

13

15module Data.Attoparsec.Internal.Types

14module Data.Attoparsec.Internal.Types

16 (

15 (

17 Parser(..)

16 Parser(..)

18− , State

19 , Failure

17 , Failure

20 , Success

18 , Success

21− , Pos(..)

22 , IResult(..)

19 , IResult(..)

20+ , Input(..)

21+ , Added(..)

23 , More(..)

22 , More(..)

23+ , addS

24+ , noAdds

24 , (<>)

25 , (<>)

25− , Chunk(..)

26 ) where

27

28−import Control.Applicative as App (Applicative(..), (<$>))

28+import Control.Applicative (Alternative(..), Applicative(..), (<$>))

29−import Control.Applicative (Alternative(..))

30import Control.DeepSeq (NFData(rnf))

29import Control.DeepSeq (NFData(rnf))

31import Control.Monad (MonadPlus(..))

30import Control.Monad (MonadPlus(..))

32−import qualified Control.Monad.Fail as Fail (MonadFail(..))

33−import Data.Monoid as Mon (Monoid(..))

31+import Data.Monoid (Monoid(..))

34−import Data.Semigroup (Semigroup(..))

35−import Data.Word (Word8)

36−import Data.ByteString (ByteString)

37−import qualified Data.ByteString as BS

38−import Data.ByteString.Internal (w2c)

39−import Data.Text (Text)

40−import qualified Data.Text as Text

41−import Data.Text.Unsafe (Iter(..))

42−import Prelude hiding (succ)

32+import Prelude hiding (getChar, take, takeWhile)

43−import qualified Data.Attoparsec.ByteString.Buffer as B

44−import qualified Data.Attoparsec.Text.Buffer as T

45

33

46−newtype Pos = Pos { fromPos :: Int }

47− deriving (Eq, Ord, Show, Num)

48−

49−-- | The result of a parse. This is parameterised over the type @i@

34+-- | The result of a parse.

50−-- of string that was processed.

51--

35--

52-- This type is an instance of 'Functor', where 'fmap' transforms the

36-- This type is an instance of 'Functor', where 'fmap' transforms the

53-- value in a 'Done' result.

37-- value in a 'Done' result.

54−data IResult i r =

55− Fail i [String] String

38+data IResult t r = Fail t [String] String

56− -- ^ The parse failed. The @i@ parameter is the input that had

39+ -- ^ The parse failed. The 't' is the input that had

57− -- not yet been consumed when the failure occurred. The

40+ -- not yet been consumed when the failure occurred.

58− -- @[@'String'@]@ is a list of contexts in which the error

41+ -- The @[@'String'@]@ is a list of contexts in which

59− -- occurred. The 'String' is the message describing the error, if

42+ -- the error occurred. The 'String' is the message

60− -- any.

43+ -- describing the error, if any.

61− | Partial (i -> IResult i r)

44+ | Partial (t -> IResult t r)

62− -- ^ Supply this continuation with more input so that the parser

45+ -- ^ Supply this continuation with more input so that

63− -- can resume. To indicate that no more input is available, pass

46+ -- the parser can resume. To indicate that no more

64− -- an empty string to the continuation.

47+ -- input is available, use an empty string.

65− --

66− -- __Note__: if you get a 'Partial' result, do not call its

67− -- continuation more than once.

68− | Done i r

48+ | Done t r

69− -- ^ The parse succeeded. The @i@ parameter is the input that had

49+ -- ^ The parse succeeded. The 't' is the input that

70− -- not yet been consumed (if any) when the parse succeeded.

50+ -- had not yet been consumed (if any) when the parse

71−

51+ -- succeeded.

52+

72−instance (Show i, Show r) => Show (IResult i r) where

53+instance (Show t, Show r) => Show (IResult t r) where

73− showsPrec d ir = showParen (d > 10) $

54+ show (Fail t stk msg) =

74− case ir of

55+ "Fail " ++ show t ++ " " ++ show stk ++ " " ++ show msg

75− (Fail t stk msg) -> showString "Fail" . f t . f stk . f msg

76− (Partial _) -> showString "Partial _"

56+ show (Partial _) = "Partial _"

77− (Done t r) -> showString "Done" . f t . f r

57+ show (Done t r) = "Done " ++ show t ++ " " ++ show r

78− where f :: Show a => a -> ShowS

58+

79− f x = showChar ' ' . showsPrec 11 x

80−

81−instance (NFData i, NFData r) => NFData (IResult i r) where

59+instance (NFData t, NFData r) => NFData (IResult t r) where

82− rnf (Fail t stk msg) = rnf t `seq` rnf stk `seq` rnf msg

60+ rnf (Fail t _ _) = rnf t

83 rnf (Partial _) = ()

61 rnf (Partial _) = ()

84 rnf (Done t r) = rnf t `seq` rnf r

62 rnf (Done t r) = rnf t `seq` rnf r

85 {-# INLINE rnf #-}

63 {-# INLINE rnf #-}

86

64

87−instance Functor (IResult i) where

65+fmapR :: (a -> b) -> IResult t a -> IResult t b

88− fmap _ (Fail t stk msg) = Fail t stk msg

66+fmapR _ (Fail t stk msg) = Fail t stk msg

89− fmap f (Partial k) = Partial (fmap f . k)

67+fmapR f (Partial k) = Partial (fmapR f . k)

90− fmap f (Done t r) = Done t (f r)

68+fmapR f (Done t r) = Done t (f r)

91

69

92−-- | The core parser type. This is parameterised over the type @i@

70+instance Functor (IResult t) where

93−-- of string being processed.

71+ fmap = fmapR

72+ {-# INLINE fmap #-}

73+

74+newtype Input t = I {unI :: t}

75+newtype Added t = A {unA :: t}

76+

77+-- | The 'Parser' type.

94--

78--

95-- This type is an instance of the following classes:

79-- This type is an instance of the following classes:

96--

80--

@@ -101,117 +85,120 @@ instance Functor (IResult i) where

101--

85--

102-- * 'MonadPlus', where 'mzero' fails (with no error message) and

86-- * 'MonadPlus', where 'mzero' fails (with no error message) and

103-- 'mplus' executes the right-hand parser if the left-hand one

87-- 'mplus' executes the right-hand parser if the left-hand one

104−-- fails. When the parser on the right executes, the input is reset

88+-- fails.

105−-- to the same state as the parser on the left started with. (In

106−-- other words, attoparsec is a backtracking parser that supports

107−-- arbitrary lookahead.)

108--

89--

109-- * 'Alternative', which follows 'MonadPlus'.

90-- * 'Alternative', which follows 'MonadPlus'.

110−newtype Parser i a = Parser {

91+newtype Parser t a = Parser {

111− runParser :: forall r.

92+ runParser :: forall r. Input t -> Added t -> More

112− State i -> Pos -> More

113− -> Failure i (State i) r

93+ -> Failure t r

114− -> Success i (State i) a r

94+ -> Success t a r

115− -> IResult i r

95+ -> IResult t r

116 }

96 }

117

97

118−type family State i

119−type instance State ByteString = B.Buffer

120−type instance State Text = T.Buffer

121−

122−type Failure i t r = t -> Pos -> More -> [String] -> String

98+type Failure t r = Input t -> Added t -> More -> [String] -> String

123− -> IResult i r

99+ -> IResult t r

124−type Success i t a r = t -> Pos -> More -> a -> IResult i r

100+type Success t a r = Input t -> Added t -> More -> a -> IResult t r

125

101

126-- | Have we read all available input?

102-- | Have we read all available input?

127data More = Complete | Incomplete

103data More = Complete | Incomplete

128 deriving (Eq, Show)

104 deriving (Eq, Show)

129

105

130−instance Semigroup More where

106+addS :: (Monoid t) =>

107+ Input t -> Added t -> More

108+ -> Input t -> Added t -> More

109+ -> (Input t -> Added t -> More -> r) -> r

110+addS i0 a0 m0 _i1 a1 m1 f =

111+ let !i = I (unI i0 <> unA a1)

112+ a = A (unA a0 <> unA a1)

113+ !m = m0 <?> m1

114+ in f i a m

115+ where

131− c@Complete <> _ = c

116+ Complete <?> _ = Complete

132− _ <> m = m

117+ _ <?> Complete = Complete

133−

118+ _ <?> _ = Incomplete

134−instance Mon.Monoid More where

119+{-# INLINE addS #-}

135− mappend = (<>)

120+

136− mempty = Incomplete

121+bindP :: Parser t a -> (a -> Parser t b) -> Parser t b

137−

122+bindP m g =

138−instance Monad (Parser i) where

123+ Parser $ \i0 a0 m0 kf ks -> runParser m i0 a0 m0 kf $

139−#if !(MIN_VERSION_base(4,13,0))

124+ \i1 a1 m1 a -> runParser (g a) i1 a1 m1 kf ks

140− fail = Fail.fail

125+{-# INLINE bindP #-}

126+

127+returnP :: a -> Parser t a

128+returnP a = Parser (\i0 a0 m0 _kf ks -> ks i0 a0 m0 a)

129+{-# INLINE returnP #-}

130+

131+instance Monad (Parser t) where

132+ return = returnP

133+ (>>=) = bindP

134+ fail = failDesc

135+

136+noAdds :: (Monoid t) =>

137+ Input t -> Added t -> More

138+ -> (Input t -> Added t -> More -> r) -> r

139+noAdds i0 _a0 m0 f = f i0 (A mempty) m0

141− {-# INLINE fail #-}

140+{-# INLINE noAdds #-}

142−#endif

141+

143−

142+plus :: (Monoid t) => Parser t a -> Parser t a -> Parser t a

144− return = App.pure

143+plus a b = Parser $ \i0 a0 m0 kf ks ->

145− {-# INLINE return #-}

144+ let kf' i1 a1 m1 _ _ = addS i0 a0 m0 i1 a1 m1 $

146−

145+ \ i2 a2 m2 -> runParser b i2 a2 m2 kf ks

147− m >>= k = Parser $ \t !pos more lose succ ->

146+ in noAdds i0 a0 m0 $ \i2 a2 m2 -> runParser a i2 a2 m2 kf' ks

148− let succ' t' !pos' more' a = runParser (k a) t' pos' more' lose succ

147+{-# INLINE plus #-}

149− in runParser m t pos more lose succ'

148+

150− {-# INLINE (>>=) #-}

151−

152− (>>) = (*>)

153− {-# INLINE (>>) #-}

154−

155−

156−instance Fail.MonadFail (Parser i) where

157− fail err = Parser $ \t pos more lose _succ -> lose t pos more [] msg

158− where msg = "Failed reading: " ++ err

159− {-# INLINE fail #-}

160−

161−plus :: Parser i a -> Parser i a -> Parser i a

162−plus f g = Parser $ \t pos more lose succ ->

163− let lose' t' _pos' more' _ctx _msg = runParser g t' pos more' lose succ

164− in runParser f t pos more lose' succ

165−

166−instance MonadPlus (Parser i) where

149+instance (Monoid t) => MonadPlus (Parser t) where

167− mzero = fail "mzero"

150+ mzero = failDesc "mzero"

168 {-# INLINE mzero #-}

151 {-# INLINE mzero #-}

169 mplus = plus

152 mplus = plus

170

153

154+fmapP :: (a -> b) -> Parser t a -> Parser t b

155+fmapP p m = Parser $ \i0 a0 m0 f k ->

156+ runParser m i0 a0 m0 f $ \i1 a1 s1 a -> k i1 a1 s1 (p a)

157+{-# INLINE fmapP #-}

158+

171−instance Functor (Parser i) where

159+instance Functor (Parser t) where

172− fmap f p = Parser $ \t pos more lose succ ->

160+ fmap = fmapP

173− let succ' t' pos' more' a = succ t' pos' more' (f a)

174− in runParser p t pos more lose succ'

175 {-# INLINE fmap #-}

161 {-# INLINE fmap #-}

176

162

177−apP :: Parser i (a -> b) -> Parser i a -> Parser i b

163+apP :: Parser t (a -> b) -> Parser t a -> Parser t b

178apP d e = do

164apP d e = do

179 b <- d

165 b <- d

180 a <- e

166 a <- e

181 return (b a)

167 return (b a)

182{-# INLINE apP #-}

168{-# INLINE apP #-}

183

169

184−instance Applicative (Parser i) where

170+instance Applicative (Parser t) where

185− pure v = Parser $ \t !pos more _lose succ -> succ t pos more v

171+ pure = returnP

186 {-# INLINE pure #-}

172 {-# INLINE pure #-}

187 (<*>) = apP

173 (<*>) = apP

188 {-# INLINE (<*>) #-}

174 {-# INLINE (<*>) #-}

189− m *> k = m >>= \_ -> k

175+

176+#if MIN_VERSION_base(4,2,0)

177+ -- These definitions are equal to the defaults, but this

178+ -- way the optimizer doesn't have to work so hard to figure

179+ -- that out.

180+ (*>) = (>>)

190 {-# INLINE (*>) #-}

181 {-# INLINE (*>) #-}

191− x <* y = x >>= \a -> y >> pure a

182+ x <* y = x >>= \a -> y >> return a

192 {-# INLINE (<*) #-}

183 {-# INLINE (<*) #-}

184+#endif

193

185

194−instance Semigroup (Parser i a) where

195− (<>) = plus

196− {-# INLINE (<>) #-}

197−

198−instance Monoid (Parser i a) where

186+instance (Monoid t) => Monoid (Parser t a) where

199− mempty = fail "mempty"

187+ mempty = failDesc "mempty"

200 {-# INLINE mempty #-}

188 {-# INLINE mempty #-}

201− mappend = (<>)

189+ mappend = plus

202 {-# INLINE mappend #-}

190 {-# INLINE mappend #-}

203

191

204−instance Alternative (Parser i) where

192+instance (Monoid t) => Alternative (Parser t) where

205− empty = fail "empty"

193+ empty = failDesc "empty"

206 {-# INLINE empty #-}

194 {-# INLINE empty #-}

207

195

208 (<|>) = plus

196 (<|>) = plus

209 {-# INLINE (<|>) #-}

197 {-# INLINE (<|>) #-}

210

198

211 many v = many_v

199 many v = many_v

212− where

213− many_v = some_v <|> pure []

200+ where many_v = some_v <|> pure []

214− some_v = (:) <$> v <*> many_v

201+ some_v = (:) <$> v <*> many_v

215 {-# INLINE many #-}

202 {-# INLINE many #-}

216

203

217 some v = some_v

204 some v = some_v

@@ -220,47 +207,11 @@ instance Alternative (Parser i) where

220 some_v = (:) <$> v <*> many_v

207 some_v = (:) <$> v <*> many_v

221 {-# INLINE some #-}

208 {-# INLINE some #-}

222

209

223−-- | A common interface for input chunks.

210+failDesc :: String -> Parser t a

224−class Monoid c => Chunk c where

211+failDesc err = Parser (\i0 a0 m0 kf _ks -> kf i0 a0 m0 [] msg)

225− type ChunkElem c

212+ where msg = "Failed reading: " ++ err

226− -- | Test if the chunk is empty.

213+{-# INLINE failDesc #-}

227− nullChunk :: c -> Bool

228− -- | Append chunk to a buffer.

229− pappendChunk :: State c -> c -> State c

230− -- | Position at the end of a buffer. The first argument is ignored.

231− atBufferEnd :: c -> State c -> Pos

232− -- | Return the buffer element at the given position along with its length.

233− bufferElemAt :: c -> Pos -> State c -> Maybe (ChunkElem c, Int)

234− -- | Map an element to the corresponding character.

235− -- The first argument is ignored.

236− chunkElemToChar :: c -> ChunkElem c -> Char

237−

238−instance Chunk ByteString where

239− type ChunkElem ByteString = Word8

240− nullChunk = BS.null

241− {-# INLINE nullChunk #-}

242− pappendChunk = B.pappend

243− {-# INLINE pappendChunk #-}

244− atBufferEnd _ = Pos . B.length

245− {-# INLINE atBufferEnd #-}

246− bufferElemAt _ (Pos i) buf

247− | i < B.length buf = Just (B.unsafeIndex buf i, 1)

248− | otherwise = Nothing

249− {-# INLINE bufferElemAt #-}

250− chunkElemToChar _ = w2c

251− {-# INLINE chunkElemToChar #-}

252

214

253−instance Chunk Text where

215+(<>) :: (Monoid m) => m -> m -> m

254− type ChunkElem Text = Char

216+(<>) = mappend

255− nullChunk = Text.null

256− {-# INLINE nullChunk #-}

257− pappendChunk = T.pappend

258− {-# INLINE pappendChunk #-}

259− atBufferEnd _ = Pos . T.length

260− {-# INLINE atBufferEnd #-}

261− bufferElemAt _ (Pos i) buf

262− | i < T.length buf = let Iter c l = T.iter buf i in Just (c, l)

263− | otherwise = Nothing

264− {-# INLINE bufferElemAt #-}

265− chunkElemToChar _ = id

266− {-# INLINE chunkElemToChar #-}

217+{-# INLINE (<>) #-}

Data/Attoparsec/Lazy.hs+2−2

@@ -1,8 +1,8 @@

1-- |

2-- Module : Data.Attoparsec.Lazy

3−-- Copyright : Bryan O'Sullivan 2007-2015

3+-- Copyright : Bryan O'Sullivan 2010

4-- License : BSD3

5−--

5+--

6-- Maintainer : bos@serpentine.com

7-- Stability : experimental

8-- Portability : unknown

Data/Attoparsec/Number.hs+1−11

@@ -1,22 +1,16 @@

1{-# LANGUAGE DeriveDataTypeable #-}

2-- |

3-- Module : Data.Attoparsec.Number

4−-- Copyright : Bryan O'Sullivan 2007-2015

4+-- Copyright : Bryan O'Sullivan 2011

5-- License : BSD3

6--

7-- Maintainer : bos@serpentine.com

8-- Stability : experimental

9-- Portability : unknown

10--

11−-- This module is deprecated, and both the module and 'Number' type

12−-- will be removed in the next major release. Use the

13−-- <http://hackage.haskell.org/package/scientific scientific> package

14−-- and the 'Data.Scientific.Scientific' type instead.

15−--

16-- A simple number type, useful for parsing both exact and inexact

11-- A simple number type, useful for parsing both exact and inexact

17-- quantities without losing much precision.

12-- quantities without losing much precision.

18module Data.Attoparsec.Number

13module Data.Attoparsec.Number

19− {-# DEPRECATED "This module will be removed in the next major release." #-}

20 (

14 (

21 Number(..)

15 Number(..)

22 ) where

16 ) where

@@ -28,13 +22,9 @@ import Data.Typeable (Typeable)

28

22

29-- | A numeric type that can represent integers accurately, and

23-- | A numeric type that can represent integers accurately, and

30-- floating point numbers to the precision of a 'Double'.

24-- floating point numbers to the precision of a 'Double'.

31−--

32−-- /Note/: this type is deprecated, and will be removed in the next

33−-- major release. Use the 'Data.Scientific.Scientific' type instead.

34data Number = I !Integer

25data Number = I !Integer

35 | D {-# UNPACK #-} !Double

26 | D {-# UNPACK #-} !Double

36 deriving (Typeable, Data)

27 deriving (Typeable, Data)

37−{-# DEPRECATED Number "Use Scientific instead." #-}

38

28

39instance Show Number where

29instance Show Number where

40 show (I a) = show a

30 show (I a) = show a

Data/Attoparsec/Text.hs+105−200

@@ -1,14 +1,9 @@

1−{-# LANGUAGE BangPatterns, CPP, FlexibleInstances, TypeSynonymInstances #-}

1+{-# LANGUAGE BangPatterns #-}

2−#if __GLASGOW_HASKELL__ >= 702

3−{-# LANGUAGE Trustworthy #-} -- Imports internal modules

4−#endif

5−{-# OPTIONS_GHC -fno-warn-warnings-deprecations #-}

6−

7-- |

2-- |

8-- Module : Data.Attoparsec.Text

3-- Module : Data.Attoparsec.Text

9−-- Copyright : Bryan O'Sullivan 2007-2015

4+-- Copyright : Bryan O'Sullivan 2011

10-- License : BSD3

5-- License : BSD3

11−--

6+--

12-- Maintainer : bos@serpentine.com

7-- Maintainer : bos@serpentine.com

13-- Stability : experimental

8-- Stability : experimental

14-- Portability : unknown

9-- Portability : unknown

@@ -31,7 +26,6 @@ module Data.Attoparsec.Text

31 Parser

26 Parser

32 , Result

27 , Result

33 , T.IResult(..)

28 , T.IResult(..)

34− , I.compareResults

35

29

36 -- * Running parsers

30 -- * Running parsers

37 , parse

31 , parse

@@ -44,6 +38,11 @@ module Data.Attoparsec.Text

44 , maybeResult

38 , maybeResult

45 , eitherResult

39 , eitherResult

46

40

41+ -- * Combinators

42+ , (I.<?>)

43+ , I.try

44+ , module Data.Attoparsec.Combinator

45+

47 -- * Parsing individual characters

46 -- * Parsing individual characters

48 , I.char

47 , I.char

49 , I.anyChar

48 , I.anyChar

@@ -52,37 +51,18 @@ module Data.Attoparsec.Text

52 , I.satisfyWith

51 , I.satisfyWith

53 , I.skip

52 , I.skip

54

53

55− -- ** Lookahead

56− , I.peekChar

57− , I.peekChar'

58−

59− -- ** Special character parsers

60− , digit

61− , letter

62− , space

63−

64 -- ** Character classes

54 -- ** Character classes

65 , I.inClass

55 , I.inClass

66 , I.notInClass

56 , I.notInClass

67

57

68 -- * Efficient string handling

58 -- * Efficient string handling

69 , I.string

59 , I.string

70− , I.stringCI

71− , I.asciiCI

72− , skipSpace

73 , I.skipWhile

60 , I.skipWhile

74− , I.scan

75− , I.runScanner

76 , I.take

61 , I.take

77 , I.takeWhile

62 , I.takeWhile

78 , I.takeWhile1

63 , I.takeWhile1

79 , I.takeTill

64 , I.takeTill

80

65

81− -- ** String combinators

82− -- $specalt

83− , (.*>)

84− , (<*.)

85−

86 -- ** Consume all remaining input

66 -- ** Consume all remaining input

87 , I.takeText

67 , I.takeText

88 , I.takeLazyText

68 , I.takeLazyText

@@ -100,99 +80,71 @@ module Data.Attoparsec.Text

100 , Number(..)

80 , Number(..)

101 , number

81 , number

102 , rational

82 , rational

103− , scientific

104

83

105− -- * Combinators

106− , try

107− , (<?>)

108− , choice

109− , count

110− , option

111− , many'

112− , many1

113− , many1'

114− , manyTill

115− , manyTill'

116− , sepBy

117− , sepBy'

118− , sepBy1

119− , sepBy1'

120− , skipMany

121− , skipMany1

122− , eitherP

123− , I.match

124 -- * State observation and manipulation functions

84 -- * State observation and manipulation functions

125 , I.endOfInput

85 , I.endOfInput

126 , I.atEnd

86 , I.atEnd

127 ) where

87 ) where

128

88

129−#if !MIN_VERSION_base(4,8,0)

130−import Control.Applicative (pure, (*>), (<*), (<$>))

89+import Control.Applicative ((<$>), (*>), (<|>))

131−import Data.Word (Word)

132−#endif

133−import Control.Applicative ((<|>))

134import Data.Attoparsec.Combinator

90import Data.Attoparsec.Combinator

135import Data.Attoparsec.Number (Number(..))

91import Data.Attoparsec.Number (Number(..))

136−import Data.Scientific (Scientific)

137−import qualified Data.Scientific as Sci

138import Data.Attoparsec.Text.Internal (Parser, Result, parse, takeWhile1)

92import Data.Attoparsec.Text.Internal (Parser, Result, parse, takeWhile1)

139import Data.Bits (Bits, (.|.), shiftL)

93import Data.Bits (Bits, (.|.), shiftL)

140−import Data.Char (isAlpha, isDigit, isSpace, ord)

94+import Data.Char (ord)

141import Data.Int (Int8, Int16, Int32, Int64)

95import Data.Int (Int8, Int16, Int32, Int64)

142−import Data.List (intercalate)

96+import Data.Ratio ((%))

143import Data.Text (Text)

97import Data.Text (Text)

144−import Data.Word (Word8, Word16, Word32, Word64)

98+import Data.Word (Word8, Word16, Word32, Word64, Word)

145−import qualified Data.Attoparsec.Internal as I

146import qualified Data.Attoparsec.Internal.Types as T

99import qualified Data.Attoparsec.Internal.Types as T

147import qualified Data.Attoparsec.Text.Internal as I

100import qualified Data.Attoparsec.Text.Internal as I

148import qualified Data.Text as T

101import qualified Data.Text as T

149

102

150-- $parsec

103-- $parsec

151--

104--

152−-- Compared to Parsec 3, attoparsec makes several tradeoffs. It is

105+-- Compared to Parsec 3, Attoparsec makes several tradeoffs. It is

153-- not intended for, or ideal for, all possible uses.

106-- not intended for, or ideal for, all possible uses.

154--

107--

155−-- * While attoparsec can consume input incrementally, Parsec cannot.

108+-- * While Attoparsec can consume input incrementally, Parsec cannot.

156-- Incremental input is a huge deal for efficient and secure network

109-- Incremental input is a huge deal for efficient and secure network

157-- and system programming, since it gives much more control to users

110-- and system programming, since it gives much more control to users

158-- of the library over matters such as resource usage and the I/O

111-- of the library over matters such as resource usage and the I/O

159-- model to use.

112-- model to use.

160--

113--

161−-- * Much of the performance advantage of attoparsec is gained via

114+-- * Much of the performance advantage of Attoparsec is gained via

162-- high-performance parsers such as 'I.takeWhile' and 'I.string'.

115-- high-performance parsers such as 'I.takeWhile' and 'I.string'.

163-- If you use complicated combinators that return lists of

116-- If you use complicated combinators that return lists of

164-- characters, there is less performance difference between the two

117-- characters, there is less performance difference between the two

165-- libraries.

118-- libraries.

166--

119--

167−-- * Unlike Parsec 3, attoparsec does not support being used as a

120+-- * Unlike Parsec 3, Attoparsec does not support being used as a

168-- monad transformer.

121-- monad transformer.

169--

122--

170−-- * attoparsec is specialised to deal only with strict 'Text'

123+-- * Attoparsec is specialised to deal only with strict 'Text'

171-- input. Efficiency concerns rule out both lists and lazy text.

124-- input. Efficiency concerns rule out both lists and lazy text.

172-- The usual use for lazy text would be to allow consumption of very

125-- The usual use for lazy text would be to allow consumption of very

173-- large input without a large footprint. For this need,

126-- large input without a large footprint. For this need,

174−-- attoparsec's incremental input provides an excellent substitute,

127+-- Attoparsec's incremental input provides an excellent substitute,

175-- with much more control over when input takes place. If you must

128-- with much more control over when input takes place. If you must

176-- use lazy text, see the 'Lazy' module, which feeds lazy chunks to

129-- use lazy text, see the 'Lazy' module, which feeds lazy chunks to

177-- a regular parser.

130-- a regular parser.

178--

131--

179-- * Parsec parsers can produce more helpful error messages than

132-- * Parsec parsers can produce more helpful error messages than

180−-- attoparsec parsers. This is a matter of focus: attoparsec avoids

133+-- Attoparsec parsers. This is a matter of focus: Attoparsec avoids

181-- the extra book-keeping in favour of higher performance.

134-- the extra book-keeping in favour of higher performance.

182

135

183-- $incremental

136-- $incremental

184--

137--

185−-- attoparsec supports incremental input, meaning that you can feed it

138+-- Attoparsec supports incremental input, meaning that you can feed it

186-- a 'Text' that represents only part of the expected total amount

139-- a 'Text' that represents only part of the expected total amount

187-- of data to parse. If your parser reaches the end of a fragment of

140-- of data to parse. If your parser reaches the end of a fragment of

188-- input and could consume more input, it will suspend parsing and

141-- input and could consume more input, it will suspend parsing and

189-- return a 'T.Partial' continuation.

142-- return a 'T.Partial' continuation.

190--

143--

191-- Supplying the 'T.Partial' continuation with another string will

144-- Supplying the 'T.Partial' continuation with another string will

192−-- resume parsing at the point where it was suspended, with the string

145+-- resume parsing at the point where it was suspended. You must be

193−-- you supplied used as new input at the end of the existing

194−-- input. You must be prepared for the result of the resumed parse to

146+-- prepared for the result of the resumed parse to be another

195−-- be another 'Partial' continuation.

147+-- 'Partial' continuation.

196--

148--

197-- To indicate that you have no more input, supply the 'Partial'

149-- To indicate that you have no more input, supply the 'Partial'

198-- continuation with an 'T.empty' 'Text'.

150-- continuation with an 'T.empty' 'Text'.

@@ -204,19 +156,12 @@ import qualified Data.Text as T

204-- If you do not need support for incremental input, consider using

156-- If you do not need support for incremental input, consider using

205-- the 'I.parseOnly' function to run your parser. It will never

157-- the 'I.parseOnly' function to run your parser. It will never

206-- prompt for more input.

158-- prompt for more input.

207−--

208−-- /Note/: incremental input does /not/ imply that attoparsec will

209−-- release portions of its internal state for garbage collection as it

210−-- proceeds. Its internal representation is equivalent to a single

211−-- 'Text': if you feed incremental input to an a parser, it will

212−-- require memory proportional to the amount of input you supply.

213−-- (This is necessary to support arbitrary backtracking.)

214

159

215-- $performance

160-- $performance

216--

161--

217−-- If you write an attoparsec-based parser carefully, it can be

162+-- If you write an Attoparsec-based parser carefully, it can be

218−-- realistic to expect it to perform similarly to a hand-rolled C

163+-- realistic to expect it to perform within a factor of 2 of a

219−-- parser (measuring megabytes parsed per second).

164+-- hand-rolled C parser (measuring megabytes parsed per second).

220--

165--

221-- To actually achieve high performance, there are a few guidelines

166-- To actually achieve high performance, there are a few guidelines

222-- that it is useful to follow.

167-- that it is useful to follow.

@@ -237,6 +182,14 @@ import qualified Data.Text as T

237-- Make active use of benchmarking and profiling tools to measure,

182-- Make active use of benchmarking and profiling tools to measure,

238-- find the problems with, and improve the performance of your parser.

183-- find the problems with, and improve the performance of your parser.

239

184

185+-- | If a parser has returned a 'Partial' result, supply it with more

186+-- input.

187+feed :: Result r -> Text -> Result r

188+feed f@(T.Fail _ _ _) _ = f

189+feed (T.Partial k) d = k d

190+feed (T.Done bs r) d = T.Done (T.append bs d) r

191+{-# INLINE feed #-}

192+

240-- | Run a parser and print its result to standard output.

193-- | Run a parser and print its result to standard output.

241parseTest :: (Show a) => I.Parser a -> Text -> IO ()

194parseTest :: (Show a) => I.Parser a -> Text -> IO ()

242parseTest p s = print (parse p s)

195parseTest p s = print (parse p s)

@@ -266,10 +219,9 @@ maybeResult _ = Nothing

266-- | Convert a 'Result' value to an 'Either' value. A 'Partial' result

219-- | Convert a 'Result' value to an 'Either' value. A 'Partial' result

267-- is treated as failure.

220-- is treated as failure.

268eitherResult :: Result r -> Either String r

221eitherResult :: Result r -> Either String r

269−eitherResult (T.Done _ r) = Right r

222+eitherResult (T.Done _ r) = Right r

270−eitherResult (T.Fail _ [] msg) = Left msg

223+eitherResult (T.Fail _ _ msg) = Left msg

271−eitherResult (T.Fail _ ctxs msg) = Left (intercalate " > " ctxs ++ ": " ++ msg)

272−eitherResult _ = Left "Result: incomplete input"

224+eitherResult _ = Left "Result: incomplete input"

273

225

274-- | A predicate that matches either a carriage return @\'\\r\'@ or

226-- | A predicate that matches either a carriage return @\'\\r\'@ or

275-- newline @\'\\n\'@ character.

227-- newline @\'\\n\'@ character.

@@ -311,7 +263,7 @@ hexadecimal = T.foldl' step 0 `fmap` takeWhile1 isHexDigit

311

263

312-- | Parse and decode an unsigned decimal number.

264-- | Parse and decode an unsigned decimal number.

313decimal :: Integral a => Parser a

265decimal :: Integral a => Parser a

314−decimal = T.foldl' step 0 `fmap` takeWhile1 isDecimal

266+decimal = T.foldl' step 0 `fmap` takeWhile1 isDigit

315 where step a c = a * 10 + fromIntegral (ord c - 48)

267 where step a c = a * 10 + fromIntegral (ord c - 48)

316{-# SPECIALISE decimal :: Parser Int #-}

268{-# SPECIALISE decimal :: Parser Int #-}

317{-# SPECIALISE decimal :: Parser Int8 #-}

269{-# SPECIALISE decimal :: Parser Int8 #-}

@@ -325,9 +277,9 @@ decimal = T.foldl' step 0 `fmap` takeWhile1 isDecimal

325{-# SPECIALISE decimal :: Parser Word32 #-}

277{-# SPECIALISE decimal :: Parser Word32 #-}

326{-# SPECIALISE decimal :: Parser Word64 #-}

278{-# SPECIALISE decimal :: Parser Word64 #-}

327

279

328−isDecimal :: Char -> Bool

280+isDigit :: Char -> Bool

329−isDecimal c = c >= '0' && c <= '9'

281+isDigit c = c >= '0' && c <= '9'

330−{-# INLINE isDecimal #-}

282+{-# INLINE isDigit #-}

331

283

332-- | Parse a number with an optional leading @\'+\'@ or @\'-\'@ sign

284-- | Parse a number with an optional leading @\'+\'@ or @\'-\'@ sign

333-- character.

285-- character.

@@ -342,24 +294,6 @@ signed p = (negate <$> (I.char '-' *> p))

342 <|> (I.char '+' *> p)

294 <|> (I.char '+' *> p)

343 <|> p

295 <|> p

344

296

345−-- | Parse a rational number.

346−--

347−-- The syntax accepted by this parser is the same as for 'double'.

348−--

349−-- /Note/: this parser is not safe for use with inputs from untrusted

350−-- sources. An input with a suitably large exponent such as

351−-- @"1e1000000000"@ will cause a huge 'Integer' to be allocated,

352−-- resulting in what is effectively a denial-of-service attack.

353−--

354−-- In most cases, it is better to use 'double' or 'scientific'

355−-- instead.

356−rational :: Fractional a => Parser a

357−{-# SPECIALIZE rational :: Parser Double #-}

358−{-# SPECIALIZE rational :: Parser Float #-}

359−{-# SPECIALIZE rational :: Parser Rational #-}

360−{-# SPECIALIZE rational :: Parser Scientific #-}

361−rational = scientifically realToFrac

362−

363-- | Parse a rational number.

297-- | Parse a rational number.

364--

298--

365-- This parser accepts an optional leading sign character, followed by

299-- This parser accepts an optional leading sign character, followed by

@@ -374,7 +308,7 @@ rational = scientifically realToFrac

374-- >rational "3.1" == Done 3.1 ""

308-- >rational "3.1" == Done 3.1 ""

375-- >rational "3e4" == Done 30000.0 ""

309-- >rational "3e4" == Done 30000.0 ""

376-- >rational "3.1e4" == Done 31000.0, ""

310-- >rational "3.1e4" == Done 31000.0, ""

377−--

311+

378-- Examples with behaviour identical to 'read':

312-- Examples with behaviour identical to 'read':

379--

313--

380-- >rational ".3" == Fail "input does not start with a digit"

314-- >rational ".3" == Fail "input does not start with a digit"

@@ -387,107 +321,78 @@ rational = scientifically realToFrac

387--

321--

388-- This function does not accept string representations of \"NaN\" or

322-- This function does not accept string representations of \"NaN\" or

389-- \"Infinity\".

323-- \"Infinity\".

324+rational :: Fractional a => Parser a

390−double :: Parser Double

325+{-# SPECIALIZE rational :: Parser Double #-}

391−double = scientifically Sci.toRealFloat

326+{-# SPECIALIZE rational :: Parser Float #-}

327+{-# SPECIALIZE rational :: Parser Rational #-}

328+rational = floaty $ \real frac fracDenom -> fromRational $

329+ real % 1 + frac % fracDenom

392

330

393−-- | Parse a number, attempting to preserve both speed and precision.

331+-- | Parse a rational number.

394--

332--

395−-- The syntax accepted by this parser is the same as for 'double'.

333+-- The syntax accepted by this parser is the same as for 'rational'.

334+--

335+-- /Note/: This function is almost ten times faster than 'rational',

336+-- but is slightly less accurate.

337+--

338+-- The 'Double' type supports about 16 decimal places of accuracy.

339+-- For 94.2% of numbers, this function and 'rational' give identical

340+-- results, but for the remaining 5.8%, this function loses precision

341+-- around the 15th decimal place. For 0.001% of numbers, this

342+-- function will lose precision at the 13th or 14th decimal place.

396--

343--

397-- This function does not accept string representations of \"NaN\" or

344-- This function does not accept string representations of \"NaN\" or

398-- \"Infinity\".

345-- \"Infinity\".

399−number :: Parser Number

346+double :: Parser Double

400−number = scientifically $ \s ->

347+double = floaty asDouble

401− let e = Sci.base10Exponent s

402− c = Sci.coefficient s

403− in if e >= 0

404− then I (c * 10 ^ e)

405− else D (Sci.toRealFloat s)

406−{-# DEPRECATED number "Use 'scientific' instead." #-}

407−

408−-- | Parse a scientific number.

409−--

410−-- The syntax accepted by this parser is the same as for 'double'.

411−scientific :: Parser Scientific

412−scientific = scientifically id

413−

414−-- A strict pair

415−data SP = SP !Integer {-# UNPACK #-}!Int

416−

417−{-# INLINE scientifically #-}

418−scientifically :: (Scientific -> a) -> Parser a

419−scientifically h = do

420− !positive <- ((== '+') <$> I.satisfy (\c -> c == '-' || c == '+')) <|>

421− pure True

422−

423− n <- decimal

424−

425− let f fracDigits = SP (T.foldl' step n fracDigits)

426− (negate $ T.length fracDigits)

427− step a c = a * 10 + fromIntegral (ord c - 48)

428−

429− SP c e <- (I.satisfy (=='.') *> (f <$> I.takeWhile isDigit)) <|>

430− pure (SP n 0)

431−

432− let !signedCoeff | positive = c

433− | otherwise = -c

434−

435− (I.satisfy (\w -> w == 'e' || w == 'E') *>

436− fmap (h . Sci.scientific signedCoeff . (e +)) (signed decimal)) <|>

437− return (h $ Sci.scientific signedCoeff e)

438−

439−-- | Parse a single digit, as recognised by 'isDigit'.

440−digit :: Parser Char

441−digit = I.satisfy isDigit <?> "digit"

442−{-# INLINE digit #-}

443−

444−-- | Parse a letter, as recognised by 'isAlpha'.

445−letter :: Parser Char

446−letter = I.satisfy isAlpha <?> "letter"

447−{-# INLINE letter #-}

448−

449−-- | Parse a space character, as recognised by 'isSpace'.

450−space :: Parser Char

451−space = I.satisfy isSpace <?> "space"

452−{-# INLINE space #-}

453

348

454−-- | Skip over white space.

349+asDouble :: Integer -> Integer -> Integer -> Double

455−skipSpace :: Parser ()

350+asDouble real frac fracDenom =

456−skipSpace = I.skipWhile isSpace

351+ fromIntegral real + fromIntegral frac / fromIntegral fracDenom

457−{-# INLINE skipSpace #-}

352+{-# INLINE asDouble #-}

458

353

459−-- $specalt

354+-- | Parse a number, attempting to preserve both speed and precision.

460−--

461−-- If you enable the @OverloadedStrings@ language extension, you can

462−-- use the '*>' and '<*' combinators to simplify the common task of

463−-- matching a statically known string, then immediately parsing

464−-- something else.

465−--

466−-- Instead of writing something like this:

467−--

468−-- @

469−--'I.string' \"foo\" '*>' wibble

470−-- @

471--

355--

472−-- Using @OverloadedStrings@, you can omit the explicit use of

356+-- The syntax accepted by this parser is the same as for 'rational'.

473−-- 'I.string', and write a more compact version:

474--

357--

475−-- @

358+-- /Note/: This function is almost ten times faster than 'rational'.

476−-- \"foo\" '*>' wibble

359+-- On integral inputs, it gives perfectly accurate answers, and on

477−-- @

360+-- floating point inputs, it is slightly less accurate than

361+-- 'rational'.

478--

362--

479−-- (Note: the '.*>' and '<*.' combinators that were originally

363+-- This function does not accept string representations of \"NaN\" or

480−-- provided for this purpose are obsolete and unnecessary, and will be

364+-- \"Infinity\".

481−-- removed in the next major version.)

365+number :: Parser Number

366+number = floaty $ \real frac fracDenom ->

367+ if frac == 0 && fracDenom == 0

368+ then I real

369+ else D (asDouble real frac fracDenom)

370+{-# INLINE number #-}

482

371

483−-- | /Obsolete/. A type-specialized version of '*>' for 'Text'. Use

372+data T = T !Integer !Int

484−-- '*>' instead.

485−(.*>) :: Text -> Parser a -> Parser a

486−s .*> f = I.string s *> f

487−{-# DEPRECATED (.*>) "This is no longer necessary, and will be removed. Use '*>' instead." #-}

488

373

489−-- | /Obsolete/. A type-specialized version of '<*' for 'Text'. Use

374+floaty :: Fractional a => (Integer -> Integer -> Integer -> a) -> Parser a

490−-- '*>' instead.

375+{-# INLINE floaty #-}

491−(<*.) :: Parser a -> Text -> Parser a

376+floaty f = do

492−f <*. s = f <* I.string s

377+ !positive <- ((== '+') <$> I.satisfy (\c -> c == '-' || c == '+')) <|>

493−{-# DEPRECATED (<*.) "This is no longer necessary, and will be removed. Use '<*' instead." #-}

378+ return True

379+ real <- decimal

380+ let tryFraction = do

381+ _ <- I.satisfy (=='.')

382+ ds <- I.takeWhile isDigit

383+ case I.parseOnly decimal ds of

384+ Right n -> return $ T n (T.length ds)

385+ _ -> fail "no digits after decimal"

386+ T fraction fracDigits <- tryFraction <|> return (T 0 0)

387+ let e c = c == 'e' || c == 'E'

388+ power <- (I.satisfy e *> signed decimal) <|> return (0::Int)

389+ let n = if fracDigits == 0

390+ then if power == 0

391+ then fromIntegral real

392+ else fromIntegral real * (10 ^^ power)

393+ else if power == 0

394+ then f real fraction (10 ^ fracDigits)

395+ else f real fraction (10 ^ fracDigits) * (10 ^^ power)

396+ return $ if positive

397+ then n

398+ else -n

Data/Attoparsec/Text/Buffer.hsdeleted−172

@@ -1,172 +0,0 @@

1−{-# LANGUAGE BangPatterns, CPP, MagicHash, RankNTypes, RecordWildCards,

2− UnboxedTuples #-}

3−

4−-- |

5−-- Module : Data.Attoparsec.Text.Buffer

6−-- Copyright : Bryan O'Sullivan 2007-2015

7−-- License : BSD3

8−--

9−-- Maintainer : bos@serpentine.com

10−-- Stability : experimental

11−-- Portability : GHC

12−--

13−-- An immutable buffer that supports cheap appends.

14−

15−-- A Buffer is divided into an immutable read-only zone, followed by a

16−-- mutable area that we've preallocated, but not yet written to.

17−--

18−-- We overallocate at the end of a Buffer so that we can cheaply

19−-- append. Since a user of an existing Buffer cannot see past the end

20−-- of its immutable zone into the data that will change during an

21−-- append, this is safe.

22−--

23−-- Once we run out of space at the end of a Buffer, we do the usual

24−-- doubling of the buffer size.

25−

26−module Data.Attoparsec.Text.Buffer

27− (

28− Buffer

29− , buffer

30− , unbuffer

31− , unbufferAt

32− , length

33− , pappend

34− , iter

35− , iter_

36− , substring

37− , dropWord16

38− ) where

39−

40−import Control.Exception (assert)

41−import Data.Bits (shiftR)

42−import Data.List (foldl1')

43−import Data.Monoid as Mon (Monoid(..))

44−import Data.Semigroup (Semigroup(..))

45−import Data.Text ()

46−import Data.Text.Internal (Text(..))

47−import Data.Text.Internal.Encoding.Utf16 (chr2)

48−import Data.Text.Internal.Unsafe.Char (unsafeChr)

49−import Data.Text.Unsafe (Iter(..))

50−import Foreign.Storable (sizeOf)

51−import GHC.Base (Int(..), indexIntArray#, unsafeCoerce#, writeIntArray#)

52−import GHC.ST (ST(..), runST)

53−import Prelude hiding (length)

54−import qualified Data.Text.Array as A

55−

56−-- If _cap is zero, this buffer is empty.

57−data Buffer = Buf {

58− _arr :: {-# UNPACK #-} !A.Array

59− , _off :: {-# UNPACK #-} !Int

60− , _len :: {-# UNPACK #-} !Int

61− , _cap :: {-# UNPACK #-} !Int

62− , _gen :: {-# UNPACK #-} !Int

63− }

64−

65−instance Show Buffer where

66− showsPrec p = showsPrec p . unbuffer

67−

68−-- | The initial 'Buffer' has no mutable zone, so we can avoid all

69−-- copies in the (hopefully) common case of no further input being fed

70−-- to us.

71−buffer :: Text -> Buffer

72−buffer (Text arr off len) = Buf arr off len len 0

73−

74−unbuffer :: Buffer -> Text

75−unbuffer (Buf arr off len _ _) = Text arr off len

76−

77−unbufferAt :: Int -> Buffer -> Text

78−unbufferAt s (Buf arr off len _ _) =

79− assert (s >= 0 && s <= len) $

80− Text arr (off+s) (len-s)

81−

82−instance Semigroup Buffer where

83− (Buf _ _ _ 0 _) <> b = b

84− a <> (Buf _ _ _ 0 _) = a

85− buf <> (Buf arr off len _ _) = append buf arr off len

86− {-# INLINE (<>) #-}

87−

88−instance Monoid Buffer where

89− mempty = Buf A.empty 0 0 0 0

90− {-# INLINE mempty #-}

91−

92− mappend = (<>)

93−

94− mconcat [] = Mon.mempty

95− mconcat xs = foldl1' (<>) xs

96−

97−pappend :: Buffer -> Text -> Buffer

98−pappend (Buf _ _ _ 0 _) t = buffer t

99−pappend buf (Text arr off len) = append buf arr off len

100−

101−append :: Buffer -> A.Array -> Int -> Int -> Buffer

102−append (Buf arr0 off0 len0 cap0 gen0) !arr1 !off1 !len1 = runST $ do

103− let woff = sizeOf (0::Int) `shiftR` 1

104− newlen = len0 + len1

105− !gen = if gen0 == 0 then 0 else readGen arr0

106− if gen == gen0 && newlen <= cap0

107− then do

108− let newgen = gen + 1

109− marr <- unsafeThaw arr0

110− writeGen marr newgen

111− A.copyI marr (off0+len0) arr1 off1 (off0+newlen)

112− arr2 <- A.unsafeFreeze marr

113− return (Buf arr2 off0 newlen cap0 newgen)

114− else do

115− let newcap = newlen * 2

116− newgen = 1

117− marr <- A.new (newcap + woff)

118− writeGen marr newgen

119− A.copyI marr woff arr0 off0 (woff+len0)

120− A.copyI marr (woff+len0) arr1 off1 (woff+newlen)

121− arr2 <- A.unsafeFreeze marr

122− return (Buf arr2 woff newlen newcap newgen)

123−

124−length :: Buffer -> Int

125−length (Buf _ _ len _ _) = len

126−{-# INLINE length #-}

127−

128−substring :: Int -> Int -> Buffer -> Text

129−substring s l (Buf arr off len _ _) =

130− assert (s >= 0 && s <= len) .

131− assert (l >= 0 && l <= len-s) $

132− Text arr (off+s) l

133−{-# INLINE substring #-}

134−

135−dropWord16 :: Int -> Buffer -> Text

136−dropWord16 s (Buf arr off len _ _) =

137− assert (s >= 0 && s <= len) $

138− Text arr (off+s) (len-s)

139−{-# INLINE dropWord16 #-}

140−

141−-- | /O(1)/ Iterate (unsafely) one step forwards through a UTF-16

142−-- array, returning the current character and the delta to add to give

143−-- the next offset to iterate at.

144−iter :: Buffer -> Int -> Iter

145−iter (Buf arr off _ _ _) i

146− | m < 0xD800 || m > 0xDBFF = Iter (unsafeChr m) 1

147− | otherwise = Iter (chr2 m n) 2

148− where m = A.unsafeIndex arr j

149− n = A.unsafeIndex arr k

150− j = off + i

151− k = j + 1

152−{-# INLINE iter #-}

153−

154−-- | /O(1)/ Iterate one step through a UTF-16 array, returning the

155−-- delta to add to give the next offset to iterate at.

156−iter_ :: Buffer -> Int -> Int

157−iter_ (Buf arr off _ _ _) i | m < 0xD800 || m > 0xDBFF = 1

158− | otherwise = 2

159− where m = A.unsafeIndex arr (off+i)

160−{-# INLINE iter_ #-}

161−

162−unsafeThaw :: A.Array -> ST s (A.MArray s)

163−unsafeThaw A.Array{..} = ST $ \s# ->

164− (# s#, A.MArray (unsafeCoerce# aBA) #)

165−

166−readGen :: A.Array -> Int

167−readGen a = case indexIntArray# (A.aBA a) 0# of r# -> I# r#

168−

169−writeGen :: A.MArray s -> Int -> ST s ()

170−writeGen a (I# gen#) = ST $ \s0# ->

171− case writeIntArray# (A.maBA a) 0# gen# s0# of

172− s1# -> (# s1#, () #)

Data/Attoparsec/Text/FastSet.hs+27−85

@@ -1,20 +1,16 @@

1−{-# LANGUAGE BangPatterns #-}

1+-----------------------------------------------------------------------------

2−

3−------------------------------------------------------------------------------

4-- |

2-- |

5-- Module : Data.Attoparsec.FastSet

3-- Module : Data.Attoparsec.FastSet

6−-- Copyright : Felipe Lessa 2010, Bryan O'Sullivan 2007-2015

4+-- Copyright : Felipe Lessa 2010, Bryan O'Sullivan 2008

7-- License : BSD3

5-- License : BSD3

8--

6--

9-- Maintainer : felipe.lessa@gmail.com

7-- Maintainer : felipe.lessa@gmail.com

10-- Stability : experimental

8-- Stability : experimental

11-- Portability : unknown

9-- Portability : unknown

12--

10--

13−-- Fast set membership tests for 'Char' values. We test for

11+-- Fast set membership tests for 'Char' values. The set

14−-- membership using a hashtable implemented with Robin Hood

15−-- collision resolution. The set representation is unboxed,

12+-- representation is unboxed for efficiency. We test for

16−-- and the characters and hashes interleaved, for efficiency.

13+-- membership using a binary search.

17−--

18--

14--

19-----------------------------------------------------------------------------

15-----------------------------------------------------------------------------

20module Data.Attoparsec.Text.FastSet

16module Data.Attoparsec.Text.FastSet

@@ -30,92 +26,38 @@ module Data.Attoparsec.Text.FastSet

30 , charClass

26 , charClass

31 ) where

27 ) where

32

28

33−import Data.Bits ((.|.), (.&.), shiftR)

29+import Data.List (sort)

34−import Data.Function (on)

35−import Data.List (sort, sortBy)

36import qualified Data.Array.Base as AB

30import qualified Data.Array.Base as AB

37import qualified Data.Array.Unboxed as A

31import qualified Data.Array.Unboxed as A

38import qualified Data.Text as T

32import qualified Data.Text as T

39

33

40−data FastSet = FastSet {

34+newtype FastSet = FastSet (A.UArray Int Char)

41− table :: {-# UNPACK #-} !(A.UArray Int Int)

35+ deriving (Eq, Ord, Show)

42− , mask :: {-# UNPACK #-} !Int

43− }

44−

45−data Entry = Entry {

46− key :: {-# UNPACK #-} !Char

47− , initialIndex :: {-# UNPACK #-} !Int

48− , index :: {-# UNPACK #-} !Int

49− }

50−

51−offset :: Entry -> Int

52−offset e = index e - initialIndex e

53−

54−resolveCollisions :: [Entry] -> [Entry]

55−resolveCollisions [] = []

56−resolveCollisions [e] = [e]

57−resolveCollisions (a:b:entries) = a' : resolveCollisions (b' : entries)

58− where (a', b')

59− | index a < index b = (a, b)

60− | offset a < offset b = (b { index=index a }, a { index=index a + 1 })

61− | otherwise = (a, b { index=index a + 1 })

62

36

63−pad :: Int -> [Entry] -> [Entry]

37+-- | Create a set.

64−pad = go 0

38+set :: T.Text -> FastSet

65− where -- ensure that we pad enough so that lookups beyond the

39+set t = mkSet (T.length t) (sort $ T.unpack t)

66− -- last hash in the table fall within the array

67− go !_ !m [] = replicate (max 1 m + 1) empty

68− go k m (e:entries) = map (const empty) [k..i - 1] ++ e :

69− go (i + 1) (m + i - k - 1) entries

70− where i = index e

71− empty = Entry '\0' maxBound 0

72−

73−nextPowerOf2 :: Int -> Int

74−nextPowerOf2 0 = 1

75−nextPowerOf2 x = go (x - 1) 1

76− where go y 32 = y + 1

77− go y k = go (y .|. (y `shiftR` k)) $ k * 2

78−

79−fastHash :: Char -> Int

80−fastHash = fromEnum

81−

82−fromList :: String -> FastSet

83−fromList s = FastSet (AB.listArray (0, length interleaved - 1) interleaved)

84− mask'

85− where s' = ordNub (sort s)

86− l = length s'

87− mask' = nextPowerOf2 ((5 * l) `div` 4) - 1

88− entries = pad mask' .

89− resolveCollisions .

90− sortBy (compare `on` initialIndex) .

91− zipWith (\c i -> Entry c i i) s' .

92− map ((.&. mask') . fastHash) $ s'

93− interleaved = concatMap (\e -> [fromEnum $ key e, initialIndex e])

94− entries

95

40

96−ordNub :: Eq a => [a] -> [a]

41+fromList :: [Char] -> FastSet

97−ordNub [] = []

42+fromList cs = mkSet (length cs) (sort cs)

98−ordNub (y:ys) = go y ys

99− where go x (z:zs)

100− | x == z = go x zs

101− | otherwise = x : go z zs

102− go x [] = [x]

103

43

104−set :: T.Text -> FastSet

44+mkSet :: Int -> [Char] -> FastSet

105−set = fromList . T.unpack

45+mkSet l = FastSet . A.listArray (0,l-1)

106

46

107-- | Check the set for membership.

47-- | Check the set for membership.

108member :: Char -> FastSet -> Bool

48member :: Char -> FastSet -> Bool

109−member c a = go (2 * i)

49+member c (FastSet a) = uncurry search (A.bounds a)

110− where i = fastHash c .&. mask a

50+ where search lo hi

111− lookupAt j b = (i' <= i) && (c == c' || b)

51+ | hi < lo = False

112− where c' = toEnum $ AB.unsafeAt (table a) j

52+ | otherwise =

53+ let mid = (lo + hi) `div` 2

113− i' = AB.unsafeAt (table a) $ j + 1

54+ in case compare c (AB.unsafeAt a mid) of

114− go j = lookupAt j . lookupAt (j + 2) . lookupAt (j + 4) .

55+ GT -> search (mid + 1) hi

115− lookupAt (j + 6) . go $ j + 8

56+ LT -> search lo (mid - 1)

57+ _ -> True

116

58

117charClass :: String -> FastSet

59charClass :: String -> FastSet

118charClass = fromList . go

60charClass = fromList . go

119− where go (a:'-':b:xs) = [a..b] ++ go xs

61+ where go (a:'-':b:xs) = [a..b] ++ go xs

120− go (x:xs) = x : go xs

62+ go (x:xs) = x : go xs

121− go _ = ""

63+ go _ = ""

Data/Attoparsec/Text/Internal.hs+175−322

@@ -1,16 +1,14 @@

1−{-# LANGUAGE BangPatterns, FlexibleInstances, GADTs, OverloadedStrings,

2− Rank2Types, RecordWildCards, TypeFamilies, TypeSynonymInstances #-}

1+{-# LANGUAGE BangPatterns, Rank2Types, OverloadedStrings, RecordWildCards #-}

3−{-# OPTIONS_GHC -fno-warn-orphans #-}

4-- |

2-- |

5-- Module : Data.Attoparsec.Text.Internal

3-- Module : Data.Attoparsec.Text.Internal

6−-- Copyright : Bryan O'Sullivan 2007-2015

4+-- Copyright : Bryan O'Sullivan 2011

7-- License : BSD3

5-- License : BSD3

8--

6--

9-- Maintainer : bos@serpentine.com

7-- Maintainer : bos@serpentine.com

10-- Stability : experimental

8-- Stability : experimental

11-- Portability : unknown

9-- Portability : unknown

12--

10--

13−-- Simple, efficient parser combinators for 'Text' strings, loosely

11+-- Simple, efficient parser combinators for 'T.Text' strings, loosely

14-- based on the Parsec library.

12-- based on the Parsec library.

15

13

16module Data.Attoparsec.Text.Internal

14module Data.Attoparsec.Text.Internal

@@ -24,6 +22,8 @@ module Data.Attoparsec.Text.Internal

24 , parseOnly

22 , parseOnly

25

23

26 -- * Combinators

24 -- * Combinators

25+ , (<?>)

26+ , try

27 , module Data.Attoparsec.Combinator

28

29 -- * Parsing individual characters

@@ -34,10 +34,6 @@ module Data.Attoparsec.Text.Internal

34 , char

35 , notChar

36

37− -- ** Lookahead

38− , peekChar

39− , peekChar'

40−

41 -- ** Character classes

37 -- ** Character classes

42 , inClass

38 , inClass

43 , notInClass

39 , notInClass

@@ -45,11 +41,8 @@ module Data.Attoparsec.Text.Internal

45 -- * Efficient string handling

41 -- * Efficient string handling

46 , skipWhile

42 , skipWhile

47 , string

43 , string

48− , stringCI

44+ , stringTransform

49− , asciiCI

50 , take

45 , take

51− , scan

52− , runScanner

53 , takeWhile

46 , takeWhile

54 , takeWhile1

47 , takeWhile1

55 , takeTill

48 , takeTill

@@ -58,38 +51,100 @@ module Data.Attoparsec.Text.Internal

58 , takeText

51 , takeText

59 , takeLazyText

52 , takeLazyText

60

53

61− -- * Utilities

54+ -- * State observation and manipulation functions

62− , endOfLine

63 , endOfInput

55 , endOfInput

64− , match

65 , atEnd

56 , atEnd

57+ , ensure

58+

59+ -- * Utilities

60+ , endOfLine

66 ) where

61 ) where

67

62

68−import Control.Applicative ((<|>), (<$>), pure, (*>))

63+import Control.Applicative ((<|>), (<$>))

69import Control.Monad (when)

64import Control.Monad (when)

70−import Data.Attoparsec.Combinator ((<?>))

65+import Data.Attoparsec.Combinator

71−import Data.Attoparsec.Internal

72−import Data.Attoparsec.Internal.Types hiding (Parser, Failure, Success)

66+import Data.Attoparsec.Internal.Types hiding (Parser, Input, Added, Failure, Success)

73−import qualified Data.Attoparsec.Text.Buffer as Buf

67+import Data.Text (Text)

74−import Data.Attoparsec.Text.Buffer (Buffer, buffer)

75−import Data.Char (isAsciiUpper, isAsciiLower, toUpper, toLower)

76−import Data.List (intercalate)

77−import Data.String (IsString(..))

78−import Data.Text.Internal (Text(..))

79−import Prelude hiding (getChar, succ, take, takeWhile)

68+import Prelude hiding (getChar, take, takeWhile)

80import qualified Data.Attoparsec.Internal.Types as T

69import qualified Data.Attoparsec.Internal.Types as T

81import qualified Data.Attoparsec.Text.FastSet as Set

70import qualified Data.Attoparsec.Text.FastSet as Set

82import qualified Data.Text as T

71import qualified Data.Text as T

83import qualified Data.Text.Lazy as L

72import qualified Data.Text.Lazy as L

84−import qualified Data.Text.Unsafe as T

85

73

86−type Parser = T.Parser Text

74+type Parser a = T.Parser Text a

87−type Result = IResult Text

75+type Result a = IResult Text a

76+type Input = T.Input Text

77+type Added = T.Added Text

88−type Failure r = T.Failure Text Buffer r

78+type Failure r = T.Failure Text r

89−type Success a r = T.Success Text Buffer a r

79+type Success a r = T.Success Text a r

90

80

91−instance (a ~ Text) => IsString (Parser a) where

81+-- | If at least @n@ characters of input are available, return the

92− fromString = string . T.pack

82+-- current input, otherwise fail.

83+ensure :: Int -> Parser Text

84+ensure !n = T.Parser $ \i0 a0 m0 kf ks ->

85+ if T.length (unI i0) >= n

86+ then ks i0 a0 m0 (unI i0)

87+ else runParser (demandInput >> ensure n) i0 a0 m0 kf ks

88+

89+-- | Ask for input. If we receive any, pass it to a success

90+-- continuation, otherwise to a failure continuation.

91+prompt :: Input -> Added -> More

92+ -> (Input -> Added -> More -> Result r)

93+ -> (Input -> Added -> More -> Result r)

94+ -> Result r

95+prompt i0 a0 _m0 kf ks = Partial $ \s ->

96+ if T.null s

97+ then kf i0 a0 Complete

98+ else ks (I (unI i0 <> s)) (A (unA a0 <> s)) Incomplete

99+

100+-- | Immediately demand more input via a 'Partial' continuation

101+-- result.

102+demandInput :: Parser ()

103+demandInput = T.Parser $ \i0 a0 m0 kf ks ->

104+ if m0 == Complete

105+ then kf i0 a0 m0 ["demandInput"] "not enough input"

106+ else let kf' i a m = kf i a m ["demandInput"] "not enough input"

107+ ks' i a m = ks i a m ()

108+ in prompt i0 a0 m0 kf' ks'

109+

110+-- | This parser always succeeds. It returns 'True' if any input is

111+-- available either immediately or on demand, and 'False' if the end

112+-- of all input has been reached.

113+wantInput :: Parser Bool

114+wantInput = T.Parser $ \i0 a0 m0 _kf ks ->

115+ case () of

116+ _ | not (T.null (unI i0)) -> ks i0 a0 m0 True

117+ | m0 == Complete -> ks i0 a0 m0 False

118+ | otherwise -> let kf' i a m = ks i a m False

119+ ks' i a m = ks i a m True

120+ in prompt i0 a0 m0 kf' ks'

121+

122+get :: Parser Text

123+get = T.Parser $ \i0 a0 m0 _kf ks -> ks i0 a0 m0 (unI i0)

124+

125+put :: Text -> Parser ()

126+put s = T.Parser $ \_i0 a0 m0 _kf ks -> ks (I s) a0 m0 ()

127+

128+-- | Attempt a parse, and if it fails, rewind the input so that no

129+-- input appears to have been consumed.

130+--

131+-- This combinator is provided for compatibility with Parsec.

132+-- Attoparsec parsers always backtrack on failure.

133+try :: Parser a -> Parser a

134+try p = p

135+{-# INLINE try #-}

136+

137+unsafeHead :: Text -> Char

138+unsafeHead = T.head

139+

140+unsafeTail :: Text -> Text

141+unsafeTail = T.tail

142+

143+unsafeTake :: Int -> Text -> Text

144+unsafeTake = T.take

145+

146+unsafeDrop :: Int -> Text -> Text

147+unsafeDrop = T.drop

93

148

94-- | The parser @satisfy p@ succeeds for any character for which the

149-- | The parser @satisfy p@ succeeds for any character for which the

95-- predicate @p@ returns 'True'. Returns the character that is

150-- predicate @p@ returns 'True'. Returns the character that is

@@ -99,12 +154,11 @@ instance (a ~ Text) => IsString (Parser a) where

99-- > where isDigit c = c >= '0' && c <= '9'

154-- > where isDigit c = c >= '0' && c <= '9'

100satisfy :: (Char -> Bool) -> Parser Char

155satisfy :: (Char -> Bool) -> Parser Char

101satisfy p = do

156satisfy p = do

102− (k,c) <- ensure 1

157+ s <- ensure 1

103− let !h = T.unsafeHead c

158+ let w = unsafeHead s

104− if p h

159+ if p w

105− then advance k >> return h

160+ then put (unsafeTail s) >> return w

106 else fail "satisfy"

161 else fail "satisfy"

107−{-# INLINE satisfy #-}

108

162

109-- | The parser @skip p@ succeeds for any character for which the

163-- | The parser @skip p@ succeeds for any character for which the

110-- predicate @p@ returns 'True'.

164-- predicate @p@ returns 'True'.

@@ -113,9 +167,9 @@ satisfy p = do

113-- > where isDigit c = c >= '0' && c <= '9'

167-- > where isDigit c = c >= '0' && c <= '9'

114skip :: (Char -> Bool) -> Parser ()

168skip :: (Char -> Bool) -> Parser ()

115skip p = do

169skip p = do

116− (k,s) <- ensure 1

170+ s <- ensure 1

117− if p (T.unsafeHead s)

171+ if p (unsafeHead s)

118− then advance k

172+ then put (unsafeTail s)

119 else fail "skip"

173 else fail "skip"

120

174

121-- | The parser @satisfyWith f p@ transforms a character, and succeeds

175-- | The parser @satisfyWith f p@ transforms a character, and succeeds

@@ -123,25 +177,26 @@ skip p = do

123-- parser returns the transformed character that was parsed.

177-- parser returns the transformed character that was parsed.

124satisfyWith :: (Char -> a) -> (a -> Bool) -> Parser a

178satisfyWith :: (Char -> a) -> (a -> Bool) -> Parser a

125satisfyWith f p = do

179satisfyWith f p = do

126− (k,s) <- ensure 1

180+ s <- ensure 1

127− let c = f $! T.unsafeHead s

181+ let c = f (unsafeHead s)

128 if p c

182 if p c

129− then advance k >> return c

183+ then put (unsafeTail s) >> return c

130 else fail "satisfyWith"

184 else fail "satisfyWith"

131−{-# INLINE satisfyWith #-}

132

185

133-- | Consume @n@ characters of input, but succeed only if the

186-- | Consume @n@ characters of input, but succeed only if the

134-- predicate returns 'True'.

187-- predicate returns 'True'.

135takeWith :: Int -> (Text -> Bool) -> Parser Text

188takeWith :: Int -> (Text -> Bool) -> Parser Text

136takeWith n p = do

189takeWith n p = do

137− (k,s) <- ensure n

190+ s <- ensure n

191+ let h = unsafeTake n s

192+ t = unsafeDrop n s

138− if p s

193+ if p h

139− then advance k >> return s

194+ then put t >> return h

140 else fail "takeWith"

195 else fail "takeWith"

141

196

142-- | Consume exactly @n@ characters of input.

197-- | Consume exactly @n@ characters of input.

143take :: Int -> Parser Text

198take :: Int -> Parser Text

144−take n = takeWith (max n 0) (const True)

199+take n = takeWith n (const True)

145{-# INLINE take #-}

200{-# INLINE take #-}

146

201

147-- | @string s@ parses a sequence of characters that identically match

202-- | @string s@ parses a sequence of characters that identically match

@@ -151,95 +206,33 @@ take n = takeWith (max n 0) (const True)

151-- /Note/: The behaviour of this parser is different to that of the

206-- /Note/: The behaviour of this parser is different to that of the

152-- similarly-named parser in Parsec, as this one is all-or-nothing.

207-- similarly-named parser in Parsec, as this one is all-or-nothing.

153-- To illustrate the difference, the following parser will fail under

208-- To illustrate the difference, the following parser will fail under

154−-- Parsec given an input of @\"for\"@:

209+-- Parsec given an input of @"for"@:

155--

210--

156-- >string "foo" <|> string "for"

211-- >string "foo" <|> string "for"

157--

212--

158−-- The reason for its failure is that the first branch is a

213+-- The reason for its failure is that that the first branch is a

159-- partial match, and will consume the letters @\'f\'@ and @\'o\'@

214-- partial match, and will consume the letters @\'f\'@ and @\'o\'@

160−-- before failing. In attoparsec, the above parser will /succeed/ on

215+-- before failing. In Attoparsec, the above parser will /succeed/ on

161-- that input, because the failed first branch will consume nothing.

216-- that input, because the failed first branch will consume nothing.

162string :: Text -> Parser Text

217string :: Text -> Parser Text

163−string s = string_ (stringSuspended id) id s

218+string s = takeWith (T.length s) (==s)

164{-# INLINE string #-}

219{-# INLINE string #-}

165

220

166−string_ :: (forall r. Text -> Text -> Buffer -> Pos -> More

221+stringTransform :: (Text -> Text) -> Text

167− -> Failure r -> Success Text r -> Result r)

168− -> (Text -> Text)

169− -> Text -> Parser Text

222+ -> Parser Text

170−string_ suspended f s0 = T.Parser $ \t pos more lose succ ->

223+stringTransform f s = takeWith (T.length s) ((==f s) . f)

171− let s = f s0

224+{-# INLINE stringTransform #-}

172− ft = f (Buf.unbufferAt (fromPos pos) t)

173− in case T.commonPrefixes s ft of

174− Nothing

175− | T.null s -> succ t pos more T.empty

176− | T.null ft -> suspended s s t pos more lose succ

177− | otherwise -> lose t pos more [] "string"

178− Just (pfx,ssfx,tsfx)

179− | T.null ssfx -> let l = Pos (T.lengthWord16 pfx)

180− in succ t (pos + l) more (substring pos l t)

181− | not (T.null tsfx) -> lose t pos more [] "string"

182− | otherwise -> suspended s ssfx t pos more lose succ

183−{-# INLINE string_ #-}

184−

185−stringSuspended :: (Text -> Text)

186− -> Text -> Text -> Buffer -> Pos -> More

187− -> Failure r

188− -> Success Text r

189− -> Result r

190−stringSuspended f s000 s0 t0 pos0 more0 lose0 succ0 =

191− runParser (demandInput_ >>= go) t0 pos0 more0 lose0 succ0

192− where

193− go s' = T.Parser $ \t pos more lose succ ->

194− let s = f s'

195− in case T.commonPrefixes s0 s of

196− Nothing -> lose t pos more [] "string"

197− Just (_pfx,ssfx,tsfx)

198− | T.null ssfx -> let l = Pos (T.lengthWord16 s000)

199− in succ t (pos + l) more (substring pos l t)

200− | T.null tsfx -> stringSuspended f s000 ssfx t pos more lose succ

201− | otherwise -> lose t pos more [] "string"

202−

203−-- | Satisfy a literal string, ignoring case.

204−--

205−-- Note: this function is currently quite inefficient. Unicode case

206−-- folding can change the length of a string (\"ß\" becomes

207−-- "ss"), which makes a simple, efficient implementation tricky. We

208−-- have (for now) chosen simplicity over efficiency.

209−stringCI :: Text -> Parser Text

210−stringCI s = go 0

211− where

212− go !n

213− | n > T.length fs = fail "stringCI"

214− | otherwise = do

215− (k,t) <- ensure n

216− if T.toCaseFold t == fs

217− then advance k >> return t

218− else go (n+1)

219− fs = T.toCaseFold s

220−{-# INLINE stringCI #-}

221−{-# DEPRECATED stringCI "this is very inefficient, use asciiCI instead" #-}

222−

223−-- | Satisfy a literal string, ignoring case for characters in the ASCII range.

224−asciiCI :: Text -> Parser Text

225−asciiCI s = fmap fst $ match $ T.foldr ((*>) . asciiCharCI) (pure ()) s

226−{-# INLINE asciiCI #-}

227−

228−asciiCharCI :: Char -> Parser Char

229−asciiCharCI c

230− | isAsciiUpper c = char c <|> char (toLower c)

231− | isAsciiLower c = char c <|> char (toUpper c)

232− | otherwise = char c

233−{-# INLINE asciiCharCI #-}

234

225

235-- | Skip past input for as long as the predicate returns 'True'.

226-- | Skip past input for as long as the predicate returns 'True'.

236skipWhile :: (Char -> Bool) -> Parser ()

227skipWhile :: (Char -> Bool) -> Parser ()

237skipWhile p = go

228skipWhile p = go

238 where

229 where

239 go = do

230 go = do

240− t <- T.takeWhile p <$> get

231+ t <- T.dropWhile p <$> get

241− continue <- inputSpansChunks (size t)

232+ put t

233+ when (T.null t) $ do

234+ input <- wantInput

242− when continue go

235+ when input go

243{-# INLINE skipWhile #-}

236{-# INLINE skipWhile #-}

244

237

245-- | Consume input as long as the predicate returns 'False'

238-- | Consume input as long as the predicate returns 'False'

@@ -249,9 +242,8 @@ skipWhile p = go

249-- predicate returns 'True' on the first character of input.

242-- predicate returns 'True' on the first character of input.

250--

243--

251-- /Note/: Because this parser does not fail, do not use it with

244-- /Note/: Because this parser does not fail, do not use it with

252−-- combinators such as 'Control.Applicative.many', because such

245+-- combinators such as 'many', because such parsers loop until a

253−-- parsers loop until a failure occurs. Careless use will thus result

246+-- failure occurs. Careless use will thus result in an infinite loop.

254−-- in an infinite loop.

255takeTill :: (Char -> Bool) -> Parser Text

247takeTill :: (Char -> Bool) -> Parser Text

256takeTill p = takeWhile (not . p)

248takeTill p = takeWhile (not . p)

257{-# INLINE takeTill #-}

249{-# INLINE takeTill #-}

@@ -263,29 +255,21 @@ takeTill p = takeWhile (not . p)

263-- predicate returns 'False' on the first character of input.

255-- predicate returns 'False' on the first character of input.

264--

256--

265-- /Note/: Because this parser does not fail, do not use it with

257-- /Note/: Because this parser does not fail, do not use it with

266−-- combinators such as 'Control.Applicative.many', because such

258+-- combinators such as 'many', because such parsers loop until a

267−-- parsers loop until a failure occurs. Careless use will thus result

259+-- failure occurs. Careless use will thus result in an infinite loop.

268−-- in an infinite loop.

269takeWhile :: (Char -> Bool) -> Parser Text

260takeWhile :: (Char -> Bool) -> Parser Text

270−takeWhile p = do

261+takeWhile p = (T.concat . reverse) `fmap` go []

271− h <- T.takeWhile p <$> get

272− continue <- inputSpansChunks (size h)

273− -- only use slow concat path if necessary

274− if continue

275− then takeWhileAcc p [h]

276− else return h

277−{-# INLINE takeWhile #-}

278−

279−takeWhileAcc :: (Char -> Bool) -> [Text] -> Parser Text

280−takeWhileAcc p = go

281 where

262 where

282 go acc = do

263 go acc = do

283− h <- T.takeWhile p <$> get

264+ (h,t) <- T.span p <$> get

284− continue <- inputSpansChunks (size h)

265+ put t

285− if continue

266+ if T.null t

267+ then do

268+ input <- wantInput

269+ if input

286− then go (h:acc)

270+ then go (h:acc)

287− else return $ concatReverse (h:acc)

271+ else return (h:acc)

288−{-# INLINE takeWhileAcc #-}

272+ else return (h:acc)

289

273

290takeRest :: Parser [Text]

274takeRest :: Parser [Text]

291takeRest = go []

275takeRest = go []

@@ -295,7 +279,7 @@ takeRest = go []

295 if input

279 if input

296 then do

280 then do

297 s <- get

281 s <- get

298− advance (size s)

282+ put T.empty

299 go (s:acc)

283 go (s:acc)

300 else return (reverse acc)

284 else return (reverse acc)

301

285

@@ -307,51 +291,6 @@ takeText = T.concat `fmap` takeRest

307takeLazyText :: Parser L.Text

291takeLazyText :: Parser L.Text

308takeLazyText = L.fromChunks `fmap` takeRest

292takeLazyText = L.fromChunks `fmap` takeRest

309

293

310−data Scan s = Continue s

311− | Finished s {-# UNPACK #-} !Int Text

312−

313−scan_ :: (s -> [Text] -> Parser r) -> s -> (s -> Char -> Maybe s) -> Parser r

314−scan_ f s0 p = go [] s0

315− where

316− scanner s !n t =

317− case T.uncons t of

318− Just (c,t') -> case p s c of

319− Just s' -> scanner s' (n+1) t'

320− Nothing -> Finished s n t

321− Nothing -> Continue s

322− go acc s = do

323− input <- get

324− case scanner s 0 input of

325− Continue s' -> do continue <- inputSpansChunks (size input)

326− if continue

327− then go (input : acc) s'

328− else f s' (input : acc)

329− Finished s' n t -> do advance (size input - size t)

330− f s' (T.take n input : acc)

331−{-# INLINE scan_ #-}

332−

333−-- | A stateful scanner. The predicate consumes and transforms a

334−-- state argument, and each transformed state is passed to successive

335−-- invocations of the predicate on each character of the input until one

336−-- returns 'Nothing' or the input ends.

337−--

338−-- This parser does not fail. It will return an empty string if the

339−-- predicate returns 'Nothing' on the first character of input.

340−--

341−-- /Note/: Because this parser does not fail, do not use it with

342−-- combinators such as 'Control.Applicative.many', because such

343−-- parsers loop until a failure occurs. Careless use will thus result

344−-- in an infinite loop.

345−scan :: s -> (s -> Char -> Maybe s) -> Parser Text

346−scan = scan_ $ \_ chunks -> return $! concatReverse chunks

347−{-# INLINE scan #-}

348−

349−-- | Like 'scan', but generalized to return the final state of the

350−-- scanner.

351−runScanner :: s -> (s -> Char -> Maybe s) -> Parser (Text, s)

352−runScanner = scan_ $ \s xs -> let !sx = concatReverse xs in return (sx, s)

353−{-# INLINE runScanner #-}

354−

355-- | Consume input as long as the predicate returns 'True', and return

294-- | Consume input as long as the predicate returns 'True', and return

356-- the consumed input.

295-- the consumed input.

357--

296--

@@ -360,16 +299,13 @@ runScanner = scan_ $ \s xs -> let !sx = concatReverse xs in return (sx, s)

360-- 'True' or if there is no input left.

299-- 'True' or if there is no input left.

361takeWhile1 :: (Char -> Bool) -> Parser Text

300takeWhile1 :: (Char -> Bool) -> Parser Text

362takeWhile1 p = do

301takeWhile1 p = do

363− (`when` demandInput) =<< endOfChunk

302+ (`when` demandInput) =<< T.null <$> get

364− h <- T.takeWhile p <$> get

303+ (h,t) <- T.span p <$> get

365− let size' = size h

366− when (size' == 0) $ fail "takeWhile1"

304+ when (T.null h) $ fail "takeWhile1"

367− advance size'

305+ put t

368− eoc <- endOfChunk

306+ if T.null t

369− if eoc

307+ then (h<>) `fmap` takeWhile p

370− then takeWhileAcc p [h]

371 else return h

308 else return h

372−{-# INLINE takeWhile1 #-}

373

309

374-- | Match any character in a set.

310-- | Match any character in a set.

375--

311--

@@ -407,143 +343,60 @@ notChar :: Char -> Parser Char

407notChar c = satisfy (/= c) <?> "not " ++ show c

343notChar c = satisfy (/= c) <?> "not " ++ show c

408{-# INLINE notChar #-}

344{-# INLINE notChar #-}

409

345

410−-- | Match any character, to perform lookahead. Returns 'Nothing' if

346+-- | Match only if all input has been consumed.

411−-- end of input has been reached. Does not consume any input.

347+endOfInput :: Parser ()

412−--

348+endOfInput = T.Parser $ \i0 a0 m0 kf ks ->

413−-- /Note/: Because this parser does not fail, do not use it with

349+ if T.null (unI i0)

414−-- combinators such as 'Control.Applicative.many', because such

350+ then if m0 == Complete

415−-- parsers loop until a failure occurs. Careless use will thus result

351+ then ks i0 a0 m0 ()

416−-- in an infinite loop.

352+ else let kf' i1 a1 m1 _ _ = addS i0 a0 m0 i1 a1 m1 $

417−peekChar :: Parser (Maybe Char)

353+ \ i2 a2 m2 -> ks i2 a2 m2 ()

418−peekChar = T.Parser $ \t pos more _lose succ ->

354+ ks' i1 a1 m1 _ = addS i0 a0 m0 i1 a1 m1 $

419− case () of

355+ \ i2 a2 m2 -> kf i2 a2 m2 []

420− _| pos < lengthOf t ->

356+ "endOfInput"

421− let T.Iter !c _ = Buf.iter t (fromPos pos)

357+ in runParser demandInput i0 a0 m0 kf' ks'

422− in succ t pos more (Just c)

358+ else kf i0 a0 m0 [] "endOfInput"

423− | more == Complete ->

359+

424− succ t pos more Nothing

360+-- | Return an indication of whether the end of input has been

425− | otherwise ->

361+-- reached.

426− let succ' t' pos' more' =

362+atEnd :: Parser Bool

427− let T.Iter !c _ = Buf.iter t' (fromPos pos')

363+atEnd = not <$> wantInput

428− in succ t' pos' more' (Just c)

429− lose' t' pos' more' = succ t' pos' more' Nothing

430− in prompt t pos more lose' succ'

431−{-# INLINE peekChar #-}

432−

433−-- | Match any character, to perform lookahead. Does not consume any

434−-- input, but will fail if end of input has been reached.

435−peekChar' :: Parser Char

436−peekChar' = do

437− (_,s) <- ensure 1

438− return $! T.unsafeHead s

439−{-# INLINE peekChar' #-}

364+{-# INLINE atEnd #-}

440

365

441-- | Match either a single newline character @\'\\n\'@, or a carriage

366-- | Match either a single newline character @\'\\n\'@, or a carriage

442-- return followed by a newline character @\"\\r\\n\"@.

367-- return followed by a newline character @\"\\r\\n\"@.

443endOfLine :: Parser ()

368endOfLine :: Parser ()

444endOfLine = (char '\n' >> return ()) <|> (string "\r\n" >> return ())

369endOfLine = (char '\n' >> return ()) <|> (string "\r\n" >> return ())

445

370

371+--- | Name the parser, in case failure occurs.

372+(<?>) :: Parser a

373+ -> String -- ^ the name to use if parsing fails

374+ -> Parser a

375+p <?> msg0 = T.Parser $ \i0 a0 m0 kf ks ->

376+ let kf' i a m strs msg = kf i a m (msg0:strs) msg

377+ in runParser p i0 a0 m0 kf' ks

378+{-# INLINE (<?>) #-}

379+infix 0 <?>

380+

446-- | Terminal failure continuation.

381-- | Terminal failure continuation.

447failK :: Failure a

382failK :: Failure a

448−failK t (Pos pos) _more stack msg = Fail (Buf.dropWord16 pos t) stack msg

383+failK i0 _a0 _m0 stack msg = Fail (unI i0) stack msg

449{-# INLINE failK #-}

384{-# INLINE failK #-}

450

385

451-- | Terminal success continuation.

386-- | Terminal success continuation.

452successK :: Success a a

387successK :: Success a a

453−successK t (Pos pos) _more a = Done (Buf.dropWord16 pos t) a

388+successK i0 _a0 _m0 a = Done (unI i0) a

454{-# INLINE successK #-}

389{-# INLINE successK #-}

455

390

456-- | Run a parser.

391-- | Run a parser.

457parse :: Parser a -> Text -> Result a

392parse :: Parser a -> Text -> Result a

458−parse m s = runParser m (buffer s) 0 Incomplete failK successK

393+parse m s = runParser m (I s) (A T.empty) Incomplete failK successK

459{-# INLINE parse #-}

394{-# INLINE parse #-}

460

395

461-- | Run a parser that cannot be resupplied via a 'Partial' result.

396-- | Run a parser that cannot be resupplied via a 'Partial' result.

462−--

463−-- This function does not force a parser to consume all of its input.

464−-- Instead, any residual input will be discarded. To force a parser

465−-- to consume all of its input, use something like this:

466−--

467−-- @

468−--'parseOnly' (myParser 'Control.Applicative.<*' 'endOfInput')

469−-- @

470parseOnly :: Parser a -> Text -> Either String a

397parseOnly :: Parser a -> Text -> Either String a

471−parseOnly m s = case runParser m (buffer s) 0 Complete failK successK of

398+parseOnly m s = case runParser m (I s) (A T.empty) Complete failK successK of

472− Fail _ [] err -> Left err

473− Fail _ ctxs err -> Left (intercalate " > " ctxs ++ ": " ++ err)

399+ Fail _ _ err -> Left err

474− Done _ a -> Right a

400+ Done _ a -> Right a

475− _ -> error "parseOnly: impossible error!"

401+ _ -> error "parseOnly: impossible error!"

476{-# INLINE parseOnly #-}

402{-# INLINE parseOnly #-}

477−

478−get :: Parser Text

479−get = T.Parser $ \t pos more _lose succ ->

480− succ t pos more (Buf.dropWord16 (fromPos pos) t)

481−{-# INLINE get #-}

482−

483−endOfChunk :: Parser Bool

484−endOfChunk = T.Parser $ \t pos more _lose succ ->

485− succ t pos more (pos == lengthOf t)

486−{-# INLINE endOfChunk #-}

487−

488−inputSpansChunks :: Pos -> Parser Bool

489−inputSpansChunks i = T.Parser $ \t pos_ more _lose succ ->

490− let pos = pos_ + i

491− in if pos < lengthOf t || more == Complete

492− then succ t pos more False

493− else let lose' t' pos' more' = succ t' pos' more' False

494− succ' t' pos' more' = succ t' pos' more' True

495− in prompt t pos more lose' succ'

496−{-# INLINE inputSpansChunks #-}

497−

498−advance :: Pos -> Parser ()

499−advance n = T.Parser $ \t pos more _lose succ -> succ t (pos+n) more ()

500−{-# INLINE advance #-}

501−

502−ensureSuspended :: Int -> Buffer -> Pos -> More

503− -> Failure r -> Success (Pos, Text) r

504− -> Result r

505−ensureSuspended n t pos more lose succ =

506− runParser (demandInput >> go) t pos more lose succ

507− where go = T.Parser $ \t' pos' more' lose' succ' ->

508− case lengthAtLeast pos' n t' of

509− Just n' -> succ' t' pos' more' (n', substring pos n' t')

510− Nothing -> runParser (demandInput >> go) t' pos' more' lose' succ'

511−

512−-- | If at least @n@ elements of input are available, return the

513−-- current input, otherwise fail.

514−ensure :: Int -> Parser (Pos, Text)

515−ensure n = T.Parser $ \t pos more lose succ ->

516− case lengthAtLeast pos n t of

517− Just n' -> succ t pos more (n', substring pos n' t)

518− -- The uncommon case is kept out-of-line to reduce code size:

519− Nothing -> ensureSuspended n t pos more lose succ

520−{-# INLINE ensure #-}

521−

522−-- | Return both the result of a parse and the portion of the input

523−-- that was consumed while it was being parsed.

524−match :: Parser a -> Parser (Text, a)

525−match p = T.Parser $ \t pos more lose succ ->

526− let succ' t' pos' more' a = succ t' pos' more'

527− (substring pos (pos'-pos) t', a)

528− in runParser p t pos more lose succ'

529−

530−-- | Ensure that at least @n@ code points of input are available.

531−-- Returns the number of words consumed while traversing.

532−lengthAtLeast :: Pos -> Int -> Buffer -> Maybe Pos

533−lengthAtLeast pos n t = go 0 (fromPos pos)

534− where go i !p

535− | i == n = Just (Pos p - pos)

536− | p == len = Nothing

537− | otherwise = go (i+1) (p + Buf.iter_ t p)

538− Pos len = lengthOf t

539−{-# INLINE lengthAtLeast #-}

540−

541−substring :: Pos -> Pos -> Buffer -> Text

542−substring (Pos pos) (Pos n) = Buf.substring pos n

543−{-# INLINE substring #-}

544−

545−lengthOf :: Buffer -> Pos

546−lengthOf = Pos . Buf.length

547−

548−size :: Text -> Pos

549−size (Text _ _ l) = Pos l

Data/Attoparsec/Text/Lazy.hs+15−26

@@ -1,19 +1,13 @@

1−{-# LANGUAGE CPP #-}

2−#if __GLASGOW_HASKELL__ >= 702

3−{-# LANGUAGE Trustworthy #-} -- Imports internal modules

4−#endif

5−

6−{-# OPTIONS_GHC -fno-warn-warnings-deprecations #-}

7-- |

1-- |

8-- Module : Data.Attoparsec.Text.Lazy

2-- Module : Data.Attoparsec.Text.Lazy

9−-- Copyright : Bryan O'Sullivan 2007-2015

3+-- Copyright : Bryan O'Sullivan 2011

10-- License : BSD3

4-- License : BSD3

11−--

5+--

12-- Maintainer : bos@serpentine.com

6-- Maintainer : bos@serpentine.com

13-- Stability : experimental

7-- Stability : experimental

14-- Portability : unknown

8-- Portability : unknown

15--

9--

16−-- Simple, efficient combinator parsing that can consume lazy 'Text'

10+-- Simple, efficient combinator parsing for lazy 'Text'

17-- strings, loosely based on the Parsec library.

11-- strings, loosely based on the Parsec library.

18--

12--

19-- This is essentially the same code as in the 'Data.Attoparsec.Text'

13-- This is essentially the same code as in the 'Data.Attoparsec.Text'

@@ -22,11 +16,10 @@

22-- more input to be fed in. Think of this as suitable for use with a

16-- more input to be fed in. Think of this as suitable for use with a

23-- lazily read file, e.g. via 'L.readFile' or 'L.hGetContents'.

17-- lazily read file, e.g. via 'L.readFile' or 'L.hGetContents'.

24--

18--

25−-- /Note:/ The various parser functions and combinators such as

26−-- 'string' still expect /strict/ 'T.Text' parameters, and return

27−-- strict 'T.Text' results. Behind the scenes, strict 'T.Text' values

19+-- Behind the scenes, strict 'T.Text' values are still used

28−-- are still used internally to store parser input and manipulate it

20+-- internally to store parser input and manipulate it efficiently.

29−-- efficiently.

21+-- High-performance parsers such as 'string' still expect strict

22+-- 'T.Text' parameters.

30

23

31module Data.Attoparsec.Text.Lazy

24module Data.Attoparsec.Text.Lazy

32 (

25 (

@@ -40,8 +33,6 @@ module Data.Attoparsec.Text.Lazy

40 , eitherResult

33 , eitherResult

41 ) where

34 ) where

42

35

43−import Control.DeepSeq (NFData(rnf))

44−import Data.List (intercalate)

45import Data.Text.Lazy.Internal (Text(..), chunk)

36import Data.Text.Lazy.Internal (Text(..), chunk)

46import qualified Data.Attoparsec.Internal.Types as T

37import qualified Data.Attoparsec.Internal.Types as T

47import qualified Data.Attoparsec.Text as A

38import qualified Data.Attoparsec.Text as A

@@ -51,21 +42,20 @@ import Data.Attoparsec.Text hiding (IResult(..), Result, eitherResult,

51

42

52-- | The result of a parse.

43-- | The result of a parse.

53data Result r = Fail Text [String] String

44data Result r = Fail Text [String] String

54− -- ^ The parse failed. The 'Text' is the input

45+ -- ^ The parse failed. The 'ByteString' is the input

55 -- that had not yet been consumed when the failure

46 -- that had not yet been consumed when the failure

56 -- occurred. The @[@'String'@]@ is a list of contexts

47 -- occurred. The @[@'String'@]@ is a list of contexts

57 -- in which the error occurred. The 'String' is the

48 -- in which the error occurred. The 'String' is the

58 -- message describing the error, if any.

49 -- message describing the error, if any.

59 | Done Text r

50 | Done Text r

60− -- ^ The parse succeeded. The 'Text' is the

51+ -- ^ The parse succeeded. The 'ByteString' is the

61 -- input that had not yet been consumed (if any) when

52 -- input that had not yet been consumed (if any) when

62 -- the parse succeeded.

53 -- the parse succeeded.

63− deriving (Show)

64

54

65−instance NFData r => NFData (Result r) where

55+instance Show r => Show (Result r) where

66− rnf (Fail bs ctxs msg) = rnf bs `seq` rnf ctxs `seq` rnf msg

56+ show (Fail bs stk msg) =

67− rnf (Done bs r) = rnf bs `seq` rnf r

57+ "Fail " ++ show bs ++ " " ++ show stk ++ " " ++ show msg

68− {-# INLINE rnf #-}

58+ show (Done bs r) = "Done " ++ show bs ++ " " ++ show r

69

59

70fmapR :: (a -> b) -> Result a -> Result b

60fmapR :: (a -> b) -> Result a -> Result b

71fmapR _ (Fail st stk msg) = Fail st stk msg

61fmapR _ (Fail st stk msg) = Fail st stk msg

@@ -96,6 +86,5 @@ maybeResult _ = Nothing

96

86

97-- | Convert a 'Result' value to an 'Either' value.

87-- | Convert a 'Result' value to an 'Either' value.

98eitherResult :: Result r -> Either String r

88eitherResult :: Result r -> Either String r

99−eitherResult (Done _ r) = Right r

89+eitherResult (Done _ r) = Right r

100−eitherResult (Fail _ [] msg) = Left msg

90+eitherResult (Fail _ _ msg) = Left msg

101−eitherResult (Fail _ ctxs msg) = Left (intercalate " > " ctxs ++ ": " ++ msg)

Data/Attoparsec/Types.hs+2−3

@@ -1,6 +1,6 @@

1-- |

2-- Module : Data.Attoparsec.Types

3−-- Copyright : Bryan O'Sullivan 2007-2015

3+-- Copyright : Bryan O'Sullivan 2011

4-- License : BSD3

5--

6-- Maintainer : bos@serpentine.com

@@ -14,7 +14,6 @@ module Data.Attoparsec.Types

14 (

15 Parser

16 , IResult(..)

17− , Chunk(chunkElemToChar)

18 ) where

17 ) where

19

18

20−import Data.Attoparsec.Internal.Types (Parser(..), IResult(..), Chunk(..))

19+import Data.Attoparsec.Internal.Types (Parser(..), IResult(..))

Data/Attoparsec/Zepto.hs+47−89

@@ -1,14 +1,10 @@

1−{-# LANGUAGE CPP #-}

1+{-# LANGUAGE BangPatterns, MagicHash, UnboxedTuples #-}

2−#if __GLASGOW_HASKELL__ >= 702

3−{-# LANGUAGE Trustworthy #-} -- Data.ByteString.Unsafe

4−#endif

5−{-# LANGUAGE BangPatterns #-}

6

2

7-- |

3-- |

8-- Module : Data.Attoparsec.Zepto

4-- Module : Data.Attoparsec.Zepto

9−-- Copyright : Bryan O'Sullivan 2007-2015

5+-- Copyright : Bryan O'Sullivan 2011

10-- License : BSD3

6-- License : BSD3

11−--

7+--

12-- Maintainer : bos@serpentine.com

8-- Maintainer : bos@serpentine.com

13-- Stability : experimental

9-- Stability : experimental

14-- Portability : unknown

10-- Portability : unknown

@@ -16,150 +12,112 @@

16-- A tiny, highly specialized combinator parser for 'B.ByteString'

12-- A tiny, highly specialized combinator parser for 'B.ByteString'

17-- strings.

13-- strings.

18--

14--

19−-- While the main attoparsec module generally performs well, this

15+-- While the main Attoparsec module generally performs well, this

20-- module is particularly fast for simple non-recursive loops that

16-- module is particularly fast for simple non-recursive loops that

21-- should not normally result in failed parses.

17-- should not normally result in failed parses.

22--

18--

23-- /Warning/: on more complex inputs involving recursion or failure,

19-- /Warning/: on more complex inputs involving recursion or failure,

24-- parsers based on this module may be as much as /ten times slower/

20-- parsers based on this module may be as much as /ten times slower/

25−-- than regular attoparsec! You should /only/ use this module when you

21+-- than regular Attoparsec! You should /only/ use this module when you

26-- have benchmarks that prove that its use speeds your code up.

22-- have benchmarks that prove that its use speeds your code up.

27module Data.Attoparsec.Zepto

23module Data.Attoparsec.Zepto

28 (

24 (

29 Parser

25 Parser

30− , ZeptoT

31 , parse

26 , parse

32− , parseT

33 , atEnd

27 , atEnd

34 , string

28 , string

35 , take

29 , take

36 , takeWhile

30 , takeWhile

37 ) where

31 ) where

38

32

39−import Control.Applicative

40−import Control.Monad (MonadPlus(..), ap)

41−import qualified Control.Monad.Fail as Fail

42−import Control.Monad.IO.Class (MonadIO(..))

43−import Data.ByteString (ByteString)

44−import Data.Functor.Identity (Identity(runIdentity))

45−import Data.Monoid as Mon (Monoid(..))

46−import Data.Semigroup (Semigroup(..))

47import Data.Word (Word8)

33import Data.Word (Word8)

48−import Prelude hiding (take, takeWhile)

34+import Control.Applicative

35+import Control.Monad

36+import Data.Monoid

49import qualified Data.ByteString as B

37import qualified Data.ByteString as B

50import qualified Data.ByteString.Unsafe as B

38import qualified Data.ByteString.Unsafe as B

39+import Data.ByteString (ByteString)

40+import Prelude hiding (take, takeWhile)

51

41

52newtype S = S {

42newtype S = S {

53 input :: ByteString

43 input :: ByteString

54 }

44 }

55

45

56data Result a = Fail String

46data Result a = Fail String

57− | OK !a S

47+ | OK !a

58

48

59-- | A simple parser.

49-- | A simple parser.

60--

50--

61-- This monad is strict in its state, and the monadic bind operator

51-- This monad is strict in its state, and the monadic bind operator

62-- ('>>=') evaluates each result to weak head normal form before

52-- ('>>=') evaluates each result to weak head normal form before

63-- passing it along.

53-- passing it along.

64−newtype ZeptoT m a = Parser {

54+newtype Parser a = Parser {

65− runParser :: S -> m (Result a)

55+ runParser :: S -> (# Result a, S #)

66 }

56 }

67

57

68−type Parser a = ZeptoT Identity a

69−

70−instance Monad m => Functor (ZeptoT m) where

58+instance Functor Parser where

71− fmap f m = Parser $ \s -> do

59+ fmap f m = Parser $ \s -> case runParser m s of

72− result <- runParser m s

73− case result of

74− OK a s' -> return (OK (f a) s')

60+ (# OK a, s' #) -> (# OK (f a), s' #)

75− Fail err -> return (Fail err)

61+ (# Fail err, s' #) -> (# Fail err, s' #)

76 {-# INLINE fmap #-}

62 {-# INLINE fmap #-}

77

63

78−instance MonadIO m => MonadIO (ZeptoT m) where

64+instance Monad Parser where

79− liftIO act = Parser $ \s -> do

65+ return a = Parser $ \s -> (# OK a, s #)

80− result <- liftIO act

81− return (OK result s)

82− {-# INLINE liftIO #-}

83−

84−instance Monad m => Monad (ZeptoT m) where

85− return = pure

86 {-# INLINE return #-}

66 {-# INLINE return #-}

87

67

88− m >>= k = Parser $ \s -> do

68+ m >>= k = Parser $ \s -> case runParser m s of

89− result <- runParser m s

90− case result of

91− OK a s' -> runParser (k a) s'

69+ (# OK a, s' #) -> runParser (k a) s'

92− Fail err -> return (Fail err)

70+ (# Fail err, s' #) -> (# Fail err, s' #)

93 {-# INLINE (>>=) #-}

71 {-# INLINE (>>=) #-}

94

72

95−#if !(MIN_VERSION_base(4,13,0))

96− fail = Fail.fail

73+ fail msg = Parser $ \s -> (# Fail msg, s #)

97− {-# INLINE fail #-}

98−#endif

99

74

100−instance Monad m => Fail.MonadFail (ZeptoT m) where

101− fail msg = Parser $ \_ -> return (Fail msg)

102− {-# INLINE fail #-}

103−

104−instance Monad m => MonadPlus (ZeptoT m) where

75+instance MonadPlus Parser where

105 mzero = fail "mzero"

76 mzero = fail "mzero"

106 {-# INLINE mzero #-}

77 {-# INLINE mzero #-}

107

78

108− mplus a b = Parser $ \s -> do

79+ mplus a b = Parser $ \s ->

109− result <- runParser a s

80+ case runParser a s of

110− case result of

81+ (# ok@(OK _), s' #) -> (# ok, s' #)

82+ (# _, _ #) -> case runParser b s of

111− ok@(OK _ _) -> return ok

83+ (# ok@(OK _), s'' #) -> (# ok, s'' #)

112− _ -> runParser b s

84+ (# err, s'' #) -> (# err, s'' #)

113 {-# INLINE mplus #-}

85 {-# INLINE mplus #-}

114

86

115−instance (Monad m) => Applicative (ZeptoT m) where

87+instance Applicative Parser where

116− pure a = Parser $ \s -> return (OK a s)

88+ pure = return

117 {-# INLINE pure #-}

89 {-# INLINE pure #-}

118 (<*>) = ap

90 (<*>) = ap

119 {-# INLINE (<*>) #-}

91 {-# INLINE (<*>) #-}

120

92

121−gets :: Monad m => (S -> a) -> ZeptoT m a

93+gets :: (S -> a) -> Parser a

122−gets f = Parser $ \s -> return (OK (f s) s)

94+gets f = Parser $ \s -> (# OK (f s), s #)

123{-# INLINE gets #-}

95{-# INLINE gets #-}

124

96

125−put :: Monad m => S -> ZeptoT m ()

97+put :: S -> Parser ()

126−put s = Parser $ \_ -> return (OK () s)

98+put s = Parser $ \_ -> (# OK (), s #)

127{-# INLINE put #-}

99{-# INLINE put #-}

128

100

129-- | Run a parser.

101-- | Run a parser.

130parse :: Parser a -> ByteString -> Either String a

102parse :: Parser a -> ByteString -> Either String a

131−parse p bs = case runIdentity (runParser p (S bs)) of

103+parse p bs = case runParser p (S bs) of

132− (OK a _) -> Right a

104+ (# OK a, _ #) -> Right a

133− (Fail err) -> Left err

134−{-# INLINE parse #-}

135−

136−-- | Run a parser on top of the given base monad.

137−parseT :: Monad m => ZeptoT m a -> ByteString -> m (Either String a)

138−parseT p bs = do

139− result <- runParser p (S bs)

140− case result of

141− OK a _ -> return (Right a)

142− Fail err -> return (Left err)

105+ (# Fail err, _ #) -> Left err

143−{-# INLINE parseT #-}

106+

144−

107+instance Monoid (Parser a) where

145−instance Monad m => Semigroup (ZeptoT m a) where

146− (<>) = mplus

147− {-# INLINE (<>) #-}

148−

149−instance Monad m => Mon.Monoid (ZeptoT m a) where

150 mempty = fail "mempty"

108 mempty = fail "mempty"

151 {-# INLINE mempty #-}

109 {-# INLINE mempty #-}

152− mappend = (<>)

110+ mappend = mplus

153 {-# INLINE mappend #-}

111 {-# INLINE mappend #-}

154

112

155−instance Monad m => Alternative (ZeptoT m) where

113+instance Alternative Parser where

156 empty = fail "empty"

114 empty = fail "empty"

157 {-# INLINE empty #-}

115 {-# INLINE empty #-}

158 (<|>) = mplus

116 (<|>) = mplus

159 {-# INLINE (<|>) #-}

117 {-# INLINE (<|>) #-}

160

118

161-- | Consume input while the predicate returns 'True'.

119-- | Consume input while the predicate returns 'True'.

162−takeWhile :: Monad m => (Word8 -> Bool) -> ZeptoT m ByteString

120+takeWhile :: (Word8 -> Bool) -> Parser ByteString

163takeWhile p = do

121takeWhile p = do

164 (h,t) <- gets (B.span p . input)

122 (h,t) <- gets (B.span p . input)

165 put (S t)

123 put (S t)

@@ -167,7 +125,7 @@ takeWhile p = do

167{-# INLINE takeWhile #-}

125{-# INLINE takeWhile #-}

168

126

169-- | Consume @n@ bytes of input.

127-- | Consume @n@ bytes of input.

170−take :: Monad m => Int -> ZeptoT m ByteString

128+take :: Int -> Parser ByteString

171take !n = do

129take !n = do

172 s <- gets input

130 s <- gets input

173 if B.length s >= n

131 if B.length s >= n

@@ -176,7 +134,7 @@ take !n = do

176{-# INLINE take #-}

134{-# INLINE take #-}

177

135

178-- | Match a string exactly.

136-- | Match a string exactly.

179−string :: Monad m => ByteString -> ZeptoT m ()

137+string :: ByteString -> Parser ()

180string s = do

138string s = do

181 i <- gets input

139 i <- gets input

182 if s `B.isPrefixOf` i

140 if s `B.isPrefixOf` i

@@ -185,7 +143,7 @@ string s = do

185{-# INLINE string #-}

143{-# INLINE string #-}

186

144

187-- | Indicate whether the end of the input has been reached.

145-- | Indicate whether the end of the input has been reached.

188−atEnd :: Monad m => ZeptoT m Bool

146+atEnd :: Parser Bool

189atEnd = do

147atEnd = do

190 i <- gets input

148 i <- gets input

191 return $! B.null i

149 return $! B.null i

README.markdown+6

@@ -16,6 +16,12 @@ Master [git repository](https://github.com/bos/attoparsec):

16

17* `git clone git://github.com/bos/attoparsec.git`

18

19+There's also a [Mercurial mirror](https://bitbucket.org/bos/attoparsec):

20+

21+* `hg clone https://bitbucket.org/bos/attoparsec`

22+

23+(You can create and contribute changes using either Mercurial or git.)

24+

19Authors

25Authors

20-------

26-------

21

27

attoparsec.cabal+29−131

@@ -1,14 +1,13 @@

1name: attoparsec

2−version: 0.13.2.2

2+version: 0.10.0.0

3−x-revision: 3

4license: BSD3

3license: BSD3

5license-file: LICENSE

4license-file: LICENSE

6category: Text, Parsing

5category: Text, Parsing

7author: Bryan O'Sullivan <bos@serpentine.com>

6author: Bryan O'Sullivan <bos@serpentine.com>

8−maintainer: Bryan O'Sullivan <bos@serpentine.com>, Ben Gamari <ben@smart-cactus.org>

7+maintainer: Bryan O'Sullivan <bos@serpentine.com>

9stability: experimental

8stability: experimental

10−tested-with: GHC == 7.0.4, GHC == 7.2.2, GHC == 7.4.2, GHC ==7.6.3, GHC ==7.8.4, GHC ==7.10.3, GHC ==8.0.2, GHC ==8.2.2, GHC==8.4.4, GHC==8.6.5, GHC==8.8.1

9+tested-with: GHC == 6.12.3, GHC == 7.0.3, GHC == 7.2.1

11−synopsis: Fast combinator parsing for bytestrings and text

10+synopsis: Fast combinator parsing for bytestrings

12cabal-version: >= 1.8

11cabal-version: >= 1.8

13homepage: https://github.com/bos/attoparsec

12homepage: https://github.com/bos/attoparsec

14bug-reports: https://github.com/bos/attoparsec/issues

13bug-reports: https://github.com/bos/attoparsec/issues

@@ -19,176 +18,75 @@ description:

19 file formats.

18 file formats.

20extra-source-files:

19extra-source-files:

21 README.markdown

20 README.markdown

22− benchmarks/*.cabal

23− benchmarks/*.hs

24− benchmarks/*.txt

25− benchmarks/json-data/*.json

26 benchmarks/Makefile

21 benchmarks/Makefile

22+ benchmarks/Tiny.hs

27 benchmarks/med.txt.bz2

23 benchmarks/med.txt.bz2

28− changelog.md

24+ tests/Makefile

29− examples/*.c

25+ tests/QC.hs

30− examples/*.hs

26+ tests/QCSupport.hs

27+ tests/TestFastSet.hs

31 examples/Makefile

28 examples/Makefile

32− tests/*.hs

29+ examples/Parsec_RFC2616.hs

33− tests/QC/*.hs

30+ examples/RFC2616.hs

34− tests/QC/IPv6/*.hs

31+ examples/TestRFC2616.hs

32+ examples/rfc2616.c

35

33

36Flag developer

34Flag developer

37 Description: Whether to build the library in development mode

35 Description: Whether to build the library in development mode

38 Default: False

36 Default: False

39− Manual: True

40

37

41library

38library

42 build-depends: array,

39 build-depends: array,

43− base >= 4.3 && < 5,

40+ base >= 3 && < 5,

44 bytestring,

41 bytestring,

45 containers,

42 containers,

46 deepseq,

43 deepseq,

47− scientific >= 0.3.1 && < 0.4,

48− transformers >= 0.2 && (< 0.4 || >= 0.4.1.0) && < 0.6,

49− text >= 1.1.1.3

44+ text >= 0.11.1.5

50− if impl(ghc < 7.4)

51− build-depends:

52− bytestring < 0.10.4.0

53−

54− if !impl(ghc >= 8.0)

55− -- Data.Semigroup && Control.Monad.Fail are available in base-4.9+

56− build-depends: fail == 4.9.*,

57− semigroups >=0.16.1 && <0.20

58

45

46+ extensions: CPP

59 exposed-modules: Data.Attoparsec

47 exposed-modules: Data.Attoparsec

60 Data.Attoparsec.ByteString

48 Data.Attoparsec.ByteString

61 Data.Attoparsec.ByteString.Char8

49 Data.Attoparsec.ByteString.Char8

62 Data.Attoparsec.ByteString.Lazy

50 Data.Attoparsec.ByteString.Lazy

63 Data.Attoparsec.Char8

51 Data.Attoparsec.Char8

64 Data.Attoparsec.Combinator

52 Data.Attoparsec.Combinator

65− Data.Attoparsec.Internal

66− Data.Attoparsec.Internal.Types

67 Data.Attoparsec.Lazy

53 Data.Attoparsec.Lazy

68 Data.Attoparsec.Number

54 Data.Attoparsec.Number

69 Data.Attoparsec.Text

55 Data.Attoparsec.Text

70 Data.Attoparsec.Text.Lazy

56 Data.Attoparsec.Text.Lazy

71 Data.Attoparsec.Types

57 Data.Attoparsec.Types

72 Data.Attoparsec.Zepto

58 Data.Attoparsec.Zepto

73− other-modules: Data.Attoparsec.ByteString.Buffer

59+ other-modules: Data.Attoparsec.ByteString.FastSet

74− Data.Attoparsec.ByteString.FastSet

75 Data.Attoparsec.ByteString.Internal

60 Data.Attoparsec.ByteString.Internal

76− Data.Attoparsec.Internal.Fhthagn

61+ Data.Attoparsec.Internal.Types

77− Data.Attoparsec.Text.Buffer

78 Data.Attoparsec.Text.FastSet

62 Data.Attoparsec.Text.FastSet

79 Data.Attoparsec.Text.Internal

63 Data.Attoparsec.Text.Internal

80− ghc-options: -O2 -Wall

64+ ghc-options: -Wall

81

65

82 if flag(developer)

66 if flag(developer)

83 ghc-prof-options: -auto-all

67 ghc-prof-options: -auto-all

84− ghc-options: -Werror

85

68

86test-suite tests

69test-suite tests

87 type: exitcode-stdio-1.0

70 type: exitcode-stdio-1.0

88− hs-source-dirs: tests .

71+ hs-source-dirs: tests

89 main-is: QC.hs

72 main-is: QC.hs

90− other-modules: QC.Buffer

91− QC.ByteString

92− QC.Combinator

93− QC.Common

94− QC.IPv6.Internal

95− QC.IPv6.Types

96− QC.Rechunked

97− QC.Simple

98− QC.Text

99− QC.Text.FastSet

100− QC.Text.Regressions

101−

102− other-modules: Data.Attoparsec.ByteString

103− Data.Attoparsec.ByteString.Buffer

104− Data.Attoparsec.ByteString.Char8

105− Data.Attoparsec.ByteString.FastSet

106− Data.Attoparsec.ByteString.Internal

107− Data.Attoparsec.ByteString.Lazy

108− Data.Attoparsec.Combinator

109− Data.Attoparsec.Internal

110− Data.Attoparsec.Internal.Fhthagn

111− Data.Attoparsec.Internal.Types

112− Data.Attoparsec.Number

113− Data.Attoparsec.Text

114− Data.Attoparsec.Text.Buffer

115− Data.Attoparsec.Text.FastSet

116− Data.Attoparsec.Text.Internal

117− Data.Attoparsec.Text.Lazy

118− Data.Attoparsec.Zepto

119

73

120 ghc-options:

74 ghc-options:

121 -Wall -threaded -rtsopts

75 -Wall -threaded -rtsopts

122

76

123− if flag(developer)

124− ghc-options: -Werror

125−

126 build-depends:

77 build-depends:

127− array,

78+ attoparsec,

128− base,

79+ base >= 4 && < 5,

129 bytestring,

80 bytestring,

130− deepseq >= 1.1,

131− QuickCheck >= 2.13.2 && < 2.14,

81+ QuickCheck >= 2.4,

132− quickcheck-unicode,

82+ test-framework >= 0.4,

133− scientific,

83+ test-framework-quickcheck2 >= 0.2,

134− tasty >= 0.11,

135− tasty-quickcheck >= 0.8,

136− text,

137− transformers >= 0.2 && (< 0.4 || >= 0.4.1.0) && < 0.6,

138− vector

139−

140− if !impl(ghc >= 8.0)

141− -- Data.Semigroup && Control.Monad.Fail are available in base-4.9+

142− build-depends: fail == 4.9.*,

143− semigroups >=0.16.1 && <0.20

144−

145−benchmark benchmarks

146− type: exitcode-stdio-1.0

147− hs-source-dirs: benchmarks benchmarks/warp-3.0.1.1 .

148− ghc-options: -O2 -Wall -rtsopts

149− main-is: Benchmarks.hs

150− other-modules:

151− Common

152− HeadersByteString

153− HeadersByteString.Atto

154− HeadersText

155− Links

156− Network.Wai.Handler.Warp.ReadInt

157− Network.Wai.Handler.Warp.RequestHeader

158− Numbers

159− Sets

160− TextFastSet

161− Warp

162− ghc-options: -O2 -Wall

163−

164− if flag(developer)

165− ghc-options: -Werror

166−

167− build-depends:

168− array,

169− base == 4.*,

170− bytestring >= 0.10.4.0,

171− case-insensitive,

172− containers,

173− criterion >= 1.0,

174− deepseq >= 1.1,

175− directory,

176− filepath,

177− ghc-prim,

178− http-types,

179− parsec >= 3.1.2,

180− scientific,

181− text >= 1.1.1.0,

84+ text

182− transformers >= 0.2 && (< 0.4 || >= 0.4.1.0) && < 0.6,

183− unordered-containers,

184− vector

185−

186− if !impl(ghc >= 8.0)

187− -- Data.Semigroup && Control.Monad.Fail are available in base-4.9+

188− build-depends: fail == 4.9.*,

189− semigroups >=0.16.1 && <0.19

190

85

191source-repository head

86source-repository head

192 type: git

87 type: git

193 location: https://github.com/bos/attoparsec

88 location: https://github.com/bos/attoparsec

194

89

90+source-repository head

91+ type: mercurial

92+ location: https://bitbucket.org/bos/attoparsec

benchmarks/Aeson.hsdeleted−353

@@ -1,353 +0,0 @@

1−{-# LANGUAGE BangPatterns, CPP, OverloadedStrings #-}

2−{-# OPTIONS_GHC -fno-warn-unused-binds #-}

3−

4−module Aeson

5− (

6− aeson

7− , value'

8− ) where

9−

10−import Data.ByteString.Builder

11− (Builder, byteString, toLazyByteString, charUtf8, word8)

12−

13−#if !MIN_VERSION_base(4,8,0)

14−import Control.Applicative ((*>), (<$>), (<*), pure)

15−import Data.Monoid (mappend, mempty)

16−#endif

17−

18−import Common (pathTo)

19−import Control.Applicative (liftA2)

20−import Control.DeepSeq (NFData(..))

21−import Control.Monad (forM)

22−import Data.Attoparsec.ByteString.Char8 (Parser, char, endOfInput, scientific,

23− skipSpace, string)

24−import Data.Bits ((.|.), shiftL)

25−import Data.ByteString (ByteString)

26−import Data.Char (chr)

27−import Data.List (sort)

28−import Data.Scientific (Scientific)

29−import Data.Text (Text)

30−import Data.Text.Encoding (decodeUtf8')

31−import Data.Vector as Vector (Vector, foldl', fromList)

32−import Data.Word (Word8)

33−import System.Directory (getDirectoryContents)

34−import System.FilePath ((</>), dropExtension)

35−import qualified Data.Attoparsec.ByteString as A

36−import qualified Data.Attoparsec.Lazy as L

37−import qualified Data.Attoparsec.Zepto as Z

38−import qualified Data.ByteString as B

39−import qualified Data.ByteString.Lazy as L

40−import qualified Data.ByteString.Unsafe as B

41−import qualified Data.HashMap.Strict as H

42−import Criterion.Main

43−

44−#define BACKSLASH 92

45−#define CLOSE_CURLY 125

46−#define CLOSE_SQUARE 93

47−#define COMMA 44

48−#define DOUBLE_QUOTE 34

49−#define OPEN_CURLY 123

50−#define OPEN_SQUARE 91

51−#define C_0 48

52−#define C_9 57

53−#define C_A 65

54−#define C_F 70

55−#define C_a 97

56−#define C_f 102

57−#define C_n 110

58−#define C_t 116

59−

60−data Result a = Error String

61− | Success a

62− deriving (Eq, Show)

63−

64−

65−-- | A JSON \"object\" (key\/value map).

66−type Object = H.HashMap Text Value

67−

68−-- | A JSON \"array\" (sequence).

69−type Array = Vector Value

70−

71−-- | A JSON value represented as a Haskell value.

72−data Value = Object !Object

73− | Array !Array

74− | String !Text

75− | Number !Scientific

76− | Bool !Bool

77− | Null

78− deriving (Eq, Show)

79−

80−instance NFData Value where

81− rnf (Object o) = rnf o

82− rnf (Array a) = Vector.foldl' (\x y -> rnf y `seq` x) () a

83− rnf (String s) = rnf s

84− rnf (Number n) = rnf n

85− rnf (Bool b) = rnf b

86− rnf Null = ()

87−

88−-- | Parse a top-level JSON value. This must be either an object or

89−-- an array, per RFC 4627.

90−--

91−-- The conversion of a parsed value to a Haskell value is deferred

92−-- until the Haskell value is needed. This may improve performance if

93−-- only a subset of the results of conversions are needed, but at a

94−-- cost in thunk allocation.

95−json :: Parser Value

96−json = json_ object_ array_

97−

98−-- | Parse a top-level JSON value. This must be either an object or

99−-- an array, per RFC 4627.

100−--

101−-- This is a strict version of 'json' which avoids building up thunks

102−-- during parsing; it performs all conversions immediately. Prefer

103−-- this version if most of the JSON data needs to be accessed.

104−json' :: Parser Value

105−json' = json_ object_' array_'

106−

107−json_ :: Parser Value -> Parser Value -> Parser Value

108−json_ obj ary = do

109− w <- skipSpace *> A.satisfy (\w -> w == OPEN_CURLY || w == OPEN_SQUARE)

110− if w == OPEN_CURLY

111− then obj

112− else ary

113−{-# INLINE json_ #-}

114−

115−object_ :: Parser Value

116−object_ = {-# SCC "object_" #-} Object <$> objectValues jstring value

117−

118−object_' :: Parser Value

119−object_' = {-# SCC "object_'" #-} do

120− !vals <- objectValues jstring' value'

121− return (Object vals)

122− where

123− jstring' = do

124− !s <- jstring

125− return s

126−

127−objectValues :: Parser Text -> Parser Value -> Parser (H.HashMap Text Value)

128−objectValues str val = do

129− skipSpace

130− let pair = liftA2 (,) (str <* skipSpace) (char ':' *> skipSpace *> val)

131− H.fromList <$> commaSeparated pair CLOSE_CURLY

132−{-# INLINE objectValues #-}

133−

134−array_ :: Parser Value

135−array_ = {-# SCC "array_" #-} Array <$> arrayValues value

136−

137−array_' :: Parser Value

138−array_' = {-# SCC "array_'" #-} do

139− !vals <- arrayValues value'

140− return (Array vals)

141−

142−commaSeparated :: Parser a -> Word8 -> Parser [a]

143−commaSeparated item endByte = do

144− w <- A.peekWord8'

145− if w == endByte

146− then A.anyWord8 >> return []

147− else loop

148− where

149− loop = do

150− v <- item <* skipSpace

151− ch <- A.satisfy $ \w -> w == COMMA || w == endByte

152− if ch == COMMA

153− then skipSpace >> (v:) <$> loop

154− else return [v]

155−{-# INLINE commaSeparated #-}

156−

157−arrayValues :: Parser Value -> Parser (Vector Value)

158−arrayValues val = do

159− skipSpace

160− Vector.fromList <$> commaSeparated val CLOSE_SQUARE

161−{-# INLINE arrayValues #-}

162−

163−-- | Parse any JSON value. You should usually 'json' in preference to

164−-- this function, as this function relaxes the object-or-array

165−-- requirement of RFC 4627.

166−--

167−-- In particular, be careful in using this function if you think your

168−-- code might interoperate with Javascript. A naïve Javascript

169−-- library that parses JSON data using @eval@ is vulnerable to attack

170−-- unless the encoded data represents an object or an array. JSON

171−-- implementations in other languages conform to that same restriction

172−-- to preserve interoperability and security.

173−value :: Parser Value

174−value = do

175− w <- A.peekWord8'

176− case w of

177− DOUBLE_QUOTE -> A.anyWord8 *> (String <$> jstring_)

178− OPEN_CURLY -> A.anyWord8 *> object_

179− OPEN_SQUARE -> A.anyWord8 *> array_

180− C_f -> string "false" *> pure (Bool False)

181− C_t -> string "true" *> pure (Bool True)

182− C_n -> string "null" *> pure Null

183− _ | w >= 48 && w <= 57 || w == 45

184− -> Number <$> scientific

185− | otherwise -> fail "not a valid json value"

186−

187−-- | Strict version of 'value'. See also 'json''.

188−value' :: Parser Value

189−value' = do

190− w <- A.peekWord8'

191− case w of

192− DOUBLE_QUOTE -> do

193− !s <- A.anyWord8 *> jstring_

194− return (String s)

195− OPEN_CURLY -> A.anyWord8 *> object_'

196− OPEN_SQUARE -> A.anyWord8 *> array_'

197− C_f -> string "false" *> pure (Bool False)

198− C_t -> string "true" *> pure (Bool True)

199− C_n -> string "null" *> pure Null

200− _ | w >= 48 && w <= 57 || w == 45

201− -> do

202− !n <- scientific

203− return (Number n)

204− | otherwise -> fail "not a valid json value"

205−

206−-- | Parse a quoted JSON string.

207−jstring :: Parser Text

208−jstring = A.word8 DOUBLE_QUOTE *> jstring_

209−

210−-- | Parse a string without a leading quote.

211−jstring_ :: Parser Text

212−jstring_ = {-# SCC "jstring_" #-} do

213− s <- A.scan False $ \s c -> if s then Just False

214− else if c == DOUBLE_QUOTE

215− then Nothing

216− else Just (c == BACKSLASH)

217− _ <- A.word8 DOUBLE_QUOTE

218− s1 <- if BACKSLASH `B.elem` s

219− then case Z.parse unescape s of

220− Right r -> return r

221− Left err -> fail err

222− else return s

223−

224− case decodeUtf8' s1 of

225− Right r -> return r

226− Left err -> fail $ show err

227−

228−{-# INLINE jstring_ #-}

229−

230−unescape :: Z.Parser ByteString

231−unescape = toByteString <$> go mempty where

232− go acc = do

233− h <- Z.takeWhile (/=BACKSLASH)

234− let rest = do

235− start <- Z.take 2

236− let !slash = B.unsafeHead start

237− !t = B.unsafeIndex start 1

238− escape = case B.findIndex (==t) "\"\\/ntbrfu" of

239− Just i -> i

240− _ -> 255

241− if slash /= BACKSLASH || escape == 255

242− then fail "invalid JSON escape sequence"

243− else do

244− let cont m = go (acc `mappend` byteString h `mappend` m)

245− {-# INLINE cont #-}

246− if t /= 117 -- 'u'

247− then cont (word8 (B.unsafeIndex mapping escape))

248− else do

249− a <- hexQuad

250− if a < 0xd800 || a > 0xdfff

251− then cont (charUtf8 (chr a))

252− else do

253− b <- Z.string "\\u" *> hexQuad

254− if a <= 0xdbff && b >= 0xdc00 && b <= 0xdfff

255− then let !c = ((a - 0xd800) `shiftL` 10) +

256− (b - 0xdc00) + 0x10000

257− in cont (charUtf8 (chr c))

258− else fail "invalid UTF-16 surrogates"

259− done <- Z.atEnd

260− if done

261− then return (acc `mappend` byteString h)

262− else rest

263− mapping = "\"\\/\n\t\b\r\f"

264−

265−hexQuad :: Z.Parser Int

266−hexQuad = do

267− s <- Z.take 4

268− let hex n | w >= C_0 && w <= C_9 = w - C_0

269− | w >= C_a && w <= C_f = w - 87

270− | w >= C_A && w <= C_F = w - 55

271− | otherwise = 255

272− where w = fromIntegral $ B.unsafeIndex s n

273− a = hex 0; b = hex 1; c = hex 2; d = hex 3

274− if (a .|. b .|. c .|. d) /= 255

275− then return $! d .|. (c `shiftL` 4) .|. (b `shiftL` 8) .|. (a `shiftL` 12)

276− else fail "invalid hex escape"

277−

278−decodeWith :: Parser Value -> (Value -> Result a) -> L.ByteString -> Maybe a

279−decodeWith p to s =

280− case L.parse p s of

281− L.Done _ v -> case to v of

282− Success a -> Just a

283− _ -> Nothing

284− _ -> Nothing

285−{-# INLINE decodeWith #-}

286−

287−decodeStrictWith :: Parser Value -> (Value -> Result a) -> B.ByteString

288− -> Maybe a

289−decodeStrictWith p to s =

290− case either Error to (A.parseOnly p s) of

291− Success a -> Just a

292− Error _ -> Nothing

293−{-# INLINE decodeStrictWith #-}

294−

295−eitherDecodeWith :: Parser Value -> (Value -> Result a) -> L.ByteString

296− -> Either String a

297−eitherDecodeWith p to s =

298− case L.parse p s of

299− L.Done _ v -> case to v of

300− Success a -> Right a

301− Error msg -> Left msg

302− L.Fail _ _ msg -> Left msg

303−{-# INLINE eitherDecodeWith #-}

304−

305−eitherDecodeStrictWith :: Parser Value -> (Value -> Result a) -> B.ByteString

306− -> Either String a

307−eitherDecodeStrictWith p to s =

308− case either Error to (A.parseOnly p s) of

309− Success a -> Right a

310− Error msg -> Left msg

311−{-# INLINE eitherDecodeStrictWith #-}

312−

313−-- $lazy

314−--

315−-- The 'json' and 'value' parsers decouple identification from

316−-- conversion. Identification occurs immediately (so that an invalid

317−-- JSON document can be rejected as early as possible), but conversion

318−-- to a Haskell value is deferred until that value is needed.

319−--

320−-- This decoupling can be time-efficient if only a smallish subset of

321−-- elements in a JSON value need to be inspected, since the cost of

322−-- conversion is zero for uninspected elements. The trade off is an

323−-- increase in memory usage, due to allocation of thunks for values

324−-- that have not yet been converted.

325−

326−-- $strict

327−--

328−-- The 'json'' and 'value'' parsers combine identification with

329−-- conversion. They consume more CPU cycles up front, but have a

330−-- smaller memory footprint.

331−

332−-- | Parse a top-level JSON value followed by optional whitespace and

333−-- end-of-input. See also: 'json'.

334−jsonEOF :: Parser Value

335−jsonEOF = json <* skipSpace <* endOfInput

336−

337−-- | Parse a top-level JSON value followed by optional whitespace and

338−-- end-of-input. See also: 'json''.

339−jsonEOF' :: Parser Value

340−jsonEOF' = json' <* skipSpace <* endOfInput

341−

342−toByteString :: Builder -> ByteString

343−toByteString = L.toStrict . toLazyByteString

344−{-# INLINE toByteString #-}

345−

346−aeson :: IO Benchmark

347−aeson = do

348− path <- pathTo "json-data"

349− names <- sort . filter (`notElem` [".", ".."]) <$> getDirectoryContents path

350− benches <- forM names $ \name -> do

351− bs <- B.readFile (path </> name)

352− return . bench (dropExtension name) $ nf (A.parseOnly jsonEOF') bs

353− return $ bgroup "aeson" benches

benchmarks/Alternative.hsdeleted−20

@@ -1,20 +0,0 @@

1−{-# LANGUAGE OverloadedStrings #-}

2−

3−-- This benchmark reveals a huge performance regression that showed up

4−-- under GHC 7.8.1 (https://github.com/bos/attoparsec/issues/56).

5−--

6−-- With GHC 7.6.3 and older, this program runs in 0.04 seconds. Under

7−-- GHC 7.8.1 with (<|>) inlined, time jumps to 12 seconds!

8−

9−import Control.Applicative

10−import Data.Text (Text)

11−import qualified Data.Attoparsec.Text as A

12−import qualified Data.Text as T

13−

14−testParser :: Text -> Either String Int

15−testParser f = fmap length -- avoid printing out the entire matched list

16− . A.parseOnly (many ((() <$ A.string "b") <|> (() <$ A.anyChar)))

17− $ f

18−

19−main :: IO ()

20−main = print . testParser $ T.replicate 50000 "a"

benchmarks/Benchmarks.hsdeleted−126

@@ -1,126 +0,0 @@

1−{-# LANGUAGE BangPatterns, CPP #-}

2−

3−import Common ()

4−import Control.Applicative (many)

5−import Criterion.Main (bench, bgroup, defaultMain, nf)

6−import Data.Bits

7−import Data.Char (isAlpha)

8−import Data.Word (Word32)

9−import Data.Word (Word8)

10−import Numbers (numbers)

11−import Common (chunksOf)

12−import Text.Parsec.Text ()

13−import Text.Parsec.Text.Lazy ()

14−import qualified Warp

15−import qualified Aeson

16−import qualified Genome

17−import qualified Data.Attoparsec.ByteString as AB

18−import qualified Data.Attoparsec.ByteString.Char8 as AC

19−import qualified Data.Attoparsec.ByteString.Lazy as ABL

20−import qualified Data.Attoparsec.Text as AT

21−import qualified Data.Attoparsec.Text.Lazy as ATL

22−import qualified Data.ByteString as B

23−import qualified Data.ByteString.Char8 as BC

24−import qualified Data.ByteString.Lazy as BL

25−import qualified Data.Text as T

26−import qualified Data.Text.Lazy as TL

27−import qualified HeadersByteString

28−import qualified HeadersText

29−import qualified Links

30−import qualified Text.Parsec as P

31−import qualified Sets

32−

33−main :: IO ()

34−main = do

35− let s = take 1024 . cycle $ ['a'..'z'] ++ ['A'..'Z']

36− !b = BC.pack s

37− !bl = BL.fromChunks . map BC.pack . chunksOf 4 $ s

38− !t = T.pack s

39− !tl = TL.fromChunks . map T.pack . chunksOf 4 $ s

40− aeson <- Aeson.aeson

41− headersBS <- HeadersByteString.headers

42− headersT <- HeadersText.headers

43− defaultMain [

44− bgroup "many" [

45− bgroup "attoparsec" [

46− bench "B" $ nf (AB.parse (many (AC.satisfy AC.isAlpha_ascii))) b

47− , bench "BL" $ nf (ABL.parse (many (AC.satisfy AC.isAlpha_ascii))) bl

48− , bench "T" $ nf (AT.parse (many (AT.satisfy AC.isAlpha_ascii))) t

49− , bench "TL" $ nf (ATL.parse (many (AT.satisfy AC.isAlpha_ascii))) tl

50− ]

51− , bgroup "parsec" [

52− bench "S" $ nf (P.parse (many (P.satisfy AC.isAlpha_ascii)) "") s

53− , bench "B" $ nf (P.parse (many (P.satisfy AC.isAlpha_ascii)) "") b

54− , bench "BL" $ nf (P.parse (many (P.satisfy AC.isAlpha_ascii)) "") bl

55− , bench "T" $ nf (P.parse (many (P.satisfy AC.isAlpha_ascii)) "") t

56− , bench "TL" $ nf (P.parse (many (P.satisfy AC.isAlpha_ascii)) "") tl

57− ]

58− ]

59− , bgroup "comparison" [

60− bgroup "many-vs-takeWhile" [

61− bench "many" $ nf (AB.parse (many (AC.satisfy AC.isAlpha_ascii))) b

62− , bench "takeWhile" $ nf (AB.parse (AC.takeWhile AC.isAlpha_ascii)) b

63− ]

64− , bgroup "letter-vs-isAlpha" [

65− bench "letter" $ nf (AB.parse (many AC.letter_ascii)) b

66− , bench "isAlpha" $ nf (AB.parse (many (AC.satisfy AC.isAlpha_ascii))) b

67− ]

68− ]

69− , bgroup "takeWhile" [

70− bench "isAlpha" $ nf (ABL.parse (AC.takeWhile isAlpha)) bl

71− , bench "isAlpha_ascii" $ nf (ABL.parse (AC.takeWhile AC.isAlpha_ascii)) bl

72− , bench "isAlpha_iso8859_15" $

73− nf (ABL.parse (AC.takeWhile AC.isAlpha_iso8859_15)) bl

74− , bench "T isAlpha" $ nf (AT.parse (AT.takeWhile isAlpha)) t

75− , bench "TL isAlpha" $ nf (ATL.parse (AT.takeWhile isAlpha)) tl

76− ]

77− , bgroup "takeWhile1" [

78− bench "isAlpha" $ nf (ABL.parse (AC.takeWhile1 isAlpha)) bl

79− , bench "isAlpha_ascii" $ nf (ABL.parse (AC.takeWhile1 AC.isAlpha_ascii)) bl

80− , bench "T isAlpha" $ nf (AT.parse (AT.takeWhile1 isAlpha)) t

81− , bench "TL isAlpha" $ nf (ATL.parse (AT.takeWhile1 isAlpha)) tl

82− ]

83− , bench "word32LE" $ nf (AB.parse word32LE) b

84− , bgroup "scan" [

85− bench "short" $ nf (AB.parse quotedString) (BC.pack "abcdefghijk\"")

86− , bench "long" $ nf (AB.parse quotedString) b

87− ]

88− , aeson

89− , Genome.genome

90− , headersBS

91− , headersT

92− , Links.links

93− , numbers

94− , Sets.benchmarks

95− , Warp.benchmarks

96− ]

97−

98−-- Benchmarks bind and (potential) bounds-check merging.

99−word32LE :: AB.Parser Word32

100−word32LE = do

101− w1 <- AB.anyWord8

102− w2 <- AB.anyWord8

103− w3 <- AB.anyWord8

104− w4 <- AB.anyWord8

105− return $! (fromIntegral w1 :: Word32) +

106− fromIntegral w2 `unsafeShiftL` 8 +

107− fromIntegral w3 `unsafeShiftL` 16 +

108− fromIntegral w4 `unsafeShiftL` 32

109−

110−doubleQuote, backslash :: Word8

111−doubleQuote = 34

112−backslash = 92

113−{-# INLINE backslash #-}

114−{-# INLINE doubleQuote #-}

115−

116−-- | Parse a string without a leading quote.

117−quotedString :: AB.Parser B.ByteString

118−quotedString = AB.scan False $ \s c -> if s then Just False

119− else if c == doubleQuote

120− then Nothing

121− else Just (c == backslash)

122−

123−#if !MIN_VERSION_base(4,5,0)

124−unsafeShiftL :: Bits a => a -> Int -> a

125−unsafeShiftL = shiftL

126−#endif

benchmarks/Common.hsdeleted−47

@@ -1,47 +0,0 @@

1−{-# LANGUAGE CPP #-}

2−{-# OPTIONS_GHC -fno-warn-orphans #-}

3−

4−module Common (

5− chunksOf

6− , pathTo

7− , rechunkBS

8− , rechunkT

9− ) where

10−

11−import Control.DeepSeq (NFData(rnf))

12−import System.Directory (doesDirectoryExist)

13−import System.FilePath ((</>))

14−import Text.Parsec (ParseError)

15−import qualified Data.ByteString as B

16−import qualified Data.ByteString.Lazy as BL

17−import qualified Data.Text as T

18−import qualified Data.Text.Lazy as TL

19−

20−#if !MIN_VERSION_bytestring(0,10,0)

21−import Data.ByteString.Internal (ByteString(..))

22−

23−instance NFData ByteString where

24− rnf (PS _ _ _) = ()

25−#endif

26−

27−instance NFData ParseError where

28− rnf = rnf . show

29−

30−chunksOf :: Int -> [a] -> [[a]]

31−chunksOf k = go

32− where go xs = case splitAt k xs of

33− ([],_) -> []

34− (y, ys) -> y : go ys

35−

36−rechunkBS :: Int -> B.ByteString -> BL.ByteString

37−rechunkBS n = BL.fromChunks . map B.pack . chunksOf n . B.unpack

38−

39−rechunkT :: Int -> T.Text -> TL.Text

40−rechunkT n = TL.fromChunks . map T.pack . chunksOf n . T.unpack

41−

42−pathTo :: String -> IO FilePath

43−pathTo wat = do

44− exists <- doesDirectoryExist "benchmarks"

45− return $ if exists

46− then "benchmarks" </> wat

47− else wat

benchmarks/Genome.hsdeleted−75

@@ -1,75 +0,0 @@

1−{-# LANGUAGE OverloadedStrings #-}

2−

3−module Genome

4− (

5− genome

6− ) where

7−

8−import Control.Applicative

9−import Criterion.Main

10−import Data.ByteString (ByteString)

11−import qualified Data.ByteString.Char8 as B8

12−import qualified Data.ByteString.Lazy.Char8 as L8

13−import Data.Attoparsec.ByteString.Char8 as B

14−import qualified Data.Attoparsec.ByteString.Lazy as BL

15−import Data.Text (Text)

16−import qualified Data.Text as T

17−import qualified Data.Text.Lazy as TL

18−import Data.Attoparsec.Text as T

19−import qualified Data.Attoparsec.Text.Lazy as TL

20−import Common (rechunkBS, rechunkT)

21−

22−genome :: Benchmark

23−genome = bgroup "genome" [

24− bgroup "bytestring" [

25− bench "s" $ nf (map (B.parse searchBS)) (B8.tails geneB)

26− , bench "l" $ nf (map (BL.parse searchBS)) (L8.tails geneBL)

27− , bgroup "CI" [

28− bench "s" $ nf (map (B.parse searchBSCI)) (B8.tails geneB)

29− , bench "l" $ nf (map (BL.parse searchBSCI)) (L8.tails geneBL)

30− ]

31− ]

32− , bgroup "text" [

33− bench "s" $ nf (map (T.parse searchT)) (T.tails geneT)

34− , bench "l" $ nf (map (TL.parse searchT)) (TL.tails geneTL)

35− , bgroup "CI" [

36− bench "s" $ nf (map (T.parse searchTCI)) (T.tails geneT)

37− , bench "l" $ nf (map (TL.parse searchTCI)) (TL.tails geneTL)

38− ]

39− ]

40− ]

41− where geneB = B8.pack gene

42− geneBL = rechunkBS 4 geneB

43− geneT = T.pack gene

44− geneTL = rechunkT 4 geneT

45−

46−searchBS :: B.Parser ByteString

47−searchBS = "caac" *> ("aaca" <|> "aact")

48−

49−searchBSCI :: B.Parser ByteString

50−searchBSCI = B.stringCI "CAAC" *> (B.stringCI "AACA" <|> B.stringCI "AACT")

51−

52−searchT :: T.Parser Text

53−searchT = "caac" *> ("aaca" <|> "aact")

54−

55−searchTCI :: T.Parser Text

56−searchTCI = T.asciiCI "CAAC" *> (T.asciiCI "AACA" <|> T.asciiCI "AACT")

57−

58−-- Dictyostelium discoideum developmental protein DG1094 (gacT) gene,

59−-- partial cds. http://www.ncbi.nlm.nih.gov/nuccore/AF081586.1

60−

61−gene :: String

62−gene = "atcgatttagaaagatacaaagatagaaccatcaataataaacaagagaagagagcaagt\

63− \agagatattaataaagagattgaaagagagattgaaaagaagagattatcaccaagagaa\

64− \agattaaatttatttggtctttcttcctcatcttcatcagtgaattcaacattaacaaga\

65− \tctacagcaaatattatctctacaatagacggtagtggaggtagtaatcgtaatagtaaa\

66− \aattatggtaatggctcatcctcctcctcaaatagaagatatagtaatactattaatcaa\

67− \caattacaaatgcaattacaacaacttcaaatccaacaacaacaatatcaacaaactcaa\

68− \caatctcaaataccattacaatatcaacaacaacaacagcaacaacaacaacaaaccact\

69− \acaactacaactacatcaagtggtagtaatagattctcttcaaatagatataaaccagtt\

70− \gatcttacacaatcatcttcaaactttcgttattcacgtgaaatttatgatgatgattat\

71− \tattcaaataataatttaatgatgtttggtaatgagcaaccaaatcaaacaccaatttct\

72− \gtatcatcttcatctgcattcacacgtcaaagatctcaaagttgctttgaaccagagaat\

73− \cttgtattgctacaacaacaatatcaacaatatcaacaacaacaacaacaacaacaacaa\

74− \attccattccaagcaaatccacaatatagtaatgctgttattgaacaaaaattggatcaa\

75− \attagagataccattaataatttacatagagataaccgagtctctaga"

benchmarks/HeadersByteString.hsdeleted−37

@@ -1,37 +0,0 @@

1−module HeadersByteString (headers) where

2−

3−import Common (pathTo, rechunkBS)

4−import Criterion.Main (bench, bgroup, nf, nfIO)

5−import Criterion.Types (Benchmark)

6−import HeadersByteString.Atto (request, response)

7−import Network.Wai.Handler.Warp.RequestHeader (parseHeaderLines)

8−import qualified Data.Attoparsec.ByteString.Char8 as B

9−import qualified Data.Attoparsec.ByteString.Lazy as BL

10−import qualified Data.ByteString.Char8 as B

11−

12−-- Note: In the benchmarks for parsing an http request

13−-- from a strict bytestring, we consider warp's implementation,

14−-- which has highly optimized code for handling the first

15−-- line in particular. It's treatment of the headers

16−-- is more relaxed from the treatment they are given by the

17−-- attoparsec parser benchmarked here. Consequently, it

18−-- is should not be possible to match its performance since

19−-- it accepts header names with disallowed characters.

20−

21−headers :: IO Benchmark

22−headers = do

23− req <- B.readFile =<< pathTo "http-request.txt"

24− resp <- B.readFile =<< pathTo "http-response.txt"

25− let reql = rechunkBS 4 req

26− respl = rechunkBS 4 resp

27− return $ bgroup "headers" [

28− bgroup "B" [

29− bench "request" $ nf (B.parseOnly request) req

30− , bench "warp" $ nfIO (parseHeaderLines (B.split '\n' req))

31− , bench "response" $ nf (B.parseOnly response) resp

32− ]

33− , bgroup "BL" [

34− bench "request" $ nf (BL.parse request) reql

35− , bench "response" $ nf (BL.parse response) respl

36− ]

37− ]

benchmarks/HeadersByteString/Atto.hsdeleted−57

@@ -1,57 +0,0 @@

1−{-# LANGUAGE BangPatterns, OverloadedStrings #-}

2−{-# OPTIONS_GHC -fno-warn-missing-signatures -fno-warn-orphans #-}

3−module HeadersByteString.Atto

4− (

5− request

6− , response

7− ) where

8−

9−import Control.Applicative

10−import Control.DeepSeq (NFData(..))

11−import Network.HTTP.Types.Version (HttpVersion, http11)

12−import qualified Data.Attoparsec.ByteString.Char8 as B

13−import qualified Data.ByteString.Char8 as B

14−

15−instance NFData HttpVersion where

16− rnf !_ = ()

17−

18−isHeaderChar :: Char -> Bool

19−isHeaderChar c =

20− (c >= 'a' && c <= 'z') ||

21− (c >= 'A' && c <= 'Z') ||

22− (c >= '0' && c <= '9') ||

23− (c == '_') ||

24− (c == '-')

25−

26−header = do

27− name <- B.takeWhile1 isHeaderChar <* B.char ':' <* B.skipSpace

28− body <- bodyLine

29− return (name, body)

30−

31−bodyLine = B.takeTill (\c -> c == '\r' || c == '\n') <* B.endOfLine

32−

33−requestLine = do

34− m <- (B.takeTill B.isSpace <* B.char ' ')

35− (p,q) <- B.break (=='?') <$> (B.takeTill B.isSpace <* B.char ' ')

36− v <- httpVersion

37− return (m,p,q,v)

38−

39−httpVersion = http11 <$ "HTTP/1.1"

40−

41−responseLine = (,,) <$>

42− (httpVersion <* B.skipSpace) <*>

43− (int <* B.skipSpace) <*>

44− bodyLine

45−

46−int :: B.Parser Int

47−int = B.decimal

48−

49−request = (,) <$> (requestLine <* B.endOfLine) <*> manyheader

50−

51−response = (,) <$> responseLine <*> many header

52−

53−manyheader = do

54− c <- B.peekChar'

55− if c == '\r' || c == '\n'

56− then return []

57− else (:) <$> header <*> manyheader

benchmarks/HeadersText.hsdeleted−57

@@ -1,57 +0,0 @@

1−{-# LANGUAGE OverloadedStrings #-}

2−{-# OPTIONS_GHC -fno-warn-missing-signatures #-}

3−module HeadersText (headers) where

4−

5−import Common (pathTo, rechunkT)

6−import Control.Applicative

7−import Criterion.Main (bench, bgroup, nf)

8−import Criterion.Types (Benchmark)

9−import Data.Char (isSpace)

10−import qualified Data.Attoparsec.Text as T

11−import qualified Data.Attoparsec.Text.Lazy as TL

12−import qualified Data.Text.IO as T

13−

14−header = do

15− name <- T.takeWhile1 (T.inClass "a-zA-Z0-9_-") <* T.char ':' <* T.skipSpace

16− body <- (:) <$> bodyLine <*> many (T.takeWhile1 isSpace *> bodyLine)

17− return (name, body)

18−

19−bodyLine = T.takeTill (\c -> c == '\r' || c == '\n') <* T.endOfLine

20−

21−requestLine =

22− (,,) <$>

23− (method <* T.skipSpace) <*>

24− (T.takeTill isSpace <* T.skipSpace) <*>

25− httpVersion

26− where method = "GET" <|> "POST"

27−

28−httpVersion = "HTTP/" *> ((,) <$> (int <* T.char '.') <*> int)

29−

30−responseLine = (,,) <$>

31− (httpVersion <* T.skipSpace) <*>

32− (int <* T.skipSpace) <*>

33− bodyLine

34−

35−int :: T.Parser Int

36−int = T.decimal

37−

38−request = (,) <$> (requestLine <* T.endOfLine) <*> many header

39−

40−response = (,) <$> responseLine <*> many header

41−

42−headers :: IO Benchmark

43−headers = do

44− req <- T.readFile =<< pathTo "http-request.txt"

45− resp <- T.readFile =<< pathTo "http-response.txt"

46− let reql = rechunkT 4 req

47− respl = rechunkT 4 resp

48− return $ bgroup "headers" [

49− bgroup "T" [

50− bench "request" $ nf (T.parseOnly request) req

51− , bench "response" $ nf (T.parseOnly response) resp

52− ]

53− , bgroup "TL" [

54− bench "request" $ nf (TL.parse request) reql

55− , bench "response" $ nf (TL.parse response) respl

56− ]

57− ]

benchmarks/Links.hsdeleted−63

@@ -1,63 +0,0 @@

1−{-# LANGUAGE OverloadedStrings #-}

2−

3−module Links (links) where

4−

5−import Control.Applicative

6−import Control.DeepSeq (NFData(..))

7−import Criterion.Main (Benchmark, bench, nf)

8−import Data.Attoparsec.ByteString as A

9−import Data.Attoparsec.ByteString.Char8 as A8

10−import Data.ByteString.Char8 as B8

11−

12−data Link = Link {

13− linkURL :: ByteString

14− , linkParams :: [(ByteString, ByteString)]

15− } deriving (Eq, Show)

16−

17−instance NFData Link where

18− rnf l = rnf (linkURL l) `seq` rnf (linkParams l)

19−

20−link :: Parser Link

21−link = Link <$> url <*> many (char8 ';' *> skipSpace *> param)

22− where url = char8 '<' *> A8.takeTill (=='>') <* char8 '>' <* skipSpace

23−

24−param :: Parser (ByteString, ByteString)

25−param = do

26− name <- paramName

27− skipSpace *> "=" *> skipSpace

28− c <- peekChar'

29− let isTokenChar = A.inClass "!#$%&'()*+./0-9:<=>?@a-zA-Z[]^_`{|}~-"

30− val <- case c of

31− '"' -> quotedString

32− _ -> A.takeWhile isTokenChar

33− skipSpace

34− return (name, val)

35−

36−data Quot = Literal | Backslash

37−

38−quotedString :: Parser ByteString

39−quotedString = char '"' *> (fixup <$> body) <* char '"'

40− where body = A8.scan Literal $ \s c ->

41− case (s,c) of

42− (Literal, '\\') -> backslash

43− (Literal, '"') -> Nothing

44− _ -> literal

45− literal = Just Literal

46− backslash = Just Backslash

47− fixup = B8.pack . go . B8.unpack

48− where go ('\\' : x@'\\' : xs) = x : go xs

49− go ('\\' : x@'"' : xs) = x : go xs

50− go (x : xs) = x : go xs

51− go xs = xs

52−

53−paramName :: Parser ByteString

54−paramName = do

55− name <- A.takeWhile1 $ A.inClass "a-zA-Z0-9!#$&+-.^_`|~"

56− c <- peekChar

57− return $ case c of

58− Just '*' -> B8.snoc name '*'

59− _ -> name

60−

61−links :: Benchmark

62−links = bench "links" $ nf (A.parseOnly link) lnk

63− where lnk = "<https://api.github.com/search/code?q=addClass+user%3Amozilla&page=2>; rel=\"next\", <https://api.github.com/search/code?q=addClass+user%3Amozilla&page=34>; rel=\"last\""

benchmarks/Numbers.hsdeleted−82

@@ -1,82 +0,0 @@

1−{-# LANGUAGE BangPatterns #-}

2−{-# OPTIONS_GHC -fno-warn-deprecations #-}

3−

4−module Numbers (numbers) where

5−

6−import Criterion.Main (bench, bgroup, nf)

7−import Criterion.Types (Benchmark)

8−import Data.Scientific (Scientific(..))

9−import Text.Parsec.Text ()

10−import Text.Parsec.Text.Lazy ()

11−import qualified Data.Attoparsec.ByteString.Char8 as AC

12−import qualified Data.Attoparsec.Text as AT

13−import qualified Data.ByteString.Char8 as BC

14−import qualified Data.Text as T

15−

16−strN, strNePos, strNeNeg :: String

17−strN = "1234.56789"

18−strNePos = "1234.56789e3"

19−strNeNeg = "1234.56789e-3"

20−

21−numbers :: Benchmark

22−numbers = bgroup "numbers" [

23− let !tN = T.pack strN

24− !tNePos = T.pack strNePos

25− !tNeNeg = T.pack strNeNeg

26− in bgroup "Text"

27− [

28− bgroup "no power"

29− [ bench "double" $ nf (AT.parseOnly AT.double) tN

30− , bench "number" $ nf (AT.parseOnly AT.number) tN

31− , bench "rational" $

32− nf (AT.parseOnly (AT.rational :: AT.Parser Rational)) tN

33− , bench "scientific" $

34− nf (AT.parseOnly (AT.rational :: AT.Parser Scientific)) tN

35− ]

36− , bgroup "positive power"

37− [ bench "double" $ nf (AT.parseOnly AT.double) tNePos

38− , bench "number" $ nf (AT.parseOnly AT.number) tNePos

39− , bench "rational" $

40− nf (AT.parseOnly (AT.rational :: AT.Parser Rational)) tNePos

41− , bench "scientific" $

42− nf (AT.parseOnly (AT.rational :: AT.Parser Scientific)) tNePos

43− ]

44− , bgroup "negative power"

45− [ bench "double" $ nf (AT.parseOnly AT.double) tNeNeg

46− , bench "number" $ nf (AT.parseOnly AT.number) tNeNeg

47− , bench "rational" $

48− nf (AT.parseOnly (AT.rational :: AT.Parser Rational)) tNeNeg

49− , bench "scientific" $

50− nf (AT.parseOnly (AT.rational :: AT.Parser Scientific)) tNeNeg

51− ]

52− ]

53− , let !bN = BC.pack strN

54− !bNePos = BC.pack strNePos

55− !bNeNeg = BC.pack strNeNeg

56− in bgroup "ByteString"

57− [ bgroup "no power"

58− [ bench "double" $ nf (AC.parseOnly AC.double) bN

59− , bench "number" $ nf (AC.parseOnly AC.number) bN

60− , bench "rational" $

61− nf (AC.parseOnly (AC.rational :: AC.Parser Rational)) bN

62− , bench "scientific" $

63− nf (AC.parseOnly (AC.rational :: AC.Parser Scientific)) bN

64− ]

65− , bgroup "positive power"

66− [ bench "double" $ nf (AC.parseOnly AC.double) bNePos

67− , bench "number" $ nf (AC.parseOnly AC.number) bNePos

68− , bench "rational" $

69− nf (AC.parseOnly (AC.rational :: AC.Parser Rational)) bNePos

70− , bench "scientific" $

71− nf (AC.parseOnly (AC.rational :: AC.Parser Scientific)) bNePos

72− ]

73− , bgroup "negative power"

74− [ bench "double" $ nf (AC.parseOnly AC.double) bNeNeg

75− , bench "number" $ nf (AC.parseOnly AC.number) bNeNeg

76− , bench "rational" $

77− nf (AC.parseOnly (AC.rational :: AC.Parser Rational)) bNeNeg

78− , bench "scientific" $

79− nf (AC.parseOnly (AC.rational :: AC.Parser Scientific)) bNeNeg

80− ]

81− ]

82− ]

benchmarks/Sets.hsdeleted−21

@@ -1,21 +0,0 @@

1−module Sets (benchmarks) where

2−

3−import Criterion

4−import Data.Char (ord)

5−import qualified Data.Attoparsec.Text.FastSet as FastSet

6−import qualified TextFastSet

7−import qualified Data.HashSet as HashSet

8−import qualified Data.IntSet as IntSet

9−

10−smallSet :: String

11−smallSet = ['a'..'z'] ++ ['A'..'Z'] ++ ['0'..'9']

12−

13−benchmarks :: Benchmark

14−benchmarks = bgroup "sets" [

15− bench "Fast" $ whnf (FastSet.member '*') (FastSet.fromList smallSet)

16− , bench "Hash" $ whnf (HashSet.member '*') (HashSet.fromList smallSet)

17− , bench "Int" $ whnf (IntSet.member (ord '*'))

18− (IntSet.fromList (map ord smallSet))

19− , bench "TextFast" $ whnf (TextFastSet.member '*')

20− (TextFastSet.fromList smallSet)

21− ]

benchmarks/TextFastSet.hsdeleted−121

@@ -1,121 +0,0 @@

1−{-# LANGUAGE BangPatterns #-}

2−

3−------------------------------------------------------------------------------

4−-- |

5−-- Module : Data.Attoparsec.FastSet

6−-- Copyright : Felipe Lessa 2010, Bryan O'Sullivan 2007-2015

7−-- License : BSD3

8−--

9−-- Maintainer : felipe.lessa@gmail.com

10−-- Stability : experimental

11−-- Portability : unknown

12−--

13−-- Fast set membership tests for 'Char' values. We test for

14−-- membership using a hashtable implemented with Robin Hood

15−-- collision resolution. The set representation is unboxed,

16−-- and the characters and hashes interleaved, for efficiency.

17−--

18−--

19−-----------------------------------------------------------------------------

20−module TextFastSet

21− (

22− -- * Data type

23− FastSet

24− -- * Construction

25− , fromList

26− , set

27− -- * Lookup

28− , member

29− -- * Handy interface

30− , charClass

31− ) where

32−

33−import Data.Bits ((.|.), (.&.), shiftR)

34−import Data.Function (on)

35−import Data.List (sort, sortBy)

36−import qualified Data.Array.Base as AB

37−import qualified Data.Array.Unboxed as A

38−import qualified Data.Text as T

39−

40−data FastSet = FastSet {

41− table :: {-# UNPACK #-} !(A.UArray Int Int)

42− , mask :: {-# UNPACK #-} !Int

43− }

44−

45−data Entry = Entry {

46− key :: {-# UNPACK #-} !Char

47− , initialIndex :: {-# UNPACK #-} !Int

48− , index :: {-# UNPACK #-} !Int

49− }

50−

51−offset :: Entry -> Int

52−offset e = index e - initialIndex e

53−

54−resolveCollisions :: [Entry] -> [Entry]

55−resolveCollisions [] = []

56−resolveCollisions [e] = [e]

57−resolveCollisions (a:b:entries) = a' : resolveCollisions (b' : entries)

58− where (a', b')

59− | index a < index b = (a, b)

60− | offset a < offset b = (b { index=index a }, a { index=index a + 1 })

61− | otherwise = (a, b { index=index a + 1 })

62−

63−pad :: Int -> [Entry] -> [Entry]

64−pad = go 0

65− where -- ensure that we pad enough so that lookups beyond the

66− -- last hash in the table fall within the array

67− go !_ !m [] = replicate (max 1 m + 1) empty

68− go k m (e:entries) = map (const empty) [k..i - 1] ++ e :

69− go (i + 1) (m + i - k - 1) entries

70− where i = index e

71− empty = Entry '\0' maxBound 0

72−

73−nextPowerOf2 :: Int -> Int

74−nextPowerOf2 0 = 1

75−nextPowerOf2 x = go (x - 1) 1

76− where go y 32 = y + 1

77− go y k = go (y .|. (y `shiftR` k)) $ k * 2

78−

79−fastHash :: Char -> Int

80−fastHash = fromEnum

81−

82−fromList :: String -> FastSet

83−fromList s = FastSet (AB.listArray (0, length interleaved - 1) interleaved)

84− mask'

85− where s' = ordNub (sort s)

86− l = length s'

87− mask' = nextPowerOf2 ((5 * l) `div` 4) - 1

88− entries = pad mask' .

89− resolveCollisions .

90− sortBy (compare `on` initialIndex) .

91− zipWith (\c i -> Entry c i i) s' .

92− map ((.&. mask') . fastHash) $ s'

93− interleaved = concatMap (\e -> [fromEnum $ key e, initialIndex e])

94− entries

95−

96−ordNub :: Eq a => [a] -> [a]

97−ordNub [] = []

98−ordNub (y:ys) = go y ys

99− where go x (z:zs)

100− | x == z = go x zs

101− | otherwise = x : go z zs

102− go x [] = [x]

103−

104−set :: T.Text -> FastSet

105−set = fromList . T.unpack

106−

107−-- | Check the set for membership.

108−member :: Char -> FastSet -> Bool

109−member c a = go (2 * i)

110− where i = fastHash c .&. mask a

111− lookupAt j b = (i' <= i) && (c == c' || b)

112− where c' = toEnum $ AB.unsafeAt (table a) j

113− i' = AB.unsafeAt (table a) $ j + 1

114− go j = lookupAt j . lookupAt (j + 2) . lookupAt (j + 4) .

115− lookupAt (j + 6) . go $ j + 8

116−

117−charClass :: String -> FastSet

118−charClass = fromList . go

119− where go (a:'-':b:xs) = [a..b] ++ go xs

120− go (x:xs) = x : go xs

121− go _ = ""

benchmarks/Tiny.hs+4−4

@@ -1,7 +1,7 @@

1−import Control.Applicative ((<|>), many)

1+import Control.Applicative ((<|>))

2import Control.Monad (forM_)

3import System.Environment (getArgs)

4−import qualified Data.Attoparsec.ByteString.Char8 as A

4+import qualified Data.Attoparsec.Char8 as A

5import qualified Data.ByteString.Char8 as B

6import qualified Text.Parsec as P

7import qualified Text.Parsec.ByteString as P

@@ -14,8 +14,8 @@ attoparsec = do

14 A.Done _ xs -> print (length xs)

15 what -> print what

16 where

17− slow = many (A.many1 A.letter_ascii <|> A.many1 A.digit)

17+ slow = A.many (A.many1 A.letter_ascii <|> A.many1 A.digit)

18− fast = many (A.takeWhile1 isLetter <|> A.takeWhile1 isDigit)

18+ fast = A.many (A.takeWhile1 isLetter <|> A.takeWhile1 isDigit)

19 isDigit c = c >= '0' && c <= '9'

20 isLetter c = (c >= 'a' && c <= 'z') || (c >= 'A' && c <= 'Z')

21 p = fast

benchmarks/Warp.hsdeleted−17

@@ -1,17 +0,0 @@

1−{-# LANGUAGE OverloadedStrings #-}

2−

3−module Warp (benchmarks) where

4−

5−import Criterion.Main (bench, bgroup, nf)

6−import Criterion.Types (Benchmark)

7−import Data.ByteString (ByteString)

8−import Network.Wai.Handler.Warp.ReadInt (readInt)

9−import qualified Data.Attoparsec.ByteString.Char8 as B

10−

11−benchmarks :: Benchmark

12−benchmarks = bgroup "warp" [

13− bgroup "decimal" [

14− bench "warp" $ nf (readInt :: ByteString -> Int) "31337"

15− , bench "atto" $ nf (B.parse (B.decimal :: B.Parser Int)) "31337"

16− ]

17− ]

benchmarks/attoparsec-benchmarks.cabaldeleted−41

@@ -1,41 +0,0 @@

1−-- These benchmarks are not intended to be installed.

2−-- So don't install 'em.

3−

4−name: attoparsec-benchmarks

5−version: 0

6−cabal-version: >=1.6

7−build-type: Simple

8−

9−executable attoparsec-benchmarks

10− main-is: Benchmarks.hs

11− other-modules:

12− Common

13− HeadersByteString

14− HeadersByteString.Atto

15− HeadersText

16− Links

17− Numbers

18− Network.Wai.Handler.Warp.ReadInt

19− Sets

20− TextFastSet

21− Warp

22− hs-source-dirs: .. . warp-3.0.1.1

23− ghc-options: -O2 -Wall -rtsopts

24− build-depends:

25− array,

26− base == 4.*,

27− bytestring >= 0.10.4.0,

28− case-insensitive,

29− containers,

30− criterion >= 1.0,

31− deepseq >= 1.1,

32− directory,

33− filepath,

34− ghc-prim,

35− http-types,

36− parsec >= 3.1.2,

37− scientific >= 0.3.1,

38− text >= 1.1.1.0,

39− transformers,

40− unordered-containers,

41− vector

benchmarks/http-request.txtdeleted−9

@@ -1,9 +0,0 @@

1−GET / HTTP/1.1

2−Host: twitter.com

3−Accept: text/html, application/xhtml+xml, application/xml; q=0.9, image/webp, */*; q=0.8

4−Accept-Encoding: gzip,deflate,sdch

5−Accept-Language: en-GB,en-US;q=0.8,en;q=0.6

6−Cache-Control: max-age=0

7−Cookie: guest_id=v1%3A139; _twitter_sess=BAh7CSIKZmxhc2hJQz-e1e1; __utma=43838368.452555194.1399611824.1; __utmb=43838368; __utmc=43838368; __utmz=1399611824.1.1.utmcsr=(direct)|utmcmd=(none)

8−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10_8_5) AppleWebKit/537.36 (KHTML, like Gecko) Chrome/35.0.1916.86 Safari/537.36

9−

benchmarks/http-response.txtdeleted−14

@@ -1,14 +0,0 @@

1−HTTP/1.1 200 OK

2−Date: Fri, 09 May 2014 04:24:57 GMT

3−Expires: -1

4−Cache-Control: private, max-age=0

5−Content-Type: text/html; charset=ISO-8859-1

6−Set-Cookie: PREF=ID=1a871afc4240db5e:FF:LM=1399609497:S=e5MZ0itEekjVwNcU; expires=Sun, 08-May-2016 04:24:57 GMT; path=/; domain=.google.com

7−Set-Cookie: NID=67=-WlfaDG6VSEPk7abAjrK98HBSoCD2ID6JKkUR95tEumzDmg7Fc8pSQ8; expires=Sat, 08-Nov-2014 04:24:57 GMT; path=/; domain=.google.com; HttpOnly

8−P3P: CP="This is not a P3P policy! See http://www.google.com/support/accounts/bin/answer.py?hl=en&answer=151657 for more info."

9−Server: gws

10−X-XSS-Protection: 1; mode=block

11−X-Frame-Options: SAMEORIGIN

12−Alternate-Protocol: 80:quic

13−Transfer-Encoding: chunked

14−

benchmarks/json-data/example.jsondeleted−88

@@ -1,88 +0,0 @@

1−{"web-app": {

2− "servlet": [

3− {

4− "servlet-name": "cofaxCDS",

5− "servlet-class": "org.cofax.cds.CDSServlet",

6− "init-param": {

7− "configGlossary:installationAt": "Philadelphia, PA",

8− "configGlossary:adminEmail": "ksm@pobox.com",

9− "configGlossary:poweredBy": "Cofax",

10− "configGlossary:poweredByIcon": "/images/cofax.gif",

11− "configGlossary:staticPath": "/content/static",

12− "templateProcessorClass": "org.cofax.WysiwygTemplate",

13− "templateLoaderClass": "org.cofax.FilesTemplateLoader",

14− "templatePath": "templates",

15− "templateOverridePath": "",

16− "defaultListTemplate": "listTemplate.htm",

17− "defaultFileTemplate": "articleTemplate.htm",

18− "useJSP": false,

19− "jspListTemplate": "listTemplate.jsp",

20− "jspFileTemplate": "articleTemplate.jsp",

21− "cachePackageTagsTrack": 200,

22− "cachePackageTagsStore": 200,

23− "cachePackageTagsRefresh": 60,

24− "cacheTemplatesTrack": 100,

25− "cacheTemplatesStore": 50,

26− "cacheTemplatesRefresh": 15,

27− "cachePagesTrack": 200,

28− "cachePagesStore": 100,

29− "cachePagesRefresh": 10,

30− "cachePagesDirtyRead": 10,

31− "searchEngineListTemplate": "forSearchEnginesList.htm",

32− "searchEngineFileTemplate": "forSearchEngines.htm",

33− "searchEngineRobotsDb": "WEB-INF/robots.db",

34− "useDataStore": true,

35− "dataStoreClass": "org.cofax.SqlDataStore",

36− "redirectionClass": "org.cofax.SqlRedirection",

37− "dataStoreName": "cofax",

38− "dataStoreDriver": "com.microsoft.jdbc.sqlserver.SQLServerDriver",

39− "dataStoreUrl": "jdbc:microsoft:sqlserver://LOCALHOST:1433;DatabaseName=goon",

40− "dataStoreUser": "sa",

41− "dataStorePassword": "dataStoreTestQuery",

42− "dataStoreTestQuery": "SET NOCOUNT ON;select test='test';",

43− "dataStoreLogFile": "/usr/local/tomcat/logs/datastore.log",

44− "dataStoreInitConns": 10,

45− "dataStoreMaxConns": 100,

46− "dataStoreConnUsageLimit": 100,

47− "dataStoreLogLevel": "debug",

48− "maxUrlLength": 500}},

49− {

50− "servlet-name": "cofaxEmail",

51− "servlet-class": "org.cofax.cds.EmailServlet",

52− "init-param": {

53− "mailHost": "mail1",

54− "mailHostOverride": "mail2"}},

55− {

56− "servlet-name": "cofaxAdmin",

57− "servlet-class": "org.cofax.cds.AdminServlet"},

58−

59− {

60− "servlet-name": "fileServlet",

61− "servlet-class": "org.cofax.cds.FileServlet"},

62− {

63− "servlet-name": "cofaxTools",

64− "servlet-class": "org.cofax.cms.CofaxToolsServlet",

65− "init-param": {

66− "templatePath": "toolstemplates/",

67− "log": 1,

68− "logLocation": "/usr/local/tomcat/logs/CofaxTools.log",

69− "logMaxSize": "",

70− "dataLog": 1,

71− "dataLogLocation": "/usr/local/tomcat/logs/dataLog.log",

72− "dataLogMaxSize": "",

73− "removePageCache": "/content/admin/remove?cache=pages&id=",

74− "removeTemplateCache": "/content/admin/remove?cache=templates&id=",

75− "fileTransferFolder": "/usr/local/tomcat/webapps/content/fileTransferFolder",

76− "lookInContext": 1,

77− "adminGroupID": 4,

78− "betaServer": true}}],

79− "servlet-mapping": {

80− "cofaxCDS": "/",

81− "cofaxEmail": "/cofaxutil/aemail/*",

82− "cofaxAdmin": "/admin/*",

83− "fileServlet": "/static/*",

84− "cofaxTools": "/tools/*"},

85−

86− "taglib": {

87− "taglib-uri": "cofax.tld",

88− "taglib-location": "/WEB-INF/tlds/cofax.tld"}}}

benchmarks/json-data/geometry.jsondeleted−1

@@ -1 +0,0 @@

1−{"geometry": {"type": "Polygon", "coordinates": [[[-0.939359853061118, 51.57401065198471], [-0.939440892477492, 51.57431080772057], [-0.939543636564569, 51.57460846194951], [-0.939564627628489, 51.574822653966265], [-0.939763179055758, 51.575406210178826], [-0.939787182642249, 51.575552991614], [-0.939819571231525, 51.57564949527348], [-0.939851290904264, 51.57571272360808], [-0.939975682132949, 51.57588648747347], [-0.940036822193859, 51.57598774653439], [-0.940072640734852, 51.57606090267849], [-0.940109693338918, 51.576205104339515], [-0.940125502187331, 51.57645611534466], [-0.940118623499009, 51.57662779459441], [-0.94008851367835, 51.57680555827417], [-0.939998015208524, 51.57709787034017], [-0.939928028667517, 51.577252794653916], [-0.939830628174189, 51.57740747134858], [-0.939796941313687, 51.57749078985784], [-0.939785586773343, 51.57754463746666], [-0.939770656147318, 51.57769016804059], [-0.939658154074368, 51.57824573765943], [-0.939485738834128, 51.57883313597966], [-0.93945717030888, 51.579192545519916], [-0.939524336079755, 51.57928306919007], [-0.939540939284811, 51.57931379092206], [-0.939553921057406, 51.579748206813974], [-0.939549110634237, 51.57983088690364], [-0.939520940649101, 51.58004913048237], [-0.93951863934971, 51.58014801827346], [-0.939525037302583, 51.580245186310094], [-0.939540364690294, 51.58033074581249], [-0.939561798495469, 51.58040197377017], [-0.939594984852117, 51.58046431619436], [-0.939708262827559, 51.580619996404984], [-0.939729069878358, 51.58065615108302], [-0.939759224390201, 51.58072476025555], [-0.939813615319267, 51.58093026195459], [-0.939900523550716, 51.58172321441459], [-0.939894144544868, 51.581997403240464], [-0.939910832471369, 51.58208657162566], [-0.940114353648015, 51.582457967531546], [-0.94022333049887, 51.58267475179605], [-0.940267247821581, 51.58277225843995], [-0.94038427828014, 51.583077233742756], [-0.940493362377966, 51.583289522851196], [-0.940571515796737, 51.58340442254201], [-0.940725857371931, 51.58359464061899], [-0.941198340240742, 51.584069167875626], [-0.941335307610427, 51.584261925920295], [-0.941372786463165, 51.5843261048293], [-0.941416540699353, 51.58443080287741], [-0.941461326187118, 51.584739621364996], [-0.941517445876004, 51.5849954910945], [-0.941575869597484, 51.58533860085252], [-0.941574762730556, 51.58538624677686], [-0.941565185406358, 51.58542572382202], [-0.941550002863301, 51.58545795698674], [-0.941515976834126, 51.58549361692739], [-0.941470510606583, 51.585524677868065], [-0.941423872780384, 51.585544039043356], [-0.94131509921043, 51.585566436558274], [-0.941075026707647, 51.58558675057684], [-0.940953181611661, 51.58561262652464], [-0.940734943851404, 51.58568708689612], [-0.940229533088359, 51.585883040066975], [-0.940067635923264, 51.58595531027499], [-0.939917220191166, 51.58603038143916], [-0.939797255285709, 51.586099433232604], [-0.939675637701456, 51.586177461657186], [-0.939611074554604, 51.58622273608784], [-0.939340396866166, 51.586441486256], [-0.93912244296424, 51.58662744303347], [-0.938817233975319, 51.58671729893312], [-0.938661522913105, 51.586771639765516], [-0.938087678078033, 51.586992141762096], [-0.937332636663603, 51.5873072119485], [-0.93492634290483, 51.58836081134952], [-0.934774110277819, 51.58845114531925], [-0.934663126573178, 51.588505886685766], [-0.934565467487243, 51.588546362183585], [-0.934462140700832, 51.588582290320545], [-0.934337145222589, 51.58861892084846], [-0.934213782000904, 51.588647473549656], [-0.934055887760941, 51.588671216763295], [-0.933259701136762, 51.58864510257983], [-0.933213278816969, 51.588716614209304], [-0.932681740160827, 51.588792708227174], [-0.931992471253759, 51.58900853446031], [-0.930629113767652, 51.58946908647644], [-0.928525036745892, 51.59005953842682], [-0.928533690860491, 51.59024394687689], [-0.928456010745829, 51.59047792078815], [-0.928256501298223, 51.5906748158337], [-0.927916132025856, 51.59066181734799], [-0.927671608556404, 51.590624516635486], [-0.927319567022116, 51.59061680481465], [-0.926850285435352, 51.59062240702726], [-0.926313746570405, 51.59066425819173], [-0.925516790702947, 51.59079184232522], [-0.925387133168341, 51.59078076476673], [-0.925293323156809, 51.59077990606886], [-0.925202187496562, 51.59078806346173], [-0.925112304116411, 51.59080432476366], [-0.925036768134577, 51.59082431403807], [-0.924968299737815, 51.59085066215826], [-0.924899640304234, 51.59088510100373], [-0.924851228495836, 51.590917926896914], [-0.924734051019008, 51.59105082982951], [-0.924694255912291, 51.59108553291224], [-0.924446018071168, 51.59126668934789], [-0.924204972773907, 51.59150995377465], [-0.923492520665307, 51.59215352189589], [-0.922775141969353, 51.59288246146081], [-0.922298613651092, 51.59343737077436], [-0.922101568270595, 51.59365046303728], [-0.92149319027045, 51.59422483935332], [-0.921029930136652, 51.59464499018023], [-0.919455791303858, 51.595519790418045], [-0.919908472816787, 51.59560757835559], [-0.919902358174605, 51.595621908790214], [-0.919721503870405, 51.59588190272939], [-0.919513222918683, 51.59614164398608], [-0.919057326435374, 51.59661490568889], [-0.918991959815932, 51.59669253146064], [-0.918853979663433, 51.59690975873926], [-0.91882720841051, 51.59694278142396], [-0.918711889332325, 51.597056812913756], [-0.918614808732714, 51.59713234806153], [-0.918297245740306, 51.59749448485627], [-0.918073703114389, 51.59778825130676], [-0.917853804369843, 51.59811082427763], [-0.917772408698363, 51.59831598343439], [-0.917709563771812, 51.59853030520902], [-0.917692745480418, 51.59856971355161], [-0.917634249201942, 51.59866178857289], [-0.917443039919903, 51.59887043094418], [-0.917335250471836, 51.598971042984616], [-0.916888284039272, 51.599309503426845], [-0.916921110547038, 51.59938623548714], [-0.916942485633783, 51.5995195094582], [-0.916937652924948, 51.599601289122916], [-0.916945811778801, 51.599683188627004], [-0.916964246289877, 51.599757989575366], [-0.917049297107238, 51.59994580090974], [-0.917089705367533, 51.60000731699611], [-0.917171120773417, 51.60010517795964], [-0.91752823274465, 51.60044925531009], [-0.917834023417531, 51.600765883511485], [-0.917913079603466, 51.600902386385464], [-0.918033251654948, 51.60107073894696], [-0.91851090277833, 51.601507638962644], [-0.918694916056997, 51.601663091331545], [-0.919167224655989, 51.60214309940451], [-0.919302231291783, 51.6024167896932], [-0.919552009673002, 51.60266096432073], [-0.919812571846437, 51.60293760761218], [-0.920091738726093, 51.60358667644501], [-0.920208566517809, 51.603592246724574], [-0.920644522919282, 51.60359715428394], [-0.921093152621479, 51.6036156641763], [-0.921168285587618, 51.603613657034074], [-0.921469264587163, 51.6035867495928], [-0.921584776688781, 51.603586911416876], [-0.921718864440287, 51.603595336217005], [-0.921999521996191, 51.60363387995426], [-0.922136050325758, 51.603661209181794], [-0.922248015684399, 51.60368921195661], [-0.922346882036963, 51.60372159023333], [-0.922478548042792, 51.60377135359644], [-0.922605777045377, 51.603825571929555], [-0.92269948345521, 51.60389297005248], [-0.922855181916126, 51.60396453348124], [-0.922908065211369, 51.60398749776935], [-0.923525984356841, 51.604174796116844], [-0.923689774691443, 51.6042095667925], [-0.923842334751645, 51.60423074681459], [-0.924020987014581, 51.604247669912816], [-0.924152253615336, 51.604253368572344], [-0.924379056519158, 51.60424915231234], [-0.924491916632975, 51.60423939614583], [-0.925129396784027, 51.604149022807746], [-0.925308707040747, 51.60413807581467], [-0.925396812395019, 51.604137083863186], [-0.925816640142735, 51.60415261457396], [-0.926339243350925, 51.604157394450915], [-0.926627592983669, 51.60417621577326], [-0.928219342008724, 51.60433911850777], [-0.928540897883304, 51.60435823822504], [-0.928666454251138, 51.6043611822271], [-0.928925123731038, 51.60435275210506], [-0.929272427371303, 51.60432085222454], [-0.929350681081097, 51.604308977474346], [-0.929525019586135, 51.60426381040009], [-0.929730308556221, 51.60419195021111], [-0.929806393059037, 51.60414948374236], [-0.929854111423592, 51.60408517871234], [-0.929877477717563, 51.604012559228565], [-0.929880189120251, 51.60395863398061], [-0.930157001898001, 51.603362311928585], [-0.930233415197893, 51.60324431822904], [-0.930397156019029, 51.60303540508514], [-0.93058677482955, 51.602831223239896], [-0.930747612253953, 51.60268432562219], [-0.931065151604954, 51.602443542878724], [-0.931358556224333, 51.60224659876122], [-0.931494751600125, 51.602165114969594], [-0.931807666849096, 51.601998019766675], [-0.932115553298882, 51.60186055047904], [-0.932344261944379, 51.601774512081256], [-0.932581062209752, 51.601712824287226], [-0.932837650566022, 51.60166929919289], [-0.93304760157037, 51.60164423223924], [-0.933247236692325, 51.60162806284857], [-0.933524572231589, 51.601623388892406], [-0.93367307135076, 51.60163283011416], [-0.933854562367985, 51.601651562386515], [-0.934222940436163, 51.60170526005669], [-0.934582321335698, 51.60177326158339], [-0.935176916778695, 51.60190903449902], [-0.935323237909383, 51.60194992468383], [-0.935449328012611, 51.60199153042619], [-0.935555166022244, 51.60203475076641], [-0.935754957696255, 51.60213547009268], [-0.935920944220561, 51.60219991608389], [-0.936105992086264, 51.60225194623237], [-0.936251123590137, 51.60228203448254], [-0.9362553703842, 51.602285669620606], [-0.935954861941404, 51.603034649313756], [-0.936025513047831, 51.60328615677915], [-0.937604653681525, 51.60374194595848], [-0.937842729718605, 51.6037494948452], [-0.937998245297976, 51.60376798569096], [-0.938149157504488, 51.60379812385097], [-0.938282536474463, 51.60383709493093], [-0.938398403200176, 51.60388400001471], [-0.938549544157173, 51.60396629131982], [-0.938542113846477, 51.60403725821696], [-0.938540670189083, 51.60403724516617], [-0.938690470772444, 51.60417707075241], [-0.93885671831091, 51.60429276731543], [-0.938949655717409, 51.60433227129961], [-0.939171393952754, 51.60435945147724], [-0.939491406642938, 51.60438302306183], [-0.939580914110842, 51.60438383145672], [-0.939698081584302, 51.604374998744255], [-0.939860253923854, 51.60435578228165], [-0.940131370864495, 51.60430877574863], [-0.940224037565311, 51.60429792302206], [-0.941065905352937, 51.604358569226044], [-0.941456261791824, 51.60439985396626], [-0.94172260946072, 51.604433725629356], [-0.942065117075164, 51.604483568721975], [-0.942405972956444, 51.60454238758566], [-0.942542307804962, 51.60457868292929], [-0.942668453620936, 51.60461848302318], [-0.942754322773386, 51.60465162617505], [-0.942930037674105, 51.6047332338937], [-0.94300827141212, 51.60478429141865], [-0.943050642772121, 51.60482513526179], [-0.943095505071305, 51.604883085645305], [-0.943175837511794, 51.60503037259752], [-0.943199044776033, 51.60508812802956], [-0.943264927978451, 51.605360268787045], [-0.94328295289835, 51.6055168856955], [-0.943285556153251, 51.605653582182974], [-0.94327790338372, 51.60573443814757], [-0.943262026480571, 51.60579633763445], [-0.943228365851772, 51.605877858692274], [-0.943092212068021, 51.60614458434088], [-0.943074097962666, 51.60624063192375], [-0.943061365824471, 51.606415854446915], [-0.943044862244347, 51.60650472320056], [-0.943017897594943, 51.606608783583646], [-0.942979591589439, 51.606703750216774], [-0.942905884027612, 51.60683076806164], [-0.942741267849139, 51.60707925374213], [-0.942655006715899, 51.607249318295594], [-0.942630361430127, 51.60731563455148], [-0.942616263944651, 51.607425205688976], [-0.942621958529523, 51.60749089598715], [-0.942636336634899, 51.60755576531453], [-0.942660904708633, 51.607617129739225], [-0.942696981288364, 51.607680396114986], [-0.942747433102709, 51.60774648940761], [-0.942856244975984, 51.6078490746924], [-0.94299552290573, 51.60794563997599], [-0.943040847342192, 51.60798381288104], [-0.943186973159248, 51.608158666884215], [-0.943285889122319, 51.60825217104693], [-0.943509689787491, 51.60844031193307], [-0.94379690141149, 51.609007570967925], [-0.943824004868445, 51.60908424372538], [-0.943831400135399, 51.609201201602104], [-0.943839541642426, 51.60922375393887], [-0.943852077204152, 51.6092436483043], [-0.943874740412961, 51.60926273459518], [-0.943900416430683, 51.60927645299323], [-0.944008015202393, 51.60930709311221], [-0.944074894993692, 51.60934995527111], [-0.944126815315737, 51.60941516198104], [-0.944143328071964, 51.60945037786937], [-0.944150844233183, 51.609499899486615], [-0.944148608042361, 51.60953404761941], [-0.944074023202655, 51.60969882315075], [-0.94403415265091, 51.60986121332522], [-0.944017357658548, 51.60996266784037], [-0.943992023164905, 51.61030771903426], [-0.943965568458423, 51.61051428886229], [-0.943938629028152, 51.61067949277199], [-0.943919488028492, 51.61075754789674], [-0.943885949921455, 51.61083367520212], [-0.943827406881077, 51.61092935920088], [-0.943739589608875, 51.61104186395993], [-0.943638735204063, 51.61115604969767], [-0.943533757272514, 51.611261206608894], [-0.942952360107171, 51.61179457356613], [-0.942768364001955, 51.61194397664764], [-0.942436714102017, 51.61217027698273], [-0.942010518369458, 51.61248743929258], [-0.941742162181165, 51.61266215641604], [-0.941369087685306, 51.61286829880399], [-0.941218061678922, 51.612965845186196], [-0.941055044244821, 51.613082165678385], [-0.940962318642569, 51.61315685920963], [-0.940802313735133, 51.613329853845215], [-0.940532273923746, 51.613638528438315], [-0.940201080800705, 51.61403027273604], [-0.940058816377521, 51.614185443187054], [-0.939985695447699, 51.614286388653916], [-0.939953592073967, 51.614362527773245], [-0.939906859457064, 51.614508669589505], [-0.939802341993177, 51.61490335803689], [-0.939554942446072, 51.615603370947234], [-0.939452722231603, 51.61596121406953], [-0.939421935085161, 51.61604275989804], [-0.939387192811998, 51.616108085051245], [-0.939207265482904, 51.61639149465681], [-0.939036585027605, 51.61671185322904], [-0.938852844916865, 51.61697274874371], [-0.938765881571911, 51.61710953487875], [-0.938636321443754, 51.617400592062225], [-0.93858227703968, 51.617550263869646], [-0.938563060896774, 51.61763101488344], [-0.938557821588965, 51.617793716095726], [-0.938568952285691, 51.6178738422429], [-0.938586194898738, 51.61793963701825], [-0.93864824402059, 51.61806608070808], [-0.938712639101221, 51.61815388154161], [-0.938801458484915, 51.61824729803767], [-0.938902019778203, 51.61833272809444], [-0.939001577491258, 51.61839926656718], [-0.939080060597956, 51.6184404379885], [-0.939144458958051, 51.618466196342986], [-0.93924483456823, 51.61849767462955], [-0.939389936057716, 51.61853135511866], [-0.939533886937889, 51.618552436752374], [-0.939605967169062, 51.618558482633226], [-0.939704125343146, 51.618561167280205], [-0.940011869234288, 51.61855765138392], [-0.940970156479417, 51.61846828865034], [-0.942814559287174, 51.61834913395653], [-0.9433943585448, 51.61832378069166], [-0.943791844341078, 51.61831207069643], [-0.944095316626396, 51.61830580819228], [-0.944345189840605, 51.61830625638639], [-0.944633949874169, 51.618311549349706], [-0.944866264500346, 51.618321729423634], [-0.945069571918896, 51.61833704343469], [-0.945259736594118, 51.618358533188456], [-0.945405071369022, 51.6183823175338], [-0.945538707551366, 51.61841229079249], [-0.945670733169093, 51.618449442740584], [-0.945789657802543, 51.61849097274293], [-0.945898390514756, 51.618536007789324], [-0.946002624502939, 51.61858819565799], [-0.946144975691139, 51.61867849034559], [-0.946290660655923, 51.61881197458077], [-0.946424293873759, 51.618966930407886], [-0.94648587943588, 51.619052004215185], [-0.946597289998464, 51.61923103785771], [-0.946748500992991, 51.619500344620654], [-0.946865282768134, 51.619759451627154], [-0.94692090631825, 51.619852564183816], [-0.946986743272162, 51.619941272483025], [-0.947121992710119, 51.62008904866086], [-0.947221067183078, 51.620177155655796], [-0.947357337089385, 51.62028088174252], [-0.947636341593443, 51.62045871900467], [-0.947732020809812, 51.62050633282523], [-0.947832261440868, 51.62054409665008], [-0.948024909405708, 51.6205835873772], [-0.948272727755043, 51.62061098363029], [-0.94903310890345, 51.62064836261257], [-0.949342820854191, 51.62068530212313], [-0.949548509996597, 51.62072310869445], [-0.949603327033706, 51.620726296510135], [-0.94966121922192, 51.62072141934501], [-0.949725095662238, 51.62070760405018], [-0.949813979767225, 51.620674230793945], [-0.949850856696741, 51.620766275113425], [-0.949938127431095, 51.62092800552347], [-0.95012170684362, 51.62142328688538], [-0.950137689181391, 51.621481875301626], [-0.950144591409982, 51.621558365780544], [-0.950143525838059, 51.62166715485939], [-0.950086848280287, 51.62218276713024], [-0.950081566444785, 51.62234906486587], [-0.950091380322934, 51.6227375905417], [-0.950012857804674, 51.623198158520914], [-0.949963053357781, 51.62366617649237], [-0.94993621019599, 51.62382778558582], [-0.949887611273865, 51.62405573809743], [-0.94981748429385, 51.62434014525264], [-0.949698012983878, 51.6246969431444], [-0.949601071539472, 51.62520410239216], [-0.949519655994856, 51.62547671925938], [-0.949509640700394, 51.62553507516918], [-0.949509569744091, 51.62560071332227], [-0.949517625184728, 51.6256898023632], [-0.949539397678852, 51.62581048474923], [-0.949602831958219, 51.626066413978656], [-0.949622600072634, 51.6262113557699], [-0.949625807500304, 51.62644786389373], [-0.949588359660548, 51.62688092470566], [-0.949587162842075, 51.62718303218221], [-0.949593421398238, 51.627287390862], [-0.949641886384285, 51.62762860642186], [-0.949677564559904, 51.627772791296934], [-0.949732061930258, 51.62791534613564], [-0.949847071945823, 51.62812767746571], [-0.95005020451512, 51.62890367131774], [-0.949860358893705, 51.62924185674224], [-0.949849459019953, 51.62927592739189], [-0.949848649628705, 51.62931098742953], [-0.949857806222275, 51.62935243070728], [-0.949882540677514, 51.62940750068883], [-0.949782851646605, 51.62940750843079], [-0.949684104107472, 51.6296170289926], [-0.949619670293909, 51.62984214210067], [-0.949589348281571, 51.62990391300069], [-0.949478823262764, 51.63006027755304], [-0.949419643728549, 51.63018293320961], [-0.949378577882241, 51.63033452402259], [-0.949364251310331, 51.63051692549393], [-0.949339228920643, 51.63059942443184], [-0.949248633732607, 51.63076855530058], [-0.949181283974238, 51.630869557872636], [-0.949044504574139, 51.63103647701982], [-0.948893935504611, 51.63136242402941], [-0.948761069414249, 51.631297394415576], [-0.948669492362367, 51.63125880992652], [-0.948537801268757, 51.63120547966423], [-0.948447461288637, 51.63117589768262], [-0.948353982967507, 51.63115707745748], [-0.948302104865814, 51.63115121794117], [-0.948079606840815, 51.63115102360314], [-0.947964190602531, 51.63114369566099], [-0.94782149485015, 51.63112892992514], [-0.947725107052886, 51.63111098229264], [-0.947684910040859, 51.63109983219839], [-0.947483021604023, 51.63102069524269], [-0.947447137482345, 51.63101048287877], [-0.947306094892948, 51.630986739722026], [-0.947000710620611, 51.63094713644845], [-0.946674033898238, 51.6308911565172], [-0.946364247153943, 51.63079216747898], [-0.946230490849763, 51.63076579091048], [-0.946172752135344, 51.63076347450912], [-0.94612066649297, 51.630766603772976], [-0.945914796224295, 51.63079712600587], [-0.94583241748209, 51.63079818492752], [-0.945382953779145, 51.63067905708907], [-0.945085984219956, 51.63058827220451], [-0.944883205963743, 51.630547786680644], [-0.944304065189339, 51.630538086402446], [-0.94394898927073, 51.630523204990325], [-0.943611477254356, 51.63049858971805], [-0.943603681926519, 51.6307098224617], [-0.943277115569317, 51.63102249010073], [-0.943359247728321, 51.63109426279834], [-0.942862682241593, 51.631385618132356], [-0.942777562378065, 51.63144239822567], [-0.942532313252267, 51.63161282917167], [-0.942337892928893, 51.63177202827151], [-0.94226606523137, 51.631816339444626], [-0.942197377359527, 51.63184988892168], [-0.942115813951467, 51.631877927416205], [-0.941937005967162, 51.631924871353945], [-0.941512981586086, 51.63201636159427], [-0.94144898217334, 51.6320346671529], [-0.94125937051438, 51.632111184999914], [-0.940790185204025, 51.6323425346351], [-0.940501042462563, 51.632535943664614], [-0.940243238615803, 51.63268647504363], [-0.940131608045529, 51.632764593869275], [-0.939328651391563, 51.63361514453957], [-0.939011405652477, 51.634145481445906], [-0.93882930544315, 51.63451878632893], [-0.93850479164515, 51.63486472819315], [-0.93841585373771, 51.63483694950617], [-0.938308667759282, 51.63503379600045], [-0.938237520065274, 51.63511048065125], [-0.938174497877949, 51.635148574806536], [-0.938097155068085, 51.63518114448376], [-0.938014243480848, 51.63520467214815], [-0.937885103100742, 51.635227781700706], [-0.937899482630853, 51.63529265131639], [-0.937852791962712, 51.635312010611116], [-0.937756752174709, 51.63534081433219], [-0.93768849662133, 51.635355482713884], [-0.937445207164159, 51.63537845841074], [-0.937282775985471, 51.6354039635962], [-0.936848828519967, 51.635485456519916], [-0.935951432459366, 51.63561220386278], [-0.935719677036262, 51.635636179646525], [-0.935420148631615, 51.63565414571281], [-0.935249454884316, 51.63560044703531], [-0.935077590540852, 51.635535048401415], [-0.934717727795324, 51.63535285185533], [-0.934413155884105, 51.635216113905294], [-0.934240481559584, 51.635123731852076], [-0.934130824273522, 51.63505529964683], [-0.934018404467151, 51.63498144729724], [-0.93379675026591, 51.63482118293064], [-0.933679892303923, 51.6347517857655], [-0.933595523374065, 51.63471415412531], [-0.933350473747258, 51.63462740768713], [-0.933261876876166, 51.63458524160035], [-0.933052343088727, 51.63446285066096], [-0.932887751506176, 51.63439571653097], [-0.932638117941304, 51.63431971687678], [-0.932307197466639, 51.63419801967628], [-0.931343887912331, 51.63380981222079], [-0.931071830619705, 51.63376597498289], [-0.930956833347264, 51.63374065092008], [-0.930823331188951, 51.63370346918478], [-0.930701576222194, 51.633658301797674], [-0.930601553796263, 51.63361063468632], [-0.930506119022842, 51.63355221932683], [-0.930386739592999, 51.633467510133144], [-0.930286034494439, 51.633387466714524], [-0.930225334024314, 51.63332666999925], [-0.930188937852857, 51.633276884582266], [-0.930114567680391, 51.63312155131756], [-0.92999324620862, 51.63293521875163], [-0.929900400330813, 51.63282827174111], [-0.929602366751531, 51.6325378240622], [-0.929499431873266, 51.632429885607195], [-0.929341000864788, 51.63222433167361], [-0.929059923028374, 51.631889079042224], [-0.928963213558906, 51.63176231446386], [-0.928896162303318, 51.6316645934755], [-0.928844852932023, 51.631573310156845], [-0.928688841592085, 51.63126527289447], [-0.928672375509884, 51.6312282570475], [-0.928615004479859, 51.631026321392014], [-0.928599834825331, 51.63099561149414], [-0.928552267379979, 51.63092953870757], [-0.928477466267079, 51.630854225808044], [-0.928389580173335, 51.630782390113474], [-0.928294323595921, 51.6307167812279], [-0.928190294396403, 51.63065558801307], [-0.928078937075949, 51.630598823630024], [-0.927494137115659, 51.630339021667446], [-0.927177150281751, 51.63017967221046], [-0.927053070740772, 51.63011110151437], [-0.926922044883713, 51.63003077810591], [-0.926774152423019, 51.6299305188448], [-0.926569924361936, 51.62976860145066], [-0.926465515994788, 51.62966244509719], [-0.926222881099496, 51.62935271335746], [-0.925807083215573, 51.62885077488713], [-0.925685153671251, 51.62869140695483], [-0.925627779063265, 51.628612654944924], [-0.925107975398826, 51.62780494620014], [-0.925039238852947, 51.627717997425265], [-0.924853081975605, 51.627525670804864], [-0.924566287633664, 51.62725149768458], [-0.924018135317732, 51.62666651663998], [-0.9236755124427, 51.62631000590676], [-0.923506463123086, 51.62618886774415], [-0.92325024557972, 51.62602736696645], [-0.923179326155173, 51.62597186775246], [-0.923151247824846, 51.62593744208942], [-0.923025917353845, 51.62573937605691], [-0.922746731858051, 51.625388839233764], [-0.922647729925315, 51.625421200084226], [-0.922438316532782, 51.62517470633975], [-0.922266691774008, 51.62491866820555], [-0.922176577184834, 51.624819832363215], [-0.921722712186069, 51.62440384906751], [-0.921324388846087, 51.624082786314446], [-0.921078577970903, 51.623909687134365], [-0.920860652296657, 51.62377910436709], [-0.920574889783577, 51.623646099345635], [-0.920239048968319, 51.623492851580735], [-0.920014292502202, 51.62371107994427], [-0.919774493442185, 51.623954346092496], [-0.9196346398006, 51.62406455586703], [-0.919395541436808, 51.62427815528515], [-0.919291601043514, 51.624396787581134], [-0.919216417933559, 51.6245210794288], [-0.919153464283899, 51.62467785367513], [-0.919134125069682, 51.624762197061855], [-0.919115026043568, 51.62495803894169], [-0.919049238753011, 51.62517323267518], [-0.919009465019033, 51.625266379578875], [-0.918926652164549, 51.625407685106715], [-0.91889138185638, 51.62549368011671], [-0.918887531877765, 51.62553410703284], [-0.918896749679156, 51.62569334383204], [-0.918892707420934, 51.62574186144837], [-0.918872585162246, 51.62579832350382], [-0.918836276012485, 51.62586722482348], [-0.918763089019947, 51.62596815648993], [-0.918486277330256, 51.626309088016214], [-0.918317614737411, 51.62653682130949], [-0.917905561785174, 51.626975413689514], [-0.917718470441796, 51.62724883363936], [-0.917588198962995, 51.627380709193844], [-0.917518986462533, 51.627435819379606], [-0.917391270738013, 51.627520961779815], [-0.916852199941663, 51.62783249660931], [-0.916708494011591, 51.62822500463541], [-0.916564194300437, 51.62882431452802], [-0.91642514281193, 51.62950639562586], [-0.916399138398425, 51.62974892972319], [-0.916394191477189, 51.62995659074321], [-0.917260413231125, 51.62992321851857], [-0.917422640699178, 51.63166639247214], [-0.91745600722272, 51.63232848375385], [-0.917204699151121, 51.632324368705305], [-0.916787813832452, 51.632356490901394], [-0.916473041038736, 51.63240843616508], [-0.91615824611563, 51.63246127954521], [-0.916096846672852, 51.632491284427324], [-0.916000979824314, 51.632573122584574], [-0.916035541448316, 51.63300234215989], [-0.916058746179642, 51.633180590521675], [-0.916070697537387, 51.63322475979131], [-0.916098260729099, 51.63328076225654], [-0.916287121367376, 51.6334803208717], [-0.916556537933578, 51.63369500893812], [-0.916833436931067, 51.63389897542989], [-0.916980624704717, 51.63396776999687], [-0.917236275570907, 51.634093312450645], [-0.91746761535009, 51.63414759643489], [-0.917599467742121, 51.63382870989293], [-0.917652284973834, 51.63367364156546], [-0.917677934007693, 51.63362802065708], [-0.917745133700401, 51.63359716923921], [-0.917749446066394, 51.633598108140106], [-0.917778102484095, 51.633608262991594], [-0.918084580428658, 51.633662338963], [-0.918258883815884, 51.633684625273325], [-0.918506861448772, 51.63370758977881], [-0.918953829589691, 51.63374767133924], [-0.919245145699076, 51.633771033193085], [-0.919300707852053, 51.63386505735126], [-0.919518444759651, 51.63449197843591], [-0.919277685382965, 51.63446908250848], [-0.919031520477806, 51.63467362436313], [-0.918786199566619, 51.63490335001199], [-0.918632752044247, 51.63503681158531], [-0.918623327237537, 51.63512933850577], [-0.918590569006466, 51.635413172104], [-0.918679820058316, 51.63554886817429], [-0.918329488250497, 51.63557621368664], [-0.918276435808259, 51.635741170885815], [-0.918247752304029, 51.6360358318421], [-0.918226764712395, 51.6364321689642], [-0.918316733144818, 51.63702374696847], [-0.918287332378286, 51.63783452012518], [-0.918306713699577, 51.63835621240955], [-0.918316674296085, 51.639213205140855], [-0.918347519668651, 51.639799742499974], [-0.918322169732004, 51.63995416480466], [-0.918318885834364, 51.64003146244247], [-0.91832686087795, 51.64012145202931], [-0.91837911416845, 51.640354816042915], [-0.918418495846573, 51.64070405330022], [-0.918530296534871, 51.64128953760163], [-0.918512952473936, 51.64147190762244], [-0.918367217757134, 51.64200916315153], [-0.917905817511154, 51.6420255938785], [-0.917874522823857, 51.64200462484983], [-0.9178264462409, 51.64196012300076], [-0.917792775459127, 51.641917552189355], [-0.917773553228143, 51.64187511449974], [-0.917765526057023, 51.64184806570082], [-0.917757894232724, 51.6417436926823], [-0.917749532884981, 51.64142711089125], [-0.917739557627689, 51.64136048104305], [-0.917720785029217, 51.641299165096676], [-0.917688816437575, 51.64124581999865], [-0.917649452591449, 51.641199600032465], [-0.917568381483579, 51.64114490323613], [-0.917433423830488, 51.64098630616572], [-0.917315173490429, 51.64079369481265], [-0.916601390868836, 51.640243120219885], [-0.916329281834837, 51.640018517003504], [-0.916001068304932, 51.63966211774633], [-0.915790319174844, 51.63947044935813], [-0.915502073944432, 51.63913509831614], [-0.915393357554307, 51.63902799332443], [-0.915169439572157, 51.63884339546647], [-0.914312592230519, 51.638234837864296], [-0.913969150495335, 51.63797270396478], [-0.913808719070197, 51.63773204326735], [-0.913709021859032, 51.63761063348384], [-0.913238840648949, 51.637814889395024], [-0.912211197236081, 51.63818662075986], [-0.912057780107923, 51.6382571327065], [-0.911911629192503, 51.63832591344631], [-0.911683066608314, 51.6384568717294], [-0.911571655864317, 51.638583520328496], [-0.910821072629623, 51.63897039510019], [-0.910799442348496, 51.63890815232427], [-0.910457034748542, 51.63884473254883], [-0.90959863753988, 51.63872527019996], [-0.909397970101408, 51.639078576087414], [-0.909048252097236, 51.63925965643008], [-0.909362542404515, 51.63959166868019], [-0.90780907162756, 51.64013291512084], [-0.906217399025103, 51.640939038154336], [-0.905898125060113, 51.64111499768922], [-0.905490384709512, 51.641363863281036], [-0.905329841704473, 51.64154939281248], [-0.905189541321435, 51.641794455508446], [-0.90489098319803, 51.64194992468491], [-0.904781623731163, 51.641990266433346], [-0.904676706895303, 51.64202615370086], [-0.904609919053975, 51.64203901826923], [-0.904237228330216, 51.64209218907456], [-0.90337364044862, 51.64224597828853], [-0.902975191138407, 51.642348358507896], [-0.90292303291413, 51.6422939216028], [-0.902563354675933, 51.64240655335107], [-0.902346768622897, 51.642458479170756], [-0.900824166346957, 51.64291090498388], [-0.900831401206159, 51.64297031739377], [-0.900456613238591, 51.64299018760407], [-0.900019098619797, 51.64297440185565], [-0.899740380937974, 51.64290615240652], [-0.899740489711103, 51.64290165761423], [-0.899316872364163, 51.642849133775655], [-0.899203336991784, 51.642822893203494], [-0.898949902655656, 51.64272520647125], [-0.898783095909619, 51.642631028913314], [-0.898613530793898, 51.64253143027416], [-0.898274969154989, 51.64230885935864], [-0.898003026265053, 51.642080618381755], [-0.897815191816853, 51.641840577798526], [-0.897681652652772, 51.6416262230417], [-0.897327401428262, 51.64091885338664], [-0.896908641882592, 51.6401308512027], [-0.896689777704333, 51.63985994571793], [-0.896199107519928, 51.639356299928586], [-0.896147069948886, 51.63929736526477], [-0.896071667668875, 51.63912941223961], [-0.896034388155249, 51.63881974973283], [-0.89604243255033, 51.63866696761571], [-0.896079873457203, 51.63849378104931], [-0.896158355572289, 51.63829670279626], [-0.896345617779906, 51.63796397393339], [-0.896436991088377, 51.637771512438086], [-0.896627579786388, 51.63748017587825], [-0.896853716275347, 51.63721255114492], [-0.896930541034958, 51.63714313797598], [-0.897052325259386, 51.63706695367484], [-0.897622203318074, 51.636806151704704], [-0.897875248140837, 51.636679946210485], [-0.898045509693898, 51.63657094674504], [-0.898161794997489, 51.63648302058021], [-0.898300490282884, 51.636364732965696], [-0.898761753797595, 51.63587451909389], [-0.898944791614438, 51.635595696246455], [-0.899167964890093, 51.63497197055003], [-0.899296205851425, 51.63450920414348], [-0.899574174378538, 51.633591065468096], [-0.89965934952667, 51.63323579470252], [-0.899745200652967, 51.632733067337156], [-0.89977291429982, 51.632065248259224], [-0.899749317297925, 51.63190587518938], [-0.899730833669311, 51.631833768913715], [-0.899698165870897, 51.631750739777836], [-0.89965967663145, 51.63166945441679], [-0.899415121605884, 51.63126703489972], [-0.899342021743563, 51.6311233827535], [-0.899274678557411, 51.630980683675816], [-0.899221406706553, 51.63067446858268], [-0.899099405183406, 51.63046202142283], [-0.899036514315775, 51.63037421293725], [-0.898969246754073, 51.63028816171176], [-0.898790586842518, 51.63008867047265], [-0.898592010806669, 51.62987640386868], [-0.898497321924236, 51.62978919602221], [-0.898330098469121, 51.62965455114822], [-0.898092642525963, 51.62949676796704], [-0.897090362270362, 51.62894426419184], [-0.896737033461809, 51.62879887742956], [-0.896347312922056, 51.6286648367393], [-0.895633444660858, 51.62837398981453], [-0.895432402381131, 51.628264199314984], [-0.895328663542796, 51.62819308870188], [-0.895257753282041, 51.62813847178444], [-0.895144755729953, 51.62803220648194], [-0.894948239644532, 51.627795675481295], [-0.894944118635818, 51.62766795529761], [-0.894659948504904, 51.62723368184], [-0.894597856997988, 51.62711350846984], [-0.894557343909314, 51.62699713484451], [-0.894469809950127, 51.62655661915932], [-0.894297931114171, 51.625960652861906], [-0.894027819576293, 51.62530531541029], [-0.893931965007508, 51.62514795788166], [-0.893770350871199, 51.62496210671055], [-0.893637995566781, 51.62476124514902], [-0.893507481839104, 51.62466290563429], [-0.892108104715385, 51.62369479825078], [-0.891788795844237, 51.623459800649094], [-0.891922368328922, 51.62337294285213], [-0.891402229815371, 51.62296161084893], [-0.891224922435199, 51.622768414566416], [-0.890089770742591, 51.621276764770215], [-0.890188416566163, 51.62120036880181], [-0.889947380146256, 51.62101466068101], [-0.889727152716072, 51.62086421627997], [-0.889328903798693, 51.62066892786315], [-0.889153387824523, 51.620758083474584], [-0.888409981594066, 51.6201459098237], [-0.888016456293258, 51.619876030785385], [-0.887588982852847, 51.619754191291285], [-0.887143566599165, 51.61965735685454], [-0.88701981132148, 51.61963820065132], [-0.886790744842007, 51.619613550199404], [-0.886603228328527, 51.619602780759124], [-0.886388075513318, 51.619599841439666], [-0.886090409498186, 51.61960421155123], [-0.8851368584814, 51.61967159165818], [-0.883828125903616, 51.61979133688442], [-0.883515973065361, 51.619797361107345], [-0.883424375160774, 51.6198216668555], [-0.883259776293847, 51.619877648328995], [-0.883163867754863, 51.61990101371408], [-0.883044634749604, 51.619815357981636], [-0.881854770311083, 51.61956485587701], [-0.881704286246311, 51.61951666620604], [-0.881635675440863, 51.619487239450166], [-0.881560131370525, 51.619446057447796], [-0.881477720403852, 51.619390423316226], [-0.881374708667671, 51.619291432867335], [-0.880834298239682, 51.61853547912722], [-0.880617549323506, 51.618127888748454], [-0.880388345702594, 51.61816796449318], [-0.879226788544387, 51.6185884841998], [-0.878534686661489, 51.61883184500677], [-0.878385021629543, 51.61898507235025], [-0.878148819949825, 51.61913297697072], [-0.878102165244257, 51.61915051459153], [-0.87804120240859, 51.61916252048532], [-0.877967464227806, 51.619165412606506], [-0.877896924603018, 51.61915574690363], [-0.877839648002824, 51.61913541789456], [-0.877812586845032, 51.61911987344738], [-0.877382402665225, 51.61869944717381], [-0.877261875140598, 51.61866682400238], [-0.877087293116294, 51.618600414623565], [-0.876592344555959, 51.61846350297477], [-0.876408990128558, 51.61845995037962], [-0.876374465270622, 51.61845422502283], [-0.876347205240439, 51.61844677083749], [-0.87630299358364, 51.61842386858449], [-0.876241963569583, 51.618380124514495], [-0.876216636094276, 51.618352907107045], [-0.876152781748704, 51.618131100785114], [-0.876106882196741, 51.61811807314475], [-0.876305643178539, 51.617614643124426], [-0.875030363348109, 51.6174927341714], [-0.874705473526163, 51.61748872204597], [-0.874564111923802, 51.6174810731233], [-0.874279482039409, 51.61730930128958], [-0.874259717266618, 51.61699889890464], [-0.874416434195306, 51.61673604585861], [-0.874423036602998, 51.61652750219062], [-0.870144618410033, 51.61769939147719], [-0.870074692270606, 51.617607003497994], [-0.869665459226217, 51.61768399010514], [-0.869137937974611, 51.617812887107476], [-0.868711126950696, 51.61789959196275], [-0.868460959800069, 51.617969115035805], [-0.866874516019656, 51.61827841686334], [-0.866642434191741, 51.6183175388698], [-0.866517885416195, 51.61833072340073], [-0.866392071649004, 51.61833670224208], [-0.865776872894858, 51.61833166083683], [-0.865633662902087, 51.618340168339564], [-0.865493072065054, 51.618359490991885], [-0.864874419821269, 51.618492883413026], [-0.864829070270363, 51.61851582340227], [-0.8648101986804, 51.61846169086974], [-0.864778464993556, 51.618402038980314], [-0.864733824417545, 51.61833866562683], [-0.864681918741689, 51.61827702035103], [-0.864649512487616, 51.61824433697217], [-0.864492159027339, 51.61812502442397], [-0.864510219622979, 51.618037979732996], [-0.864490008258273, 51.61792179156664], [-0.863791866117017, 51.616668790850674], [-0.863578496430752, 51.61619016667409], [-0.863939572338851, 51.6160749702936], [-0.864141702322916, 51.61602027805823], [-0.864343742093738, 51.615969181278444], [-0.864684853799959, 51.61590144547291], [-0.864287415633653, 51.61573755014447], [-0.864114344880943, 51.615611790807684], [-0.86394143216696, 51.615479738556914], [-0.863424226660599, 51.6150224515856], [-0.863108525016747, 51.61470918210108], [-0.862999136822108, 51.61463618943345], [-0.862947760773663, 51.614611414387845], [-0.862827479233939, 51.614569786988696], [-0.862764327092327, 51.6145538895073], [-0.862690954996651, 51.614542388851355], [-0.862422671693898, 51.614528100870835], [-0.862278208948609, 51.61452939875511], [-0.862025067586916, 51.614544929155834], [-0.861633333855888, 51.61461576315295], [-0.861195617216796, 51.61467715820802], [-0.860991546767721, 51.61469406144679], [-0.860819513274215, 51.61470048511226], [-0.860591345418716, 51.61469917048917], [-0.860366335624517, 51.61468709604235], [-0.860199196800327, 51.61467108707321], [-0.860140174693704, 51.6146633207896], [-0.859842784619867, 51.61460018922178], [-0.85969929013584, 51.61456282905675], [-0.859501466379857, 51.61450336097874], [-0.859306643699259, 51.614439425872085], [-0.859175017225196, 51.614389591981386], [-0.858977780895874, 51.61430675031806], [-0.858172868778381, 51.61392127488393], [-0.856305510909038, 51.61299763777437], [-0.855879431428414, 51.61282624136621], [-0.855413827571698, 51.612676038205095], [-0.855073660630441, 51.61259179657028], [-0.854915624510577, 51.612558784566126], [-0.854688372582268, 51.61252150056368], [-0.854459541396129, 51.6124895957323], [-0.854208848612115, 51.61246556965946], [-0.853413812340721, 51.612436228916096], [-0.851724243907319, 51.61242871018406], [-0.851450292115, 51.612410744947404], [-0.850998615679464, 51.61233888823236], [-0.850653274334699, 51.61223120468302], [-0.850372939737194, 51.61235164666859], [-0.850315593337778, 51.61233490012849], [-0.850193999216673, 51.612288751000705], [-0.850146601119627, 51.612278395984944], [-0.849926028861458, 51.61226274823948], [-0.849854084982468, 51.61225215268858], [-0.849714847013531, 51.612218418620564], [-0.849473435162227, 51.61217019573735], [-0.849372523204365, 51.61216291272777], [-0.849235958321253, 51.61219484371945], [-0.849170915863905, 51.6121969037703], [-0.849112126238191, 51.61218014249445], [-0.8487984760956, 51.61201881385575], [-0.848813983178796, 51.61186251023449], [-0.848805967905994, 51.611779707971536], [-0.848777693193183, 51.61169850541887], [-0.848751669639592, 51.61164250170296], [-0.848740414389996, 51.61163070213332], [-0.848685616135578, 51.61162746733029], [-0.848598109857592, 51.61148993537107], [-0.848561752293423, 51.61144282198033], [-0.848420551583887, 51.61131555337684], [-0.848346143135118, 51.61123120073643], [-0.848017978126262, 51.61073074025961], [-0.84803240586268, 51.61067423405594], [-0.848009203184881, 51.61062095534751], [-0.848010806265629, 51.61061467688053], [-0.848360723390725, 51.61054078070849], [-0.848731046077576, 51.61040234328455], [-0.848814480324059, 51.61035820278237], [-0.848820437461021, 51.610351067821576], [-0.848690278305866, 51.610072847084595], [-0.847947554822518, 51.60900543974003], [-0.847435103308081, 51.6083125448088], [-0.847167998407497, 51.60796823756615], [-0.846186886755928, 51.60662333116728], [-0.845549998419521, 51.605828497430636], [-0.845383680959569, 51.60566770865375], [-0.844840468159951, 51.60522267062485], [-0.84443530295085, 51.60497141150611], [-0.844232696249957, 51.60481835643492], [-0.843486943931864, 51.60416181103064], [-0.84332558359401, 51.60420428093958], [-0.842908147301968, 51.603868373383044], [-0.842663709069561, 51.603714004109015], [-0.842310199280505, 51.603533382087996], [-0.841471682375652, 51.60311958453644], [-0.841215384127901, 51.602977683579475], [-0.840873068217364, 51.60281155440105], [-0.840467421086961, 51.602637605395635], [-0.840268344470896, 51.602516948405764], [-0.840203154295604, 51.60246864832527], [-0.838474883614574, 51.601841924417336], [-0.838334815858368, 51.60178568911777], [-0.838125139250388, 51.60168470536249], [-0.837520083534699, 51.60134782062488], [-0.837365310402971, 51.60124558073874], [-0.837143016970701, 51.6010734356079], [-0.83702163004049, 51.600964332538595], [-0.836879440722268, 51.60082175386177], [-0.836733036616179, 51.60067463738169], [-0.836105420124444, 51.59992210370809], [-0.836001567218505, 51.59980508080317], [-0.835894758960057, 51.59969072601903], [-0.835646409012494, 51.5994652683849], [-0.835572705263831, 51.59941148620318], [-0.835355212679077, 51.599278049641256], [-0.835001490423373, 51.59910819321327], [-0.834666328550124, 51.59894661249016], [-0.834023851532118, 51.59860753956394], [-0.833813699592692, 51.59846967713012], [-0.832219972267628, 51.59727861587006], [-0.831975375091702, 51.59713321406168], [-0.83180286996819, 51.597047874561696], [-0.83156138306724, 51.59695015903964], [-0.831279067386554, 51.596868221715724], [-0.831119729288761, 51.59683246683902], [-0.830996129682144, 51.596810555210986], [-0.830798964246538, 51.59678611250204], [-0.829935838169309, 51.596720865686486], [-0.82967342169104, 51.596707460026586], [-0.829378950815281, 51.59670542343618], [-0.828672101908656, 51.596738836236966], [-0.828529092462618, 51.59674190522934], [-0.828241907711544, 51.596737240965595], [-0.828066024571149, 51.59672739285258], [-0.827854311754233, 51.596707295846045], [-0.827399248313258, 51.59666228882735], [-0.827164974703315, 51.59662128423301], [-0.827063074447412, 51.59659778687348], [-0.826830893268571, 51.59653162563389], [-0.826403126611598, 51.596379885757386], [-0.826320361645679, 51.596342192238744], [-0.826196596762853, 51.596270819297594], [-0.825930135887572, 51.596078429107884], [-0.825702044863314, 51.59590980062742], [-0.825239717878873, 51.595531118786504], [-0.824901250965003, 51.59522021379687], [-0.824412039116432, 51.59470908081712], [-0.8242790371805, 51.59460434384618], [-0.824162427084317, 51.59453573788591], [-0.823734544991122, 51.59433363318264], [-0.822923577534385, 51.59387232098135], [-0.82274220720895, 51.593740122024236], [-0.822758790294358, 51.59343366962803], [-0.822450529949737, 51.592123177421634], [-0.822408018987733, 51.591980681321466], [-0.82236394886053, 51.59184266543808], [-0.822242174035691, 51.59158338051977], [-0.821801765862476, 51.5908065697487], [-0.821372709449585, 51.59009371260957], [-0.821171850754746, 51.58982284235581], [-0.820679968304875, 51.58936291919855], [-0.820417155492676, 51.58914357740762], [-0.82015811620844, 51.5888901042506], [-0.820045903377484, 51.58876399099103], [-0.81975498206002, 51.5884040936899], [-0.819793038416411, 51.58838379523831], [-0.819648800144719, 51.588268149727725], [-0.819147039514258, 51.58763368041164], [-0.818936357700162, 51.58740856531028], [-0.818746726401906, 51.58698404449756], [-0.818744261992127, 51.58691208559554], [-0.818786542624285, 51.586561832259704], [-0.818798419467402, 51.58638211648965], [-0.818772601288344, 51.58593047014409], [-0.818622316220491, 51.585380460186784], [-0.818493730937228, 51.58471737211902], [-0.818460174123387, 51.58461992329734], [-0.818316632401033, 51.58436670899539], [-0.818092592164715, 51.58404524580265], [-0.817774082795079, 51.58341531231479], [-0.817553796530972, 51.58311636524129], [-0.817445537064436, 51.58300557512581], [-0.81689125274485, 51.582562990062094], [-0.816348587477007, 51.58217357091916], [-0.816214612729635, 51.58210837837547], [-0.816144330954904, 51.58209148442308], [-0.816059129697027, 51.58209332267878], [-0.815742672724781, 51.5820523651453], [-0.815217212787465, 51.58194545592985], [-0.815002344756643, 51.58188304223224], [-0.814826435408141, 51.5818210214772], [-0.814485295861823, 51.581730356582035], [-0.81444044205173, 51.581790148477246], [-0.813566956536122, 51.581635656767844], [-0.813282023122958, 51.58154825394594], [-0.813052037332166, 51.581456910143594], [-0.812870182657061, 51.581346270732034], [-0.812790810356639, 51.58129061819263], [-0.812604263086127, 51.581138568732094], [-0.812386509085548, 51.58085492331321], [-0.812249092317067, 51.58070067277682], [-0.812167619564544, 51.58055957666617], [-0.812051961231651, 51.58029045130041], [-0.812042798783181, 51.580254391465495], [-0.812034433182585, 51.580187767648724], [-0.812033188044369, 51.58012481260171], [-0.812058064730261, 51.580000977815104], [-0.81229781440549, 51.579440518478464], [-0.812247901650195, 51.57941753400863], [-0.812446355706805, 51.57916777205078], [-0.81277233113049, 51.578787120404634], [-0.813191367818544, 51.57821318632392], [-0.813476583358647, 51.57767926033569], [-0.81372993476285, 51.57714950751218], [-0.813894821439398, 51.57669169369027], [-0.813998634879093, 51.57614064720803], [-0.814138744624452, 51.57508193151095], [-0.814120940539715, 51.57493428638376], [-0.81419874804071, 51.57321943977239], [-0.814492542549023, 51.572575897898666], [-0.814547744449169, 51.57211787423915], [-0.814549364628156, 51.57200009817749], [-0.81449843948966, 51.57157247390041], [-0.81447275908744, 51.57022974030085], [-0.814470739157426, 51.56964165674743], [-0.814429823166273, 51.56938407823071], [-0.814416473674158, 51.5693425811485], [-0.814362577800679, 51.569251219648685], [-0.81406844007837, 51.5689659058573], [-0.813908308238922, 51.56874308971205], [-0.813853532979604, 51.56863013877188], [-0.81375715260415, 51.56839717647337], [-0.81371284208748, 51.56815934527622], [-0.813667666933597, 51.567788426746645], [-0.813915408556528, 51.567527470860746], [-0.814280993234198, 51.56684059466537], [-0.814704823511867, 51.56613272518902], [-0.814994772052415, 51.56569055892733], [-0.815202529336662, 51.56519091397622], [-0.815219131565213, 51.56505170869626], [-0.815351636137841, 51.564671793906264], [-0.815511116853932, 51.56436408558186], [-0.815565592175225, 51.5642108755608], [-0.815662011458114, 51.564053592855515], [-0.815731002538058, 51.56389693250399], [-0.815762954470268, 51.56377766396064], [-0.815882314039101, 51.56307031436626], [-0.815899206541573, 51.563030920866616], [-0.815918960262566, 51.5629924554096], [-0.816100387305838, 51.56272812828101], [-0.816239061970809, 51.562387838558415], [-0.816351227865814, 51.56217946080997], [-0.816402225233145, 51.562104443964415], [-0.816445731089239, 51.56204014171416], [-0.816755073070336, 51.56173843863565], [-0.81682883069147, 51.5615089920632], [-0.81709149295673, 51.56100450196165], [-0.817126546068515, 51.5610435199925], [-0.817036868291134, 51.56144185218239], [-0.817602599672938, 51.56148891511105], [-0.817650902097453, 51.56129517879352], [-0.81772376875861, 51.56109989153342], [-0.818544773098936, 51.56114952106405], [-0.818940645385275, 51.56112652991029], [-0.819286252234888, 51.56087194248433], [-0.820505192935939, 51.560762809232635], [-0.821152924392013, 51.56109751750433], [-0.821401734784996, 51.56112699167495], [-0.821468077854438, 51.561127657861135], [-0.821837057068471, 51.56108460493917], [-0.822551882107614, 51.56083281445182], [-0.822991148836609, 51.56069335159132], [-0.823298868990794, 51.56056425765945], [-0.823427756279142, 51.560489119484224], [-0.823816316952276, 51.56018999039105], [-0.823841530161624, 51.56016326766115], [-0.823879440321637, 51.5600917131651], [-0.823939663402364, 51.55926686943448], [-0.824000930577316, 51.55924050793579], [-0.823876052668265, 51.55798579953388], [-0.823797968341331, 51.557154174451156], [-0.823813910366727, 51.55698348995032], [-0.824268965579194, 51.556733581409404], [-0.824612742777356, 51.55649154853787], [-0.826344281900068, 51.55484359477631], [-0.826657025878971, 51.55457337099326], [-0.827233265990788, 51.554040521447654], [-0.827929376968602, 51.55344502444081], [-0.828029419518581, 51.553368693973354], [-0.828246668974642, 51.55322159923911], [-0.828485269800709, 51.5530855074047], [-0.828605105979095, 51.55302466009866], [-0.829372820563392, 51.55267264797847], [-0.830416538296143, 51.552300003050114], [-0.830341853307235, 51.55217517181714], [-0.830015969895102, 51.55217192349864], [-0.82991663595149, 51.55216463892005], [-0.829524156953837, 51.55211486704629], [-0.829282415323888, 51.552092673855796], [-0.828838545910614, 51.55207835426137], [-0.828599504055965, 51.55206338004898], [-0.828680519991051, 51.55199764928292], [-0.828534433277995, 51.55195752639793], [-0.828384829125967, 51.55188589688778], [-0.827987906418731, 51.55167242458396], [-0.827957477145366, 51.551621766572], [-0.827834232346298, 51.55159086272802], [-0.827633977763617, 51.551525919798664], [-0.827259642164726, 51.55144395104261], [-0.826879262755715, 51.5513727108443], [-0.826619197529414, 51.551334143723224], [-0.825020961294276, 51.55117248609027], [-0.825087548806697, 51.55099511486544], [-0.825080332863119, 51.55093929339289], [-0.825041927300218, 51.55086247849746], [-0.82502361605882, 51.55078946149474], [-0.825044884876699, 51.55069166368164], [-0.825058487270179, 51.550667521970404], [-0.82509857658956, 51.550622964257876], [-0.825145597538488, 51.55058926609727], [-0.825325151596322, 51.5505056412203], [-0.824909915146001, 51.550164291306395], [-0.82525013660448, 51.550002248032946], [-0.825332063085088, 51.549957209837], [-0.825638185418255, 51.54977504214384], [-0.82578350044032, 51.54967668704559], [-0.825923116734683, 51.54957557721289], [-0.826170603160388, 51.54937393870707], [-0.826371785812396, 51.54917813090106], [-0.826492161334072, 51.549039961540565], [-0.826611394860751, 51.548890091280356], [-0.82670116630089, 51.54876420424681], [-0.826782355507479, 51.54863553380353], [-0.826823019292071, 51.54856850170786], [-0.827062757600335, 51.548106920435835], [-0.827101368877001, 51.54800749719491], [-0.827194201898492, 51.54770629998806], [-0.827307057244965, 51.54741159704493], [-0.827582602426052, 51.54684696658141], [-0.827901482950928, 51.54639156924703], [-0.828226190833503, 51.54604592938406], [-0.828636291311094, 51.545744301711125], [-0.82879259021163, 51.54566673370386], [-0.828904643767125, 51.545627388779295], [-0.829074413403866, 51.54558682127211], [-0.829642313890905, 51.54554213206049], [-0.831137752395514, 51.5457125947128], [-0.831296230672639, 51.545718668970665], [-0.831381409559054, 51.545715021306385], [-0.831520416985355, 51.54569302674314], [-0.831658465956176, 51.54565213966273], [-0.832162223002951, 51.54540897973132], [-0.832259763552867, 51.545373083913695], [-0.832342495362879, 51.54535232675641], [-0.832449690786029, 51.545333611293344], [-0.832560958333776, 51.54532482723805], [-0.832748224427793, 51.54533298427906], [-0.833594396864807, 51.5455158387706], [-0.833803468208608, 51.5455736658201], [-0.834066591719905, 51.54566080332341], [-0.834319302360527, 51.54576042533909], [-0.834632701147966, 51.545911902800114], [-0.834743597643834, 51.54597414830218], [-0.834972095381443, 51.546118487532766], [-0.835101437527799, 51.546192605160904], [-0.835308853525451, 51.54642845092972], [-0.835597379030446, 51.546650714213946], [-0.835675530378703, 51.54669644865621], [-0.835765285050956, 51.54673960061442], [-0.835946924814448, 51.54679895002405], [-0.836738145066418, 51.54693268079673], [-0.837616543696299, 51.54698454508781], [-0.837668585980954, 51.546979665457], [-0.837867989708348, 51.546964555807335], [-0.83797367625272, 51.54694851789646], [-0.838105566972017, 51.54692284834119], [-0.838233315283634, 51.54688994418392], [-0.838329229403341, 51.54686122067977], [-0.838482151664417, 51.546802489195365], [-0.839036827411148, 51.54642762424692], [-0.83955396219585, 51.54605418383688], [-0.840116011657223, 51.54567219327131], [-0.840736658187885, 51.54525391246058], [-0.840941426195899, 51.54514083988849], [-0.841049279937165, 51.54509604683764], [-0.841194847094701, 51.5450426342828], [-0.841299520083949, 51.545009498946165], [-0.841898633062652, 51.544870644649805], [-0.842282244574123, 51.54481328536381], [-0.842762474116396, 51.54475597844143], [-0.843565178344648, 51.54477737891959], [-0.844086979548171, 51.54484366398717], [-0.845732620874625, 51.545006428046236], [-0.847066038668597, 51.54519847249473], [-0.847735465249349, 51.545415455459946], [-0.84773690700669, 51.54541546961599], [-0.848634731053663, 51.54572550693968], [-0.849946581441456, 51.54620234699594], [-0.850255922443757, 51.54628810259981], [-0.850450510421732, 51.5463493547082], [-0.850677807173489, 51.54642891042725], [-0.850994850981171, 51.546552505063595], [-0.852786328510159, 51.547342426670774], [-0.85300310746802, 51.547496506935786], [-0.853571212311598, 51.54778799706584], [-0.854020445083318, 51.54798930492918], [-0.854581807452525, 51.548205193183556], [-0.85478620907829, 51.54827822314386], [-0.854963577157503, 51.54833660211785], [-0.855161244465997, 51.54839068294659], [-0.855663052553423, 51.5485088736389], [-0.856166529832507, 51.54867563412252], [-0.856279761006, 51.54870371304979], [-0.856530960852844, 51.54875111981111], [-0.856804082121709, 51.54878705024175], [-0.857112033920981, 51.54881432744164], [-0.857381573472553, 51.548820548731904], [-0.857549123049589, 51.54881049056259], [-0.857844479857821, 51.548764809719025], [-0.858057604662229, 51.54872012637499], [-0.858337617310588, 51.54865361386837], [-0.858552497890933, 51.54859635820055], [-0.859049392399301, 51.548450127924276], [-0.859439117962245, 51.5483792842905], [-0.859697682244768, 51.54836291412634], [-0.859779823131423, 51.54836551056866], [-0.860170027263243, 51.548390881318824], [-0.860456238387038, 51.54842243448379], [-0.861009536104037, 51.548500639150554], [-0.861158816462501, 51.54852906321894], [-0.861352413335375, 51.54857320311727], [-0.861544411683264, 51.54862362144007], [-0.861731905414109, 51.5486811891874], [-0.862073439754406, 51.548807688741114], [-0.86254414698236, 51.54901726458452], [-0.86282747298222, 51.54916477803516], [-0.863015068128655, 51.549276295417606], [-0.863120154717426, 51.549342054318615], [-0.863285809311142, 51.54946594721784], [-0.863418211576468, 51.54959311456195], [-0.863530092020445, 51.54973357070672], [-0.863653360363745, 51.549937978681236], [-0.863733641061499, 51.550131180181424], [-0.863790336700716, 51.5503448343906], [-0.863824973966162, 51.550691353426465], [-0.863841717303786, 51.55100353042492], [-0.863889686614544, 51.55116225019172], [-0.863971345177536, 51.55135816235228], [-0.864192531443895, 51.5518009005184], [-0.864636908176204, 51.552606367995786], [-0.864885616784935, 51.55304487507487], [-0.864984710926909, 51.55317801261536], [-0.865042267578469, 51.5532415116859], [-0.86524661818949, 51.553434113390985], [-0.866448255146234, 51.55464702695421], [-0.866553639357719, 51.55475954277147], [-0.86713929523259, 51.555454866418074], [-0.86728119491555, 51.55560729781788], [-0.867357192432134, 51.55568356216347], [-0.867846797612144, 51.55612348793147], [-0.867948777192819, 51.5561991033314], [-0.868039688780355, 51.55625572917072], [-0.868162193200772, 51.55631805467487], [-0.868334859667638, 51.55639345221028], [-0.868507816648064, 51.556457162985154], [-0.868686743286876, 51.556512838449954], [-0.868885971532242, 51.55656421341042], [-0.869870431325262, 51.55700170522159], [-0.870538382015661, 51.557289577406756], [-0.87065953954758, 51.55734829060127], [-0.870968323528286, 51.55751940747054], [-0.871084688448939, 51.55759695683154], [-0.871173919806704, 51.55766345498963], [-0.871421843971099, 51.55790412108149], [-0.871517352960249, 51.558008444760674], [-0.871560414081151, 51.55807539786269], [-0.871689483441928, 51.558339198343305], [-0.871715457861831, 51.558455441841], [-0.871819115572425, 51.558871857901316], [-0.872116688986198, 51.559438501590606], [-0.87224925001588, 51.559678057158926], [-0.872395481580982, 51.5598898694294], [-0.872503199025109, 51.56002578071336], [-0.872616797176149, 51.56015725249727], [-0.872767427555836, 51.560307962534345], [-0.873712440787397, 51.560887112412736], [-0.874019840047307, 51.56105730856152], [-0.874413245272104, 51.56124990894107], [-0.875159636577155, 51.56157807024888], [-0.875469862748955, 51.561692540724444], [-0.875618818634067, 51.561736229028845], [-0.87605776549836, 51.56183754414599], [-0.876366373823489, 51.56190074371407], [-0.87668521195865, 51.561958645316366], [-0.876968369886447, 51.56200091867397], [-0.877197163756339, 51.56202468778881], [-0.877516822654725, 51.5620493254706], [-0.878098847659676, 51.56208186543848], [-0.879220205739232, 51.56212315048378], [-0.879742407250114, 51.562124539056946], [-0.8803196812009, 51.56211566057546], [-0.88047709073344, 51.562109069498774], [-0.880781923890852, 51.5620912956137], [-0.881058065229737, 51.56206695318683], [-0.881262135404653, 51.56204012483733], [-0.881418631531618, 51.562011943580096], [-0.881649213834679, 51.56196288783239], [-0.882003250428868, 51.56187993977645], [-0.882376388095226, 51.56178278572967], [-0.882764299497775, 51.56167138432022], [-0.883194585739291, 51.561537905452155], [-0.883498576630078, 51.5614364931922], [-0.883756281221724, 51.56134003501421], [-0.884086956514705, 51.56120920221847], [-0.884407665982054, 51.56107287871968], [-0.885457870533961, 51.5606602434964], [-0.885606584631741, 51.56059601575753], [-0.88578613479336, 51.56050960117672], [-0.88595858283258, 51.56041862303493], [-0.886091760097573, 51.560340759581955], [-0.886521253482028, 51.56006159461465], [-0.886883345687433, 51.559824949307504], [-0.887389733197074, 51.559468282123994], [-0.887580604245187, 51.55927227271282], [-0.887708691217493, 51.559107139161064], [-0.888191015763102, 51.55861266662589], [-0.888192457957821, 51.55861268028735], [-0.888287760756616, 51.55849039596854], [-0.888562664893145, 51.558278995716826], [-0.888677108662246, 51.55814070717499], [-0.888887527216288, 51.55791161122132], [-0.889030158653071, 51.55774121885465], [-0.889203011709727, 51.557514464273005], [-0.88945350380216, 51.55717964382524], [-0.889600043815338, 51.556967026485395], [-0.889736358446423, 51.55670036168757], [-0.889858423154084, 51.55648571413559], [-0.889957478394766, 51.55626815130874], [-0.88999480235023, 51.556157006507235], [-0.890171676314085, 51.5555274577222], [-0.89040150985715, 51.554855248874496], [-0.891496918227321, 51.55316795557777], [-0.892148150167392, 51.55212836271704], [-0.892302414411729, 51.5517746441604], [-0.892679622502675, 51.55097074336506], [-0.892968782461996, 51.55046633574481], [-0.893655961353766, 51.54930928124159], [-0.894173495307085, 51.548604708475054], [-0.894625223197592, 51.54805597035748], [-0.895275002004698, 51.547308578527485], [-0.895581553072133, 51.54691762432374], [-0.89567259455686, 51.54679079793778], [-0.895853734572665, 51.54651645501248], [-0.896746527292651, 51.54508077321264], [-0.896901839906062, 51.544860136456265], [-0.897255891587921, 51.54494888564188], [-0.898115394177492, 51.545187148067974], [-0.89822539056202, 51.54523044209882], [-0.898280925208036, 51.54525973711452], [-0.898317695099433, 51.54528975512979], [-0.898473190139101, 51.54530020648797], [-0.899619101095523, 51.54544313546729], [-0.901006352145532, 51.54562517973134], [-0.901825064903737, 51.54570208025918], [-0.903152296119515, 51.54586195719927], [-0.903215411109321, 51.54587603470979], [-0.903297183099556, 51.545893883241035], [-0.903017403675823, 51.54655396139701], [-0.902616538461231, 51.54745118838641], [-0.902395351374664, 51.54801290343283], [-0.902224993241029, 51.54837997226972], [-0.902166365216381, 51.54859882282856], [-0.902146545476892, 51.54876318664974], [-0.902208891983797, 51.54892921824649], [-0.902230894835185, 51.549033728477525], [-0.902380735585514, 51.54999904656443], [-0.902673692529055, 51.551610411429984], [-0.902806620567669, 51.55250003963136], [-0.902816651036337, 51.55268266601908], [-0.902804979597758, 51.55292803179951], [-0.902756997764027, 51.55318384821566], [-0.902654701329301, 51.55353896524768], [-0.902427419928527, 51.55423280167036], [-0.901847751389036, 51.555843197130926], [-0.901770133963284, 51.556011515784924], [-0.90172081219273, 51.556082988265544], [-0.902203201151337, 51.55617741874876], [-0.906010818638152, 51.55679743475821], [-0.906204734572883, 51.556771367660915], [-0.906311884484255, 51.55675438267928], [-0.906358975073264, 51.55689599188705], [-0.90638590166065, 51.55691602462513], [-0.906615524939952, 51.55696492104195], [-0.907278267614382, 51.55705831304524], [-0.907858939004531, 51.55720578727805], [-0.908174621569804, 51.5572752632291], [-0.908339760107985, 51.55730647205926], [-0.908420198492941, 51.557320707807335], [-0.908923514869315, 51.557385632424236], [-0.909322889103033, 51.5574540848968], [-0.909506497855653, 51.557497152980005], [-0.909658336207082, 51.557541723987356], [-0.909754316957776, 51.55756959081508], [-0.909871264277585, 51.557625526703404], [-0.91002439519459, 51.55767640345812], [-0.91014009429463, 51.557724234915874], [-0.910363938659539, 51.55783421414451], [-0.910769828656022, 51.55805288423369], [-0.910899633150579, 51.55817457810929], [-0.911134211672749, 51.55843931338367], [-0.911191431662737, 51.558519870694006], [-0.911262279817118, 51.55863382382822], [-0.911345597527786, 51.558829717406], [-0.911347039740573, 51.55882973078292], [-0.911354152248679, 51.55895478193117], [-0.911501156990394, 51.55932300828838], [-0.911744284152759, 51.55977395051585], [-0.911784714781588, 51.55983277167005], [-0.911848028397377, 51.559899897522016], [-0.911951124589094, 51.55999256899618], [-0.912043240814804, 51.56006176008463], [-0.912343203354435, 51.560247072388215], [-0.91252735254784, 51.560389049785144], [-0.912663001694362, 51.56050809825428], [-0.913644040185922, 51.561715780647766], [-0.914729932802775, 51.56149024267299], [-0.915936249212879, 51.561720788632314], [-0.917099342153636, 51.56255696600573], [-0.917716153850379, 51.56209778262442], [-0.918510926061236, 51.561494569835055], [-0.919190082061234, 51.56187308324347], [-0.919265061021478, 51.56187467281339], [-0.919319677161742, 51.561883268238525], [-0.919395565855925, 51.56190734542486], [-0.919450182060758, 51.561915940789575], [-0.919451624375034, 51.56191595406745], [-0.919612764956992, 51.561873377936905], [-0.919684473323871, 51.562134798108005], [-0.919731696029427, 51.56227280618616], [-0.919795125391412, 51.562396576626476], [-0.919877773921036, 51.56250074208832], [-0.920024454979703, 51.56264236275641], [-0.920273793481437, 51.562835281288635], [-0.920455811890565, 51.56300779833283], [-0.92054707457537, 51.56311384087594], [-0.920622684574115, 51.56321074767881], [-0.920768557091237, 51.56344767224896], [-0.920815933327546, 51.56357938704838], [-0.92087756775181, 51.56365728255545], [-0.920897207761338, 51.56368084160506], [-0.920950783915168, 51.5637334861553], [-0.921113636188415, 51.563862665653886], [-0.921195103215065, 51.56395602921301], [-0.921351882125165, 51.56422002842434], [-0.921395592904906, 51.56432383493418], [-0.921420893006769, 51.56441308549212], [-0.921438619701684, 51.56451755238376], [-0.921413985191466, 51.56464410933019], [-0.92167481147157, 51.56453500840272], [-0.923479752756133, 51.56373602685831], [-0.924155377789785, 51.5634113259626], [-0.924873111301507, 51.56399247344971], [-0.924951149378637, 51.56404803772923], [-0.925274524870032, 51.56428388466152], [-0.92664770764064, 51.56515336065692], [-0.927393574791524, 51.56558368874587], [-0.927927453464337, 51.5659491340051], [-0.92835633038721, 51.56599441223158], [-0.928244524844939, 51.56725223174753], [-0.928125342518282, 51.56741209518939], [-0.9281054698832, 51.56745956981058], [-0.927839528670842, 51.568092855254655], [-0.93052584537502, 51.568532778436946], [-0.930434864440691, 51.56872077542371], [-0.930290537945866, 51.568968530677175], [-0.93032458943141, 51.568993118606556], [-0.930407160146686, 51.56904062792432], [-0.930494248489543, 51.56908008580425], [-0.93056005729139, 51.5691040638391], [-0.930644619283805, 51.56912821268005], [-0.930755210497826, 51.569149901051155], [-0.931002865082897, 51.56917193845677], [-0.931506345671459, 51.5692367670135], [-0.9319179887186, 51.56928007686346], [-0.93222706378822, 51.569328746497334], [-0.932389335623021, 51.56936169347699], [-0.932508352034028, 51.56939334769875], [-0.932608510110525, 51.56942932617174], [-0.932871163025979, 51.56955040480943], [-0.933086053531851, 51.569616199317096], [-0.933414865356232, 51.569684826955594], [-0.93386895042082, 51.56976448240679], [-0.934635570791928, 51.5700537823344], [-0.934785550106084, 51.57011898456062], [-0.934985327167408, 51.57021431104797], [-0.935122135234023, 51.5702874858722], [-0.935333952219633, 51.570423383659445], [-0.935683954424458, 51.570697207984594], [-0.935948857561102, 51.57084617434456], [-0.936321009353978, 51.57109861741231], [-0.936776166293208, 51.57138058458356], [-0.936874033955222, 51.57139136186155], [-0.937185388877335, 51.57140497135624], [-0.937358713203379, 51.57139754881963], [-0.937474500211682, 51.571382411871916], [-0.937604964789291, 51.57135661760672], [-0.938082770631526, 51.571224267138255], [-0.938303744516349, 51.57115343316592], [-0.938622419406116, 51.57103852370375], [-0.938583754985448, 51.57127375671787], [-0.938615426417796, 51.5714008261012], [-0.938651384040882, 51.57152973256723], [-0.938810396393867, 51.572013125409214], [-0.938917102284257, 51.5723881447753], [-0.938977920287056, 51.572564931845086], [-0.939147081147104, 51.57298457478389], [-0.93921529881351, 51.57340150695511], [-0.939295227462625, 51.57374930879435], [-0.939359853061118, 51.57401065198471]]]}}

benchmarks/json-data/integers.jsondeleted−1

@@ -1 +0,0 @@

1−[1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 2, 2, 2, 2, 2, 2, 2, 3, 3, 3, 3, 3, 4, 4, 4, 4, 5, 5, 5, 6, 6, 7, 7, 7, 8, 9, 9, 10, 10, 11, 12, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 23, 24, 26, 27, 29, 31, 33, 35, 37, 39, 42, 44, 47, 50, 53, 56, 60, 63, 67, 72, 76, 81, 86, 91, 96, 102, 109, 115, 122, 130, 138, 146, 155, 165, 175, 186, 197, 209, 222, 236, 250, 266, 282, 299, 318, 337, 358, 380, 403, 428, 454, 482, 511, 543, 576, 611, 649, 688, 730, 775, 823, 873, 926, 983, 1043, 1107, 1175, 1247, 1323, 1404, 1490, 1582, 1679, 1781, 1890, 2006, 2129, 2259, 2398, 2544, 2700, 2865, 3041, 3227, 3425, 3634, 3857, 4093, 4343, 4609, 4891, 5191, 5509, 5846, 6204, 6583, 6986, 7414, 7868, 8349, 8860, 9403, 9978, 10589, 11237, 11925, 12655, 13430, 14252, 15124, 16050, 17032, 18075, 19181, 20355, 21601, 22923, 24326, 25815, 27396, 29072, 30852, 32740, 34744, 36871, 39128, 41523, 44064, 46762, 49624, 52661, 55884, 59305, 62935, 66787, 70875, 75213, 79817, 84702, 89887, 95389, 101227, 107423, 113998, 120976, 128381, 136239, 144578, 153427, 162818, 172784, 183360, 194583, 206493, 219132, 232545, 246778, 261883, 277912, 294923, 312975, 332131, 352460, 374034, 396928, 421223, 447005, 474365, 503400, 534212, 566911, 601610, 638433, 677511, 718980, 762987, 809688, 859247, 911840, 967652, 1026880, 1089734, 1156434, 1227217, 1302333, 1382046, 1466638, 1556408, 1651673, 1752769, 1860052, 1973902, 2094721, 2222934, 2358996, 2503385, 2656613, 2819219, 2991777, 3174898, 3369227, 3575451, 3794297, 4026539, 4272995, 4534536, 4812086, 5106625, 5419191, 5750889, 6102889, 6476435, 6872845, 7293518, 7739939, 8213686, 8716429, 9249944, 9816115, 10416939, 11054539, 11731166, 12449207, 13211198, 14019829, 14877955, 15788605, 16754994, 17780533, 18868844, 20023768, 21249383, 22550016, 23930257, 25394980, 26949356, 28598872, 30349352, 32206975, 34178300, 36270285, 38490317, 40846232, 43346349, 45999492, 48815029, 51802899, 54973651, 58338478, 61909260, 65698602, 69719882, 73987297, 78515911, 83321713, 88421668, 93833782, 99577160, 105672079, 112140056, 119003924, 126287916, 134017747, 142220706, 150925751, 160163614, 169966908, 180370243, 191410345, 203126189, 215559137, 228753081, 242754599, 257613123, 273381107, 290114218, 307871529, 326715729, 346713346, 367934976, 390455540, 414354543, 439716356, 466630515, 495192035, 525501749, 557666661, 591800322, 628023236, 666463282, 707256166, 750545902, 796485316, 845236589, 896971830, 951873682, 1010135966, 1071964368, 1137577163, 1207205986, 1281096650, 1359510014, 1442722903, 1531029087, 1624740315, 1724187420, 1829721484, 1941715077, 2060563573, 2186686548, 2320529259, 2462564214, 2613292844, 2773247272, 2942992191, 3123126858, 3314287206, 3517148098, 3732425698, 3960880011, 4203317554, 4460594215, 4733618266, 5023353573, 5330822998, 5657112012, 6003372524, 6370826950, 6760772526, 7174585891, 7613727944, 8079749004, 8574294281, 9099109685, 9656047991, 10247075377, 10874278366, 11539871197, 12246203633, 12995769265, 13791214310, 14635346955, 15531147272, 16481777734, 17490594386, 18561158687, 19697250088, 20902879371, 22182302812, 23540037202, 24980875800, 26509905246, 28132523526, 29854459026, 31681790754, 33620969802, 35678842122, 37862672691, 40180171161, 42639519077, 45249398761, 48019023960, 50958172379, 54077220194, 57387178688, 60899733121, 64627283986, 68582990784, 72780818484, 77235586822, 81963022620, 86979815309, 92303675844, 97953399235, 103948930895, 110311437058, 117063379497, 124228594829, 131832378662, 139901574895, 148464670491, 157551896043, 167195332496, 177429024407, 188289100133, 199813899374, 212044108527, 225022904322, 238796106249, 253412338321, 268923200725, 285383451995, 302851202324, 321388118716, 341059642687, 361935221296, 384088552321, 407597844432, 432546093294, 459021374572, 487117154867, 516932621682, 548573033590, 582150091830, 617782334651, 655595555791, 695723248569, 738307077168, 783497376747, 831453684183, 882345301285, 936351892486, 993664119121, 1054484312524, 1119027188325, 1187520604468, 1260206365627, 1337341076854, 1419197049486, 1506063262491, 1598246382662, 1696071847252, 1799885012878, 1910052374747, 2026962860500, 2151029203266, 2282689398739, 2422408251457, 2570679015712, 2728025136906, 2895002099486, 3072199387991, 3260242568131, 3459795495242, 3671562657914, 3896291665080, 4134775885316, 4387857247705, 4656429214122, 4941439933460, 5243895588908, 5564863950114, 5905478142772, 6266940648935, 6650527552175, 7057593042589, 7489574197539, 7947996055022, 8434476997558, 8950734465625, 9498591020797, 10079980779998, 10696956243580, 11351695541337, 12046510122031, 12783852913581, 13566326982715, 14396694724673, 15277887615381, 16213016560543, 17205382878181, 18258489953389, 19376055606456, 20562025218016, 21820585657560, 23156180064488, 24573523533875, 26077619762337, 27673778712750, 29367635360200, 31165169585327, 33072727285306, 35097042776985, 37245262571278, 39524970602741, 41944215003394, 44511536515321, 47235998642351, 50127219647252, 53195406507421, 56451390948928, 59906667686130, 63573435001862, 67464637811456, 71594013362620, 75976139732519, 80626487293267, 85561473327514, 90798519986944, 96356115798305, 102253880934088, 108512636478302, 115154477931865, 122202853217119, 129682645456833, 137620260819954, 146043721744222, 154982765864743, 164468950997792, 174535766550465, 185218751749486, 196555621106568, 208586397563259, 221353553785311, 234902162105402, 249280053643550, 264537987166964, 280729828285480, 297912739615178, 316147382581544, 335498131574595, 356033301212013, 377825387512598, 400951323831468, 425492752460545, 451536312853150, 479173947490266, 508503226468250, 539627691953919, 572657223723034, 607708427072674, 644905044476938, 684378392439283, 726267825083707, 770721226121430, 817895530929871, 867957280587026, 921083209817197, 977460870923688, 1037289295911185, 1100779699135317, 1168156222959992, 1239656729054927, 1315533638126921, 1396054821049394, 1481504544536185, 1572184474698156, 1668414742025481, 1770535071555377, 1878905982215138, 1993910059574563, 2115953306501003, 2245466576485316, 2382907094698829, 2528760072151156, 2683540418647385, 2847794560591953]

benchmarks/json-data/jp10.jsondeleted−1

@@ -1 +0,0 @@

1−{"results":[{"from_user_id_str":"2458313","profile_image_url":"http://a2.twimg.com/profile_images/1203653060/fure091226_normal.png","created_at":"Thu, 27 Jan 2011 20:30:04 +0000","from_user":"19princess","id_str":"30724239224995840","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6d77\u6674\u300c\u672c\u65e5\u306e\u6771\u4eac\u306e\u304a\u5929\u6c17\u306f\u6674\u6642\u3005\u66c7\u3067\u3057\u3087\u3046\u3002\u6700\u9ad8\u6c17\u6e29\u306f8\u5ea6\u3001\u6700\u4f4e\u6c17\u6e29\u306f1\u5ea6\u3067\u3059\u3002\u3042\u306a\u305f\u306e\u4eca\u65e5\u306e\u4eba\u751f\u306b\u3068\u3073\u3063\u304d\u308a\u306e\u304a\u5929\u6c17\u3092\u2665\u300d","id":30724239224995840,"from_user_id":2458313,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://babyprincess.sakura.ne.jp/about/" rel="nofollow">\u5929\u4f7f\u5bb6\u306e\u88cf\u5c71</a>"},{"from_user_id_str":"66578965","profile_image_url":"http://a0.twimg.com/profile_images/1183763267/fossetta_normal.png","created_at":"Thu, 27 Jan 2011 20:00:04 +0000","from_user":"Fossetta_Tokyo","id_str":"30716689779785729","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u304a\u306f\u3088\u3046\u3054\u3056\u3044\u307e\u3059!!\u6771\u4eac\u90fd\u3001\u672c\u65e5\u306e\u304a\u5929\u6c17\u306f\u6674\u6642\u3005\u66c7\u3002\u6700\u9ad8\u6c17\u6e298\u5ea6\u3001\u6700\u4f4e\u6c17\u6e291\u5ea6\u3002\u6771\u4eac\u5730\u65b9\u3067\u306f\u3001\u7a7a\u6c17\u306e\u4e7e\u71e5\u3057\u305f\u72b6\u614b\u304c\u7d9a\u3044\u3066\u3044\u307e\u3059\u3002\u706b\u306e\u53d6\u308a\u6271\u3044\u306b\u6ce8\u610f\u3057\u3066\u4e0b\u3055\u3044\u3002\u4f0a\u8c46\u8af8\u5cf6\u3068\u5c0f\u7b20\u539f\u8af8\u5cf6\u306b\u306f\u3001\u5f37\u98a8\u3001\u6ce2\u6d6a\u3001\u4e7e\u71e5\u3001\u971c\u306e\u6ce8\u610f\u5831\u3092\u767a\u8868\u4e2d\u3067\u3059\u3002","id":30716689779785729,"from_user_id":66578965,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://bit.ly/Fossetta" rel="nofollow">\u30d5\u30a9\u30bb\u30c3\u30bf ver.3.1.1</a>"},{"from_user_id_str":"104041146","profile_image_url":"http://a2.twimg.com/profile_images/863965118/001jwatokyo_normal.jpg","created_at":"Thu, 27 Jan 2011 19:44:33 +0000","from_user":"jwa_tokyo","id_str":"30712787537756160","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6c17\u8c61\u5e81\u304b\u3089\u6771\u4eac\u306e\u5929\u6c17\u4e88\u5831\u304c\u767a\u8868\u3055\u308c\u307e\u3057\u305f\u3000\u305d\u306e\u5929\u6c17\u4e88\u5831\u3092\u3053\u3053\u3067\u3064\u3076\u3084\u3053\u3046\u304b\u306a\u3041\uff5e\uff1f\u3000\u8003\u3048\u4e2d\u3000\u307e\u3066\u6b21\u53f7\uff08\u7b11","id":30712787537756160,"from_user_id":104041146,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.docodemo.jp/twil/" rel="nofollow">Twil2 (Tweet Anytime, Anywhere by Mail)</a>"},{"from_user_id_str":"144500192","profile_image_url":"http://a3.twimg.com/a/1294874399/images/default_profile_3_normal.png","created_at":"Thu, 27 Jan 2011 18:59:33 +0000","from_user":"kyo4to4","id_str":"30701462774358016","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u90fd \u516b\u4e08\u5cf6 - \u4eca\u65e5\u306e\u5929\u6c17\u306f\u30fb\u30fb\u30fb\u66c7\u306e\u3061\u6674\u3067\u3059\u306e\uff01","id":30701462774358016,"from_user_id":144500192,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/kyo4to4" rel="nofollow">lost-sheep-bot</a>"},{"from_user_id_str":"165724582","profile_image_url":"http://a0.twimg.com/profile_images/1222842347/163087_1256281064506_1753997852_484926_2761052_n_normal.jpg","created_at":"Thu, 27 Jan 2011 17:39:06 +0000","from_user":"Rifqi_19931020","id_str":"30681213748387840","metadata":{"result_type":"recent"},"to_user_id":113796067,"text":"@CHLionRagbaby \u30b1\u30f3\u3061\u3083\u3093\u3001\u671d\u4eca\u307e\u3067\u306e\u81ea\u5206\u306e\u30db\u30fc\u30e0\u30a8\u30ea\u30a2\u304b\u3089\u307e\u3060\u975e\u5e38\u306b\u5bd2\u3044\u3068\u96e8\u304c\u964d\u3063\u3066\u3044\u305f..\u3069\u306e\u3088\u3046\u306b\u73fe\u5728\u306e\u6771\u4eac\u306e\u5929\u6c17\uff1f","id":30681213748387840,"from_user_id":165724582,"to_user":"CHLionRagbaby","geo":null,"iso_language_code":"ja","to_user_id_str":"113796067","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"120911929","profile_image_url":"http://a0.twimg.com/profile_images/772435076/20100312___capture2_normal.png","created_at":"Thu, 27 Jan 2011 17:28:30 +0000","from_user":"Cirno_fan","id_str":"30678546020040705","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u65e5\u306e\u6771\u4eac\u306e\u5929\u6c17\u306f\u3001\u66c7\u6642\u3005\u6674\u3067\u6700\u9ad8\u6c17\u6e29\u306f8\u2103\uff01 \u6700\u4f4e\u6c17\u6e29\u306f2\u2103\u3060\u3063\u305f\u3088\uff01 RT @mimi22999 \uff08\uff65\u2200\uff65\uff09\uff4c\u3001\u865a\u5f31\u306a\u8005\u306b\u3068\u3063\u3066\u3001\u6717\u3089\u304b\u306a\u9854\u306f\u4e0a\u5929\u6c17\u3068\u540c\u3058\u304f\u3089\u3044\u3046\u308c\u3057\u3044\u3082\u306e\u3060\u3002\u30d5\u30e9\u30f3\u30af\u30ea\u30f3 #tenki #bot","id":30678546020040705,"from_user_id":120911929,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://blog.livedoor.jp/fairycirno/archives/34686.html" rel="nofollow">\u5e7b\u60f3\u90f7 \u9727\u306e\u6e56</a>"},{"from_user_id_str":"65976527","profile_image_url":"http://a0.twimg.com/profile_images/452810990/little_italies_____normal.jpg","created_at":"Thu, 27 Jan 2011 17:00:03 +0000","from_user":"heta_weather01","id_str":"30671388754845696","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u30d8\u30bf\u5929\u3011Tere hommikust.\u30a8\u30b9\u30c8\u30cb\u30a2\u3067\u3059\u3002\u4eca\u65e5\u306e\u6771\u4eac\u306e\u5929\u6c17\u306f\u6674\u6642\u3005\u66c7\u3067\u660e\u65e5\u306f\u66c7\u308a\u3067\u3059\u3002\u3061\u306a\u307f\u306b\u50d5\u306e\u3068\u3053\u308d\u3067\u306f\u66c7\u308a\u3067\u6c17\u6e29-7\u2103\u3067\u3059\u3002\u3061\u306a\u307f\u306b\u30b9\u30ab\u30a4\u30d7\u306e\u958b\u767a\u672c\u90e8\u306f\u50d5\u306e\u5bb6\u306b\u3042\u308b\u3093\u3067\u3059\u3002","id":30671388754845696,"from_user_id":65976527,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www15.atpages.jp/~kageyanma/" rel="nofollow">\u5730\u7403\u306e\u4e2d</a>"},{"from_user_id_str":"7278433","profile_image_url":"http://a3.twimg.com/profile_images/1218965303/michael-1_normal.png","created_at":"Thu, 27 Jan 2011 16:50:16 +0000","from_user":"shimohiko","id_str":"30668926035689472","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3042\u308a\u3002\n\u3010\u7f8e\u4eba\u5929\u6c17/\u6771\u4eac\u3011\u7f8e\u4eba\u5929\u6c17\u30ad\u30e3\u30b9\u30bf\u30fc\u306e"\u3055\u3042\u3084\u3093\u3055\u3093"\u306b\u3088\u308b\u3068\u300c1/29(\u571f)\u306f\u304f\u3082\u308a\u3067\u3001\u964d\u6c34\u78ba\u738740%\u3001\u6700\u9ad8\u6c17\u6e29\u306f6\u2103\u3067\u6700\u4f4e\u6c17\u6e29\u306f1\u2103\u3067\u3059\u300d\u7f8e\u4eba\u5929\u6c17\u21d2http://bit.ly/djB8th http://twitpic.com/3twnl0 #bt_tenki","id":30668926035689472,"from_user_id":7278433,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://bijintenki.jp" rel="nofollow">bijintenki.jp</a>"},{"from_user_id_str":"61770","profile_image_url":"http://a3.twimg.com/profile_images/1206955079/tw172a_normal.png","created_at":"Thu, 27 Jan 2011 16:40:52 +0000","from_user":"rsky","id_str":"30666561853333504","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3075\u3068\u591c\u7a7a\u3092\u898b\u4e0a\u3052\u3066\u30aa\u30ea\u30aa\u30f3\u304c\u898b\u3048\u306a\u304f\u3066\u300c\u6771\u4eac\u306b\u306f\u7a7a\u304c\u306a\u3044\u300d\u3068\u667a\u6075\u5b50\u306e\u3088\u3046\u306a\u3053\u3068\u3092\u601d\u3063\u305f\u308f\u3051\u3060\u304c\u3001\u305f\u3076\u3093\u534a\u5206\u3050\u3089\u3044\u306f\u5929\u6c17\u306e\u305b\u3044\u3067\u3059","id":30666561853333504,"from_user_id":61770,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"103259265","profile_image_url":"http://a0.twimg.com/profile_images/767857973/anime_icon_normal.gif","created_at":"Thu, 27 Jan 2011 16:37:42 +0000","from_user":"liveshowonly","id_str":"30665765698928640","metadata":{"result_type":"recent"},"to_user_id":null,"text":"iPhone\u5929\u6c17\u3002\u6771\u4eac4\u2103\u3063\u3066\u7d50\u69cb\u5bd2\u304f\u306a\u3044\u3058\u3083\u3093\u3002\uff08\u78ba\u304b\u306b\u3082\u306e\u51c4\u304f\u5bd2\u3044\u8a33\u3067\u306f\u7121\u3044\uff09\u3002\u798f\u5ca1\u5e02\u306f1\u2103\u3060\u3002\u52dd\u3061\u3060\u305c\u3002Rock'n'roll","id":30665765698928640,"from_user_id":103259265,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"165242761","profile_image_url":"http://a1.twimg.com/profile_images/1147334744/SN3E00600001_normal.jpg","created_at":"Thu, 27 Jan 2011 16:37:35 +0000","from_user":"deuxavril0502","id_str":"30665736556912640","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6b8b\u5ff5\u3001\u79c1\u306f\u6c96\u7e04\u3067\u3059(>_<)\u3067\u3082\u304a\u5929\u6c17\u826f\u3055\u305d\u3046\u3067\u826f\u304b\u3063\u305f\u306d\u3002\u3053\u3061\u3089\u306f\u96e8\u3088\uff5eRT @rinandy2010: \u305d\u3046\u3067\u3059\u3063\u266a\u51fa\u5f35\u3067(^^)\u304a\u306d\u3048\u3055\u307e\u306f\u6771\u4eac\u3067\u3059\u304b\uff1f\u3081\u3063\u3061\u3083\u5929\u6c17\u826f\u304f\u3066\u3073\u3063\u304f\u308a\u3067\u3059\u3002\u624b\u888b\u3068\u304b\u5168\u7136\u3044\u3089\u306a\u3044\u3067\u3059\u306d\u30fc RT @deuxavril0502 \u6771\u4eac\u306a\u306e\u30fc\uff1f","id":30665736556912640,"from_user_id":165242761,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.echofon.com/" rel="nofollow">Echofon</a>"},{"from_user_id_str":"163900288","profile_image_url":"http://a1.twimg.com/profile_images/1210224823/icon12945064955238_normal.jpg","created_at":"Thu, 27 Jan 2011 16:24:37 +0000","from_user":"nyao_yurichan","id_str":"30662472734089216","metadata":{"result_type":"recent"},"to_user_id":100985873,"text":"@ray_ko302 \u767a\u898b\u3042\u308a\u304c\u3068\u3067\u3059\u3045\u3002\u3053\u3061\u3089\u3067\u3082\u3088\u308d\u3057\u304f\u306d\u3002\u6771\u4eac\u306f\u4eca\u65e5\u3082\u4e7e\u71e5\u3067\u5927\u5909\u3088\u3002\u305d\u3063\u3061\u3068\u771f\u9006\u306e\u5929\u6c17\u3060\u306d\u3002\u30a2\u30a4\u30b9\u30d0\u30fc\u30f3\u304d\u3092\u3064\u3051\u3066\u3088\u306d\u3002","id":30662472734089216,"from_user_id":163900288,"to_user":"ray_ko302","geo":null,"iso_language_code":"ja","to_user_id_str":"100985873","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"49227098","profile_image_url":"http://a3.twimg.com/profile_images/965007882/____normal.jpg","created_at":"Thu, 27 Jan 2011 15:52:26 +0000","from_user":"dosannko6","id_str":"30654371016478720","metadata":{"result_type":"recent"},"to_user_id":108570870,"text":"@peke_hajiP \u4ffa\u304c\u6771\u4eac \u6765\u3066\u6700\u521d\u306b\u9a5a\u3044\u305f\u306e\u304c\u3001\u5929\u6c17\u4e88\u5831\u3067\u82b1\u7c89\u60c5\u5831\u304c\u6d41\u308c\u308b\u3053\u3068\u3067\u3001\u6700\u521d\u306b\u8a66\u3057\u305f\u306e\u304c \u30b4\u30ad\u69d8 \u53ec\u559a\u306e\u5100\u5f0f\u3067\u3059\u304a\uff1f","id":30654371016478720,"from_user_id":49227098,"to_user":"peke_hajip","geo":null,"iso_language_code":"ja","to_user_id_str":"108570870","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"71148934","profile_image_url":"http://a0.twimg.com/profile_images/1209223630/image_normal.jpg","created_at":"Thu, 27 Jan 2011 15:46:49 +0000","from_user":"123keiko","id_str":"30652958311981058","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u9727\u5cf6\u306e\u964d\u7070\u306e\u30cb\u30e5\u30fc\u30b9\u3092\u898b\u3066\u601d\u3044\u51fa\u3057\u307e\u3057\u305f\u3002\u4e0a\u4eac\u3057\u305f\u59cb\u3081\u306e\u9803\u3001\u6771\u4eac\u306f1\u5e74\u4e2d\u3001\u7070\u304c\u964d\u3089\u306a\u3044\u304b\u3089\u7a7a\u6c17\u304c\u6f84\u3093\u3067\u3066\u904e\u3054\u3057\u3084\u3059\u3044\u306a\u3041\u3001\u3068\u601d\u3063\u305f\u306a\u3041\u3001\u3063\u3066\u3002\n\u5b9f\u5bb6\u306f\u51ac\u306e\u5b63\u7bc0\u98a8\u3067\u685c\u5cf6\u306e\u7070\u304c\u964d\u308b\u5730\u533a\u3067\u3057\u305f\u3002\u9e7f\u5150\u5cf6\u306e\u5929\u6c17\u4e88\u5831\u3067\u306f\u3001\u6bce\u65e5\u3001\u685c\u5cf6\u4e0a\u7a7a\u306e\u98a8\u5411\u304d\u4e88\u5831\u304c\u3067\u307e\u3059\u3002\u3053\u308c\u304b\u3089\u306f\u9727\u5cf6\u3082\u304b\u306a\uff1f","id":30652958311981058,"from_user_id":71148934,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"91124773","profile_image_url":"http://a3.twimg.com/profile_images/1139308356/prof101007_3-1_normal.jpg","created_at":"Thu, 27 Jan 2011 15:43:35 +0000","from_user":"sanposuruhito","id_str":"30652146277945345","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u5bb5\u306e\u90fd\u5fc3\u306f\u3001\u8eab\u3082\u5f15\u304d\u7de0\u307e\u308b\u3068\u3044\u3046\u3088\u308a\u306f\u51cd\u3048\u308b\u7a0b\u306e\u51b7\u6c17\u3092\u611f\u3058\u308b\u5bd2\u3044\u591c\u3067\u3059\u3002\u660e\u65e5\u65e5\u4e2d\u306e\u6771\u4eac\u306e\u5929\u6c17\u306f\u3001\u5915\u65b9\u306b\u591a\u5c11\u96f2\u304c\u51fa\u308b\u5834\u6240\u304c\u3042\u308a\u305d\u3046\u306a\u3082\u306e\u306e\u6982\u306d\u6674\u308c\u7a7a\u304c\u5e83\u304c\u308a\u7d9a\u3051\u305d\u3046\u3067\u3059\u3002\u6700\u9ad8\u6c17\u6e29\u306f\u30015-6\u5ea6\u4f4d\u3068\u306a\u308a\u305d\u3046\u3067\u3059\u3002#weather_tokyo","id":30652146277945345,"from_user_id":91124773,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://projects.playwell.jp/go/Saezuri" rel="nofollow">Saezuri</a>"}],"max_id":30724239224995840,"since_id":28179956995457024,"refresh_url":"?since_id=30724239224995840&q=%E6%9D%B1%E4%BA%AC%E3%80%80%E5%A4%A9%E6%B0%97","next_page":"?page=2&max_id=30724239224995840&lang=ja&q=%E6%9D%B1%E4%BA%AC%E3%80%80%E5%A4%A9%E6%B0%97","results_per_page":15,"page":1,"completed_in":0.104827,"warning":"adjusted since_id to 28179956995457024 (), requested since_id was older than allowed -- since_id removed for pagination.","since_id_str":"28179956995457024","max_id_str":"30724239224995840","query":"%E6%9D%B1%E4%BA%AC%E3%80%80%E5%A4%A9%E6%B0%97"}

benchmarks/json-data/jp100.jsondeleted−1

@@ -1 +0,0 @@

1−{"results":[{"from_user_id_str":"178045354","profile_image_url":"http://a0.twimg.com/profile_images/1214479381/154722_10100141954893059_808622_55276626_7445050_n_normal.jpg","created_at":"Fri, 25 Feb 2011 17:40:04 +0000","from_user":"ChuriSta_gt","id_str":"41190705623732224","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3072\u3089\u304c\u306a\u306e\u300c\u3064\u300d\u306f\u3082\u3046Twitter\u306e\u300c\u3064\u300d\u3060\uff01","id":41190705623732224,"from_user_id":178045354,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twipple.jp/" rel="nofollow">\u3064\u3044\u3063\u3077\u308b for iPhone</a>"},{"from_user_id_str":"71746558","profile_image_url":"http://a2.twimg.com/profile_images/591641547/wwd_normal.gif","created_at":"Fri, 25 Feb 2011 17:40:02 +0000","from_user":"fuckkilldiestar","id_str":"41190699571494912","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u306b\u3057\u3066\u3082Twitter\u3084pixiv\u96e2\u308c\u3092\u3069\u3046\u306b\u304b\u3057\u308d\u674f\u4ec1\u30d6\u30eb\u30de","id":41190699571494912,"from_user_id":71746558,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"131230176","profile_image_url":"http://a2.twimg.com/sticky/default_profile_images/default_profile_5_normal.png","created_at":"Fri, 25 Feb 2011 17:39:58 +0000","from_user":"proory_bot","id_str":"41190683922546688","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30ea\u30cd\u30f3\u30dd\u30fc\u30c1 http://bit.ly/btjqlH","id":41190683922546688,"from_user_id":131230176,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://proory.com/" rel="nofollow">proory tems</a>"},{"from_user_id_str":"120359038","profile_image_url":"http://a1.twimg.com/profile_images/946521484/200805161826000_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:58 +0000","from_user":"tukinosuke","id_str":"41190680835391488","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @fuefukioyasumi: \u3082\u3046\u3044\u3044\u3002\u300c\u671d\u751f\u300d\u306a\u3093\u304b\u3044\u3044\u3002BBC\u3082CNN\u3082\u82f1\u8a9e\u653e\u9001\u3060\u3002\u307f\u3093\u306a\u3001\u30c6\u30ec\u30d3\u3092\u3076\u3061\u3063\u3068\u5207\u3063\u3066Twitter\u3092\u898b\u3088\u3046\u3002\u3053\u3053\u306b\u300c\u751f\u304d\u305f\u60c5\u5831\u300d\u304c\u6d41\u308c\u3066\u3044\u308b\u3002\u300c\u751f\u304d\u305f\u53eb\u3073\u300d\u304c\u3042\u308b\u3002\u3053\u3053\u304b\u3089\u3067\u3082\u6b74\u53f2\u306e\u8ee2\u63db\u70b9\u3092\u611f\u3058\u308b\u4e8b\u304c\u3067\u304d\u308b\u306e\u3060\u3002 @gjmorley #libjp","id":41190680835391488,"from_user_id":120359038,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"166512109","profile_image_url":"http://a3.twimg.com/profile_images/1224583217/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:50 +0000","from_user":"yurii1129","id_str":"41190649839620096","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u6c17\u4ed8\u3044\u305f\u2026\u307f\u3043\u304f\u3093\u306eTwitter\u540d\u3001\u3084\u307e\u306d\u3084\u3093(\uffe3\u25c7\uffe3;)","id":41190649839620096,"from_user_id":166512109,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"228999619","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_6_normal.png","created_at":"Fri, 25 Feb 2011 17:39:49 +0000","from_user":"takami926","id_str":"41190644793745408","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u7530\u539f\u3055\u3093\u3001\u5fdc\u63f4\u3057\u3066\u307e\u3059\u3002WEB\u3082TWITTER\u3082\u62dd\u898b\u3057\u3066\u307e\u3059\u3002\u7530\u539f\u3055\u3093\u304c\u653f\u6cbb\u5bb6\u306b\u306a\u3063\u3066\u3001\u65e5\u672c\u3092\u5909\u3048\u3066\u304f\u3060\u3055\u3044\u3002\u5c16\u95a3\u3001\u5317\u65b9\u554f\u984c\u5171\u306b\u65e5\u672c\u306e\u653f\u6cbb\u306e\u5931\u6557\u3067\u3059\u3002\u8a55\u8ad6\u5bb6\u306f\u8272\u3005\u8a00\u3063\u3066\u307e\u3059\u304c\u3001\u4e2d\u6771\u307b\u3069\u56fd\u6c11\u306e\u71b1\u6c17\u304c\u7121\u304f\u3001\u683c\u5dee\u304c\u3042\u308a\u3001\u4f55\u3082\u5909\u308f\u3089\u306a\u3044\u666f\u6c17\u4f4e\u8ff7\u306e\u65e5\u672c\u306b\u56fd\u6c11\u306f\u8ae6\u3081\u3066\u308b\u3093\u3067\u3059\u3002","id":41190644793745408,"from_user_id":228999619,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"151773701","profile_image_url":"http://a0.twimg.com/profile_images/1213699753/obi_nao_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:44 +0000","from_user":"obi_nao","id_str":"41190622949941248","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3060\u3044\u3076\u5e74\u4e0b\u306e\u5f8c\u8f29\u306b\u3001\u30d3\u30b8\u30cd\u30b9\u3084\u308b\u306a\u3089\u771f\u5263\u306bTwitter\u3084\u308c\uff01\u3063\u3066\u6012\u3089\u308c\u305f\u3002\u306a\u306e\u3067\u4eca\u65e5\u304b\u3089\u771f\u5263\u306b\u3064\u3076\u3084\u304f\u3053\u3068\u306b\u3057\u307e\u3059\u3002\u3088\u308d\u3057\u304f\u3067\u3059\u3002","id":41190622949941248,"from_user_id":151773701,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.flight.co.jp/iPhone/TweetMe/" rel="nofollow">TweetMe for iPhone</a>"},{"from_user_id_str":"20817229","profile_image_url":"http://a0.twimg.com/profile_images/1212012721/205_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:43 +0000","from_user":"allte","id_str":"41190619804082176","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u7206\u7b11\u3057\u3066\u547c\u5438\u56f0\u96e3\u3067\u75d9\u6523\u3059\u308b\u5618\u304f\u3093\u304c\u898b\u308c\u308b\u306e\u306fTwitter\u3060\u3051","id":41190619804082176,"from_user_id":20817229,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.movatwi.jp" rel="nofollow">www.movatwi.jp</a>"},{"from_user_id_str":"166907967","profile_image_url":"http://a2.twimg.com/profile_images/1250526230/___normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:43 +0000","from_user":"NTTYAHOOOOOOOI","id_str":"41190618235412480","metadata":{"result_type":"recent"},"to_user_id":106469594,"text":"@takahirororo \u3066\u304b\u4f55\u3067twitter\u4e0a\u3067\u30a2\u30c9\u30d0\u30a4\u30b9\u3082\u3089\u3063\u3066\u3093\u306d\u3093\uff57","id":41190618235412480,"from_user_id":166907967,"to_user":"takahirororo","geo":null,"iso_language_code":"ja","to_user_id_str":"106469594","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"82581287","profile_image_url":"http://a0.twimg.com/profile_images/774721566/miyaru2_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:38 +0000","from_user":"kine_rahchaos","id_str":"41190598132244480","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30a2\u30aa\u30b7\u30de\u3055\u3093\u304cTwitter\u59cb\u3081\u305f\u3060\u3068\u2026","id":41190598132244480,"from_user_id":82581287,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"136633905","profile_image_url":"http://a2.twimg.com/profile_images/1247161991/yama_normal.png","created_at":"Fri, 25 Feb 2011 17:39:35 +0000","from_user":"yamachi39","id_str":"41190584706285568","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3084\u3063\u3071\u308amixi\u3088\u308atwitter\u306e\u304c\u597d\u304d\u304b\u3082","id":41190584706285568,"from_user_id":136633905,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://jigtwi.jp/?p=1" rel="nofollow">jigtwi</a>"},{"from_user_id_str":"44029295","profile_image_url":"http://a2.twimg.com/profile_images/1112965522/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:32 +0000","from_user":"no2yosee","id_str":"41190572769280000","metadata":{"result_type":"recent"},"to_user_id":97721124,"text":"@hn0345 \u3042\u3001\u500b\u4eba\u7684\u306b\u306f\u4eca\u306ftwitter\u306e\u30d7\u30ed\u30d5\u30a3\u30fc\u30eb\u306b\u66f8\u3044\u3066\u3042\u308b\u30d6\u30ed\u30b0\u306e\u30e6\u30cb\u30c3\u30c8\u3092\u306e\u3093\u3073\u308a\u3084\u3063\u3066\u307e\u3059w","id":41190572769280000,"from_user_id":44029295,"to_user":"hn0345","geo":null,"iso_language_code":"ja","to_user_id_str":"97721124","source":"<a href="http://www.flight.co.jp/iPhone/TweetMe/" rel="nofollow">TweetMe for iPhone</a>"},{"from_user_id_str":"149872179","profile_image_url":"http://a0.twimg.com/profile_images/1145770150/Winter11_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:31 +0000","from_user":"xmyyyxx","id_str":"41190566951653376","metadata":{"result_type":"recent"},"to_user_id":95069405,"text":"@rindofu \u653b\u7565\u672c\u3042\u308c\u3070\u3044\u3044\u306e\u306b\u3063\u3066\u601d\u3044\u307e\u3059(T\u03c9T)/~~~ \u79c1\u3082\u76f4\u3057\u305f\u3044\u3068\u3053\u3044\u3063\u3071\u3044\u3060\u3051\u3069\u3001\u3042\u306860\u5e74\u304f\u3089\u3044\u3044\u304d\u3089\u308c\u308b\u306f\u305a\u3060\u3057\u3001\u306e\u3093\u3073\u308a\u76f4\u308c\u3070\u3044\u3044\u306a\u3042 \u304a\u3084\u3059\u307f\u3067\u3059^^\uff01\u308a\u3093\u3055\u3093\u3068twitter\u3067\u4ef2\u826f\u304f\u306a\u308c\u3066\u3088\u304b\u3063\u305f\u3067\u3059\u3063","id":41190566951653376,"from_user_id":149872179,"to_user":"rindofu","geo":null,"iso_language_code":"ja","to_user_id_str":"95069405","source":"<a href="http://twtr.jp" rel="nofollow">Keitai Web</a>"},{"from_user_id_str":"105579892","profile_image_url":"http://a0.twimg.com/profile_images/1212950455/love_happy_pink_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:30 +0000","from_user":"love_happy_pink","id_str":"41190566494601216","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u305d\u308c\u898b\u305f\u3044\u306a\u266aRT @kazukt \u3046\u308b\u304a\u307c\u7d75\u3001\u4ed6\u306e\u4eba\u306e\u3082\u898b\u3066\u3044\u305f\u3089\u3084\u305f\u3089\u30de\u30f3\u30ac\u306e\u30ad\u30e3\u30e9\u30af\u30bf\u30fc\u3067\u3080\u3061\u3083\u304f\u3061\u3083\u4e0a\u624b\u3044\u4eba\u304c\uff01\u2026\u3068\u3001\u30d7\u30ed\u30d5\u30a3\u30fc\u30eb\u898b\u305f\u3089\u3001\u306a\u3093\u3068\u3054\u672c\u4eba\u304c\u66f8\u3044\u3066\u3044\u3089\u3063\u3057\u3083\u3063\u305f\u3002Twitter\u3063\u3066\u30b9\u30b4\u30a4\u308f\u3002","id":41190566494601216,"from_user_id":105579892,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.nibirutech.com/" rel="nofollow">TwitBird iPad</a>"},{"from_user_id_str":"16996368","profile_image_url":"http://a0.twimg.com/profile_images/1198892387/pochi_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:30 +0000","from_user":"HyoYoshikawa","id_str":"41190564187611136","metadata":{"result_type":"recent"},"to_user_id":1800565,"text":"@shinichiro_beck \u73fe\u5730\u304b\u3089\u306a\u3089\u826f\u304f\u3066\u4ed6\u306e\u5730\u57df\u304b\u3089\u3060\u4f59\u8a08\u306a\u3089\u3001\u4f55\u306e\u305f\u3081\u306bTwitter\u304c\u3042\u308b\u306e\u304b\u308f\u304b\u3089\u306a\u3044\u3088\u3002\u3044\u307e\u8d77\u304d\u3066\u308b\u3053\u3068\u306e\u8aac\u660e\u3082\u3064\u304b\u306a\u3044\u3002\u30a2\u30eb\u30b8\u30e3\u30b8\u30fc\u30e9\u304c\u4f1d\u3048\u3066\u308b\u3053\u3068\u304c\u5168\u3066\u3058\u3083\u306a\u3044\u3057\u3001\u65e5\u672c\u306eTV\u306f\u4f1d\u3048\u306a\u3044\u3067\u3057\u3087\u3046\u3002\u77e5\u308a\u305f\u304c\u3063\u3066\u308b\u4eba\u3082\u305f\u304f\u3055\u3093\u3044\u308b\u3002","id":41190564187611136,"from_user_id":16996368,"to_user":"shinichiro_beck","geo":null,"iso_language_code":"ja","to_user_id_str":"1800565","source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"119070802","profile_image_url":"http://a2.twimg.com/profile_images/1229773005/346d8435099798113a1326e1ba4949ee_normal.jpeg","created_at":"Fri, 25 Feb 2011 17:39:25 +0000","from_user":"takotako726","id_str":"41190545439207424","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u9b54\u6cd5\u5c11\u5973\u307e\u3069\u304b\u30de\u30ae\u30ab\u306e\u53cd\u97ff\u304ctwitter\u3067\u306f\u3093\u3071\u306d\u3048\u4ef6\u3002","id":41190545439207424,"from_user_id":119070802,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://z.twipple.jp/" rel="nofollow">\u3064\u3044\u3063\u3077\u308b/twipple</a>"},{"from_user_id_str":"165695316","profile_image_url":"http://a1.twimg.com/profile_images/681748782/ring_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:21 +0000","from_user":"pandora_shotbar","id_str":"41190526447390720","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u300e\u30b7\u30e7\u30c3\u30c8\u30d0\u30fc\u3000\u30d1\u30f3\u30c9\u30e9\u3000\u30c4\u30a4\u30c3\u30bf\u30fc\u306e\u3064\u3076\u3084\u304d\u300f\u30b7\u30e7\u30c3\u30c8\u30d0\u30fc\u3000\u30d1\u30f3\u30c9\u30e9\u3000\u30c4\u30a4\u30c3\u30bf\u30fc\u306e\u3064\u2026\uff5chttp://pandora-twitter.seesaa.net/article/187809936.html","id":41190526447390720,"from_user_id":165695316,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://blog.seesaa.jp/" rel="nofollow">SeesaaBlog</a>"},{"from_user_id_str":"88862311","profile_image_url":"http://a2.twimg.com/profile_images/1182243698/161113_100001897885617_169366_q_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:16 +0000","from_user":"amebaguide","id_str":"41190504926416896","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u300e\u30a2\u30e1\u30d6\u30ed\u653b\u7565\u30ac\u30a4\u30c9\u306e\u30c4\u30a4\u30c3\u30bf\u30fc\u306e\u3064\u3076\u3084\u304d\u300f\u30d6\u30ed\u30b0\u306e\u653b\u7565\u3000\u30c4\u30a4\u30c3\u30bf\u30fc\u306e\u3064\u3076\u3084\u304d\u96c6\uff5chttp://accessup-twitter.seesaa.net/article/187809931.html","id":41190504926416896,"from_user_id":88862311,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://blog.seesaa.jp/" rel="nofollow">SeesaaBlog</a>"},{"from_user_id_str":"186895007","profile_image_url":"http://a2.twimg.com/profile_images/1229610799/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:11 +0000","from_user":"zizikt","id_str":"41190486123356161","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3053\u308c\u306f\u500b\u4eba\u7684\u306b\u306f\u91cd\u5b9d\u3067\u3059\u3002\n\u25c6iPhone&iPad\u5411\u3051Twitter\u30a2\u30d7\u30ea\u300c\u3064\u3044\u3063\u3077\u308b\u300d\u306bEvernote\u3068\u306e\u9023\u643a\u6a5f\u80fd\u3092\u8ffd\u52a0 \nhttp://bit.ly/hPf44u","id":41190486123356161,"from_user_id":186895007,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"132320738","profile_image_url":"http://a3.twimg.com/profile_images/1229760475/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:04 +0000","from_user":"faina_","id_str":"41190453592334336","metadata":{"result_type":"recent"},"to_user_id":167894537,"text":"@gjmorley \u30e2\u30fc\u30ea\u30fc\u3055\u3093\u306e\u7ffb\u8a33\u306e\u8a00\u8449\u306e\u30bb\u30f3\u30b9\u304c\u3059\u304d\u3067\u3059\u3002\u305d\u3057\u3066\u3001Twitter\u3067\u77e5\u308b\u3001\u73fe\u5730\u306e\u4eba\u306e\u76ee\u306e\u529b\u3084\u3001\u60c5\u5831\u3092\u4f1d\u3048\u3066\u304f\u308c\u308b\u7686\u3055\u3093\u306e\u60c5\u71b1\u306b\u611f\u52d5\u3057\u3066\u3044\u307e\u3059\u3002\u611f\u52d5\u3059\u308b\u3063\u3066\u3059\u3054\u3044\u30a8\u30cd\u30eb\u30ae\u30fc\u3067\u3059\uff01\uff01","id":41190453592334336,"from_user_id":132320738,"to_user":"gjmorley","geo":null,"iso_language_code":"ja","to_user_id_str":"167894537","source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"24870552","profile_image_url":"http://a3.twimg.com/profile_images/907130634/4_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:03 +0000","from_user":"tana1192","id_str":"41190450480021504","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u500b\u4eba\u7684\u306b\u306f\u3001\u30bf\u30b0\u5f3e\u304d\u3059\u308c\u3070\u3044\u3044\uff08\u5f3e\u3051\u308b\u30c4\u30fc\u30eb\u3092\u4f7f\u3063\u3066Twitter\u3092\u3059\u308c\u3070\u3044\u3044\uff09\u3068\u601d\u3046\u3093\u3060\u3051\u3069\u306a\u3042\u3002\u307f\u3093\u306a\u305d\u308c\u306a\u308a\u306bTwitter\u3084\u308b\u4eba\u3060\u3057\u3001\u30c4\u30fc\u30eb\u9078\u3073\u304f\u3089\u3044\u5e45\u3092\u6301\u3063\u3066\u3084\u3063\u3066\u3082\u3002 \u307e\u3042\u3001\u4ffa\u30a2\u30cb\u30e1\u306f\u89b3\u308b\u89b3\u308b\u8a50\u6b3a\u3059\u308b\u3060\u3051\u306e\u4eba\u3060\u304b\u3089\u95a2\u4fc2\u306a\u3044\u3093\u3060\u3051\u3069\u3082\uff57\uff57\u5b9f\u6cc1\u306f\u697d\u3057\u305d\u3046\u306b\u898b\u3048\u308b\u3088\u3002","id":41190450480021504,"from_user_id":24870552,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"58509646","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Fri, 25 Feb 2011 17:39:02 +0000","from_user":"kakuyas","id_str":"41190446663344128","metadata":{"result_type":"recent"},"to_user_id":107076877,"text":"@Dayspool \u6df1\u591c\uff12\uff19\u6642\u304f\u3089\u3044\u307e\u3067\u306f\u6bce\u65e5\u55b6\u696d\u3057\u3066\u308b\u306e\u3067\u3001twitter\u3001\u30e1\u30c3\u30bb\u3001PS3\u306a\u3069\u3067\u3088\u3093\u3067\u3051\u308c\u3002\u3053\u3063\u3061\u304b\u3089\u58f0\u304b\u3051\u308b\u3053\u3068\u3082\u3042\u308b\u304b\u3082\u3060\u304c\uff57","id":41190446663344128,"from_user_id":58509646,"to_user":"Dayspool","geo":null,"iso_language_code":"ja","to_user_id_str":"107076877","source":"<a href="http://cheebow.info/chemt/archives/2007/04/twitterwindowst.html" rel="nofollow">Twit for Windows</a>"},{"from_user_id_str":"149128527","profile_image_url":"http://a2.twimg.com/profile_images/1254922702/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:00 +0000","from_user":"uni13yoki","id_str":"41190437087748096","metadata":{"result_type":"recent"},"to_user_id":119468594,"text":"@kuro_wr84 \u304a\u308c\u3068\u304a\u524d\u3067Twitter\u3067\u4f1a\u8a71\u3057\u305f\u3089\u3001\u5927\u5909\u306a\u3053\u3068\u306b\u306a\u308b\u306a","id":41190437087748096,"from_user_id":149128527,"to_user":"kuro_wr84","geo":null,"iso_language_code":"ja","to_user_id_str":"119468594","source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"18670595","profile_image_url":"http://a2.twimg.com/profile_images/1250674062/ProfilePhoto_normal.png","created_at":"Fri, 25 Feb 2011 17:38:59 +0000","from_user":"nyuuuuun","id_str":"41190436450222080","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3078\u30fc\u3053\u3093\u306a\u306b\u3088\u304f\u4f3c\u308b\u3053\u3068\u3082\u3042\u308b\u3093\u3060\u30fc\nhttp://twitter.com/Re_44/status/35943233016168448\nhttp://twitter.com/3510_misaka/status/36122114821988352","id":41190436450222080,"from_user_id":18670595,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"96267603","profile_image_url":"http://a3.twimg.com/profile_images/1245253473/DSiLL3_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:59 +0000","from_user":"arivis","id_str":"41190433119940608","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://twitter.com/#!/arivis/status/40636755380142080 \u306a\u3093\u3064\u3046\u304b\u3053\u308c\u3067\u8d64\u3063\u3066\u306e\u3082\u3061\u3087\u3063\u3068\u3042\u308c\u3063\u3059\u306d\u3002\u305d\u3057\u3066\u4e88\u671f\u3057\u3066\u3044\u305f\u304b\u306e\u3088\u3046\u3060","id":41190433119940608,"from_user_id":96267603,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"148097776","profile_image_url":"http://a3.twimg.com/profile_images/1166904064/broken-heart_normal.png","created_at":"Fri, 25 Feb 2011 17:38:56 +0000","from_user":"ReajuBreaker_A","id_str":"41190422135058432","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u672c\u57a2\u30d5\u30a9\u30ed\u30fc\u3088\u308d\u3057\u304f\u3067\u3059\u2192 http://twitter.com/ReajuBreaker \uff08\uff20\u3060\u3068\u30ea\u30d7\u30e9\u30a4\u304c\u57cb\u307e\u308b\u305f\u3081\u3001URL\u306b\u3057\u3066\u3042\u308a\u307e\u3059\uff09","id":41190422135058432,"from_user_id":148097776,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.twitter.com/ReajuBreaker" rel="nofollow">\u73fe\u5145\u6bba\u3057\u306e\u7121\u4eba\u9023\u545f\uff1c\u30aa\u30fc\u30c8\u30c4\u30a4\u30fc\u30c8\uff1e</a>"},{"from_user_id_str":"59711654","profile_image_url":"http://a2.twimg.com/profile_images/416212928/flowers-06-1_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:56 +0000","from_user":"agamo45","id_str":"41190421522546688","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @ebizo66: \u30ea\u30d3\u30a2\u30fb\u30c8\u30ea\u30dd\u30ea\u306eTw\uff1a\u6551\u6025\u8eca\u304c\u6765\u305f\u304c\u3001\u8ca0\u50b7\u8005\u3092\u8eca\u5185\u3067\u6bba\u5bb3\u3057\u3066\u3044\u305f\u3001\u3068\u3002\uff08\u6ec5\u8336\u82e6\u8336\u3060\uff01\uff09http://ow.ly/43pQ2 #libjp","id":41190421522546688,"from_user_id":59711654,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"145311373","profile_image_url":"http://a3.twimg.com/profile_images/1187802576/a_gam_02_normal.png","created_at":"Fri, 25 Feb 2011 17:38:55 +0000","from_user":"nogic1008","id_str":"41190418141937664","metadata":{"result_type":"recent"},"to_user_id":88117317,"text":"@runasoru \u307e\u3042\u5acc\u306a\u3089\u6df1\u591c\u5e2f\u306bTwitter\u898b\u306a\u304d\u3083\u3044\u3044\u3060\u3051\u3067\u3059\u304b\u3089\u306d\u30fc \u30103/19BDM\u30aa\u30d5http://twvt.us/bdoff_kansai\u3011","id":41190418141937664,"from_user_id":145311373,"to_user":"runasoru","geo":null,"iso_language_code":"ja","to_user_id_str":"88117317","source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"195851300","profile_image_url":"http://a2.twimg.com/profile_images/1124572815/be7b4c0a06cb60e8_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:49 +0000","from_user":"LoveLAscrewDoll","id_str":"41190391147540480","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @jp_mjp: SCREW TV SHOW Vol.6\u306e\u653e\u9001\u304c\u7121\u4e8b\u306b\u7d42\u4e86\u3044\u305f\u3057\u307e\u3057\u305f\u3002\u3054\u89a7\u9802\u304d\u3042\u308a\u304c\u3068\u3046\u3054\u3056\u3044\u307e\u3057\u305f\uff01\u6b21\u56de\u653e\u9001\u306f3\u670818\u65e5(\u91d1)\u3067\u3059\u3002\u8996\u8074\u8005\u30d7\u30ec\u30bc\u30f3\u30c8\u306e\u8a73\u7d30\u306f\u5f8c\u65e5MJP\u3067\u304a\u77e5\u3089\u305b\u3044\u305f\u3057\u307e\u3059\u3002\u305d\u306e\u969b\u306b\u306f\u3001\u3053\u306eTwitter\u3067\u3082\u304a\u77e5\u3089\u305b\u3044\u305f\u3057\u307e\u3059\u306e\u3067\u3001\u304a\u697d\u3057\u307f\u306b\uff01#SCREWTV","id":41190391147540480,"from_user_id":195851300,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://z.twipple.jp/" rel="nofollow">\u3064\u3044\u3063\u3077\u308b/twipple</a>"},{"from_user_id_str":"178045354","profile_image_url":"http://a0.twimg.com/profile_images/1214479381/154722_10100141954893059_808622_55276626_7445050_n_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:48 +0000","from_user":"ChuriSta_gt","id_str":"41190389549510656","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3053\u3053\u4e00\u9031\u9593Twitter\u304c\u3084\u305f\u3089\u697d\u3057\u3044\u306e\u3067\u3059\u3051\u3069\u30fc\u30fc\u30fc\uff01\u306b\u3072\u3072\u3063\u7b11","id":41190389549510656,"from_user_id":178045354,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twipple.jp/" rel="nofollow">\u3064\u3044\u3063\u3077\u308b for iPhone</a>"},{"from_user_id_str":"50592111","profile_image_url":"http://a0.twimg.com/profile_images/1252176582/lFjpi_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:48 +0000","from_user":"crowNeko","id_str":"41190387271864320","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30a8\u30ed\u30b2\u30d7\u30ec\u30a4\u3057\u306a\u304c\u3089\u307e\u3069\u30de\u30aeTL\u3092\u898b\u306a\u3044\u3088\u3046\u306b\u534a\u76ee\u306b\u306a\u308a\u306a\u304c\u3089Twitter\u3057\u3066\u308b\u6df1\u591c2\u6642\u534a\u3002","id":41190387271864320,"from_user_id":50592111,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://stone.com/Twittelator" rel="nofollow">Twittelator</a>"},{"from_user_id_str":"7141467","profile_image_url":"http://a3.twimg.com/profile_images/1198540741/icon12912579345276_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:40 +0000","from_user":"hina_geshi","id_str":"41190355961380864","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u7d50\u5c40\u30cd\u30bf\u30d0\u30ec\u3059\u3093\u306a\u3063\u3066\u8a00\u3046\u65b9\u304c\u30a2\u30ec\u3060\u3088\u306d\u3001\u3057\u306a\u3044\u308f\u3051\u7121\u3044\u3058\u3083\u306a\u3044\u8133\u5185\u5782\u308c\u6d41\u3057\u304cTwitter\u306a\u3093\u3060\u304b\u3089\u3055","id":41190355961380864,"from_user_id":7141467,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://projects.playwell.jp/go/Saezuri" rel="nofollow">Saezuri</a>"},{"from_user_id_str":"149608984","profile_image_url":"http://a0.twimg.com/profile_images/1205950885/090702_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:39 +0000","from_user":"Mr_Tsubaki","id_str":"41190349447774208","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u307e\u3069\u304b\u306fTwitter\u5408\u308f\u305b\u3066\uff11\u6642\u9593\u306f\u697d\u3057\u3044","id":41190349447774208,"from_user_id":149608984,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://z.twipple.jp/" rel="nofollow">\u3064\u3044\u3063\u3077\u308b/twipple</a>"},{"from_user_id_str":"122271550","profile_image_url":"http://a0.twimg.com/profile_images/961936499/neoneko_bot5jpg_____normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:39 +0000","from_user":"neoneko_bot5","id_str":"41190348726345728","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u30c6\u30b9\u30c8\uff1a23\u3011\u4eca\u65e5\u304b\u3089\u5ba3\u4f1d\u958b\u59cb\u2606\u306d\u304a\u306d\u3053\u306eTwitter \u3067 EasyBottex\u3000\u3067\u304d\u308b\u307e\u3067\uff01\u2192http://neoneko.blog31.fc2.com/","id":41190348726345728,"from_user_id":122271550,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www20.atpages.jp/neoneko/" rel="nofollow">neoneko_bot5</a>"},{"from_user_id_str":"127069188","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_6_normal.png","created_at":"Fri, 25 Feb 2011 17:38:37 +0000","from_user":"MYCHEBOT","id_str":"41190340908163074","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30eb\u30d5\u3055\u3093\u304c\u914d\u4fe1\u3092\u7d42\u4e86\u3057\u307e\u3057\u305f\uff01/ http://777labo.com/mychecker/view/745.php / \u30c8\u30d4\u30c3\u30af:XSplit\u30c6\u30b9\u30c8\u3000twitter\u2192http://twitter.com/rukh01","id":41190340908163074,"from_user_id":127069188,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://777labo.com/mychecker/" rel="nofollow">MYCHEBOT</a>"},{"from_user_id_str":"107626142","profile_image_url":"http://a1.twimg.com/profile_images/1104968421/SuperMaika1_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:34 +0000","from_user":"MaikaPaPa","id_str":"41190328614666240","metadata":{"result_type":"recent"},"to_user_id":null,"text":"75\u5e74\u524d\u306e\u4eca\u65e52\u670826\u65e5\u672a\u660e\u3001\u82e5\u304d\u9752\u5e74\u5c06\u6821\u3089\u304c\u653f\u6cbb\u8150\u6557\u3068\u8fb2\u6751\u306e\u56f0\u7aae\u306b\u5bfe\u3057\u3066\u6c7a\u8d77\u3057\u307e\u3057\u305f\u3002\u3082\u3061\u308d\u3093\u5f53\u6642\u306fTwitter\u3082FB\u3082\u3001\u307e\u305f\u5f53\u7136\u306a\u304c\u3089Internet\u3082\u3042\u308a\u307e\u305b\u3093\u3067\u3057\u305f\u3002\u4e00\u65b9\u3001\u30c1\u30e5\u30cb\u30b8\u30a2\u3001\u30a8\u30b8\u30d7\u30c8\u3001\u4e2d\u6771\u306b\u5e83\u304c\u308b\u53cd\u653f\u5e9c\u30c7\u30e2\u3068\u5f37\u6a29\u4f53\u5236\u306e\u5d29\u58ca\u3002\u73fe\u5728\u306e\u65e5\u672c\u3067\u306f\u8003\u3048\u3089\u308c\u306a\u3044\u3053\u3068\u3067\u3059\u3002","id":41190328614666240,"from_user_id":107626142,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"11111695","profile_image_url":"http://a1.twimg.com/sticky/default_profile_images/default_profile_0_normal.png","created_at":"Fri, 25 Feb 2011 17:38:28 +0000","from_user":"kumatchipooh","id_str":"41190306145775617","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @inosenaoki: \u306a\u308b\u307b\u3069\u306d\u3002 RT @dansrmz @inosenaoki \u3053\u3061\u3089\u304c\u30bd\u30d5\u30c8\u30d0\u30f3\u30af\u526f\u793e\u9577\u306e\u677e\u672c\u5fb9\u4e09\u3055\u3093\u306e\u3001Twitter\u306b\u95a2\u3059\u308b\u8ad6\u8003\u3067\u3059\u3002 \u25b6 "Twitter\u306e2\u30c1\u30e3\u30f3\u30cd\u30eb\u5316\u306f\u9632\u6b62\u51fa\u6765\u308b\u304b" http://t.co/Mwzb8Zf","id":41190306145775617,"from_user_id":11111695,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"212161909","profile_image_url":"http://a1.twimg.com/profile_images/1252895790/natm01_normal.gif","created_at":"Fri, 25 Feb 2011 17:38:28 +0000","from_user":"n34hitman","id_str":"41190303830511616","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Twitter\u30fb\u30d6\u30ed\u30b0\u30a2\u30d5\u30a3\u30ea\u30a8\u30a4\u30c8\u81ea\u52d5\u6295.... http://goo.gl/a4RHB 4054","id":41190303830511616,"from_user_id":212161909,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twibow.net/" rel="nofollow">Twibow</a>"},{"from_user_id_str":"105945593","profile_image_url":"http://a2.twimg.com/sticky/default_profile_images/default_profile_5_normal.png","created_at":"Fri, 25 Feb 2011 17:38:24 +0000","from_user":"nakano_bot","id_str":"41190285710983168","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3053\u306ebot\u306f\u4e0d\u52d5\u7523\u4f1a\u793e\u69d8\u5411\u3051\u306e\u4e0d\u52d5\u7523\u30dd\u30fc\u30bf\u30eb\u30b5\u30a4\u30c8\u3078\u306e\u4e00\u62ec\u8ee2\u9001\uff0bTwitter\u7121\u6599\u8ee2\u9001\u30b5\u30fc\u30d3\u30b9\u306b\u3088\u308a\u3064\u3076\u3084\u304d\u307e\u3059\u3002\u3054\u5229\u7528\u306b\u306a\u308a\u305f\u3044\u5834\u5408\u306f http://bit.ly/demey0 \u306b\u304a\u6c17\u8efd\u306b\u304a\u554f\u3044\u5408\u308f\u305b\u4e0b\u3055\u3044\u3002","id":41190285710983168,"from_user_id":105945593,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.teramax.jp/aboutus.html" rel="nofollow">tmxbot</a>"},{"from_user_id_str":"170904226","profile_image_url":"http://a2.twimg.com/profile_images/1249020397/1789kb_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:21 +0000","from_user":"1789kb","id_str":"41190274428305408","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3068\u308a\u3042\u3048\u305a\u4eca\u56de\u521d\u3081\u3066\u30ea\u30a2\u30eb\u30bf\u30a4\u30e0\u3067\u898b\u3066\u308f\u304b\u3063\u305f\u306e\u306f\u3001QB\u306f\u5168\u8eab\u304c\u30a2\u30f3\u30d1\u30f3\u30bf\u30a4\u30d7\u3060\u3068\u3044\u3046\u3053\u3068\u3068\u3001\u307e\u3069\u30de\u30ae\u7d42\u4e86\u5f8c\u306eTwitter\u306e\u3056\u308f\u3064\u304d\u304c\u3059\u3054\u3044\u3068\u3044\u3046\u3053\u3068","id":41190274428305408,"from_user_id":170904226,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.echofon.com/" rel="nofollow">Echofon</a>"},{"from_user_id_str":"166169644","profile_image_url":"http://a1.twimg.com/profile_images/1217017679/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:18 +0000","from_user":"Okkkkkkkkkkun","id_str":"41190262420017152","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3063\u3066Twitter\u3067\u3064\u3076\u3084\u304f\u81ea\u5206\u3082\u76f8\u5f53\u5c0f\u3055\u3044\u306a\u3002","id":41190262420017152,"from_user_id":166169644,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"196623456","profile_image_url":"http://a3.twimg.com/profile_images/1219076661/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:06 +0000","from_user":"NoMoneyClub","id_str":"41190213342601216","metadata":{"result_type":"recent"},"to_user_id":195462431,"text":"@yosal15 \nTwitter\u3084\u3063\u3066\u308b\u3089\u3057\u3044\u3002\u3051\u3069\u3001\u898b\u3064\u304b\u3089\u306a\u3044\u3002","id":41190213342601216,"from_user_id":196623456,"to_user":"yosal15","geo":null,"iso_language_code":"ja","to_user_id_str":"195462431","source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"126984048","profile_image_url":"http://a3.twimg.com/profile_images/1254579571/zipyaru-20090829-23-0012_normal.png","created_at":"Fri, 25 Feb 2011 17:38:02 +0000","from_user":"minaduki_naduki","id_str":"41190196418584576","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u203b\u30e1\u30fc\u30eb\u3067\u5973\u306e\u5b50\u53e3\u8aac\u304f\u306e\u306b\u5fd9\u3057\u3044\u3093\u3060\u305d\u3046\u3067\u3059\u3000\u307e\u3058\u3058\u3054\u308d RT @yowano_k: \u5fd9\u3057\u304f\u3066\u3082Twitter\u306b\u9854\u3092\u51fa\u3057\u305f\u304f\u306a\u308b\u50d5\u30a7\u2026\u2026","id":41190196418584576,"from_user_id":126984048,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://seesmic.com/seesmic_desktop/sd2" rel="nofollow">Seesmic Desktop</a>"},{"from_user_id_str":"200568705","profile_image_url":"http://a3.twimg.com/profile_images/1242179765/101230_1355_01_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:01 +0000","from_user":"hammerstrap","id_str":"41190190428979200","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6628\u65e5\u91d1\u66dc\u65e5\u306f\u732e\u8840\u306b\u5f80\u304f\u3002\u4eca\u306e\u50d5\u306e\u4eba\u9593\u3068\u3057\u3066\u306e\u4fa1\u5024\u306f\u3001\u7cbe\u3005\u3053\u306e\u7a0b\u5ea6\u3002\u8179\u304c\u6e1b\u3063\u305f\u3002\u5374\u8aac\u3002twitter\u306e\u767e\u56db\u5341\u6587\u5b57\u306b\u82db\u3005\u3068\u3057\u3066\u3001\u4e00\u3064\u306e\u4eee\u8aac\u306b\u4fe1\u6191\u6027\u3092\u5f97\u308b\u3002\u6226\u6642\u4e0b\u306e\u7d19\u306e\u7d71\u5236\u3068\u3001\u4e2d\u5cf6\u6566\u306e\u6587\u7ae0\u306e\u95a2\u4fc2\u6027\u3002\u73fe\u5728\u30a6\u30a7\u30d6\u30ed\u30b0\u306b\u3001\u7e8f\u3081\u3066\u3044\u308b\u6700\u4e2d\u3002\u8fd1\u65e5\u516c\u958b\u4e88\u5b9a\u3002","id":41190190428979200,"from_user_id":200568705,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"164970427","profile_image_url":"http://a0.twimg.com/profile_images/1227176662/9192b021ef85ce9902c28955f86e604b_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:59 +0000","from_user":"syuigetsuIT","id_str":"41190184041197569","metadata":{"result_type":"recent"},"to_user_id":141926331,"text":"@iliad_tga \u30a4\u30ea\u30a2\u30b9\u3055\u3093\u304c\u305d\u306e\u8fba\u7406\u89e3\u306e\u3042\u308b\u3053\u3068\u306f\u5206\u304b\u3063\u3066\u307e\u3059\uff57\u3000\u30cd\u30bf\u30d0\u30ec\u4e91\u3005\u306ftwitter\u306e\u6c7a\u5b9a\u7684\u306a\u6b20\u70b9\u3060\u3068\u601d\u3044\u307e\u3059\u306d\u3047\u3002","id":41190184041197569,"from_user_id":164970427,"to_user":"iliad_tga","geo":null,"iso_language_code":"ja","to_user_id_str":"141926331","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"94526795","profile_image_url":"http://a0.twimg.com/profile_images/679411954/akb48_in_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:56 +0000","from_user":"akb48_in","id_str":"41190171248431104","metadata":{"result_type":"recent"},"to_user_id":null,"text":"AKB48\u67cf\u6728\u7531\u7d00 \u304a\u75b2\u308c\u69d8\u3002: \n\u3053\u3093\u3070\u3093\u306f(^O^)\uff0f\u266a\n\u3000\n\u3000\n\u3000\n\u4eca\u65e5\u306e\u516c\u6f14\u697d\u3057\u304b\u3063\u305f\u301c\n\u3000\n\u3000\n\u4e45\u3057\u3076\u308a\u3067\u7dca\u5f35\u3057\u305f\u3051\u3069\u3001\u306f\u3058\u3051\u307e\u304f\u3063\u305f\u305c\u3043\uff01\uff01\n\u3000\n\u3000\n\u3000\nMC\u306f\u565b\u307f\u307e\u304f\u308a\u306e\u30c6\u30f3\u30d1\u308a\u307e\u304f... http://bit.ly/ie8bEa akb48 twitter","id":41190171248431104,"from_user_id":94526795,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"222270374","profile_image_url":"http://a3.twimg.com/profile_images/1250946143/P1040062_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:53 +0000","from_user":"chrxpac","id_str":"41190158455943168","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u5b9a\u671f\u3011Twitter\u306f\uff8a\uff9f\uff7f\uff7a\uff9d\u304b\u3089\u3057\u304b\u3067\u304d\u306a\u3044\u306e\u3067\uff98\uff8c\uff9f\u8fd4\u3057\u304c\u9045\u304f\u306a\u308a\u307e\u3059(\u00b4\u30fb\u03c9\u30fb\uff40)\u3054\u4e86\u627f\u4e0b\u3055\u3044!!","id":41190158455943168,"from_user_id":222270374,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twittbot.net/" rel="nofollow">twittbot.net</a>"},{"from_user_id_str":"64009258","profile_image_url":"http://a2.twimg.com/profile_images/1154025023/Mixi___normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:52 +0000","from_user":"Tatsuyuko","id_str":"41190153447944192","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4f01\u696d\u304c\u5c31\u6d3b\u751f\u306bFacebook\u3092\u4f7f\u3063\u3066\u7533\u8acb\u305b\u3088\u3068\u3044\u3044\u3001\u4f01\u696d\u304cFacebook\u3092\u4f7f\u3048\u3068\u4f01\u696d\u304c\u8a00\u3063\u3066\u304d\u305f\u308a\u3059\u308c\u3070\u305d\u308c\u3069\u3053\u308d\u3058\u3083\u306a\u3044\u304b\u3068\u3002\u5c11\u306a\u304f\u3068\u3082\u5c31\u6d3b\u3067Twitter\u306e\u8a00\u52d5\u3084\u30d5\u30a9\u30ed\u30ef\u30fc\u3092\u8abf\u67fb\u3059\u308b\u4f01\u696d\u306f\u304b\u306a\u308a\u591a\u3044\u3067\u3059 RT @Isshee: \u4f01\u696d\u3067\u3082\u540c\u3058\u3067\u3057\u3087 RT","id":41190153447944192,"from_user_id":64009258,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"105145175","profile_image_url":"http://static.twitter.com/images/default_profile_normal.png","created_at":"Fri, 25 Feb 2011 17:37:49 +0000","from_user":"snao813","id_str":"41190141703753728","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @yumisaiki: \u795e\u69d8\u306f\u672c\u5f53\u306b\u4eba\u9593\u3092\u3059\u3070\u3089\u3057\u3044\u30d0\u30e9\u30f3\u30b9\u3067\u914d\u7f6e\u3057\u3066\u304a\u3089\u308c\u308b\u3002\u795d\u5cf6\u307f\u305f\u3044\u306a\u5c0f\u3055\u3044\u3068\u3053\u308d\u306b\u306a\u3093\u3067\u3053\u3093\u306a\u306b\u7acb\u6d3e\u306a\u4eba\u304c\u305f\u304f\u3055\u3093\u3044\u308b\u3093\u3060\u308d\u3046\u3002\u795e\u69d8\u3042\u308a\u304c\u3068\u3046\u3002\u672c\u5f53\u306b\u3042\u308a\u304c\u3068\u3046\u3002\u4eba\u9593\u3063\u3066\u3059\u3070\u3089\u3057\u3044\u3068\u601d\u3048\u305f\u3002twitter\u3082\u3042\u308a\u304c\u3068\u3046\u3002\u3000#kaminoseki","id":41190141703753728,"from_user_id":105145175,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://seesmic.com/seesmic_desktop/sd2" rel="nofollow">Seesmic Desktop</a>"},{"from_user_id_str":"203667204","profile_image_url":"http://a2.twimg.com/profile_images/1254664000/eve_blackcat_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:46 +0000","from_user":"eve_blackcat","id_str":"41190129292943361","metadata":{"result_type":"recent"},"to_user_id":146894340,"text":"@kuroiso02 \u3057\u308a\u3068\u308a\u3068\u304b\uff1f\n\u2026\u3067\u3082Twitter\u3060\u3068\u7d42\u308f\u3089\u306a\u304f\u306a\u308b\u30b1\u30c9\u2026","id":41190129292943361,"from_user_id":203667204,"to_user":"kuroiso02","geo":null,"iso_language_code":"ja","to_user_id_str":"146894340","source":"<a href="http://twipple.jp/" rel="nofollow">\u3064\u3044\u3063\u3077\u308b for iPhone</a>"},{"from_user_id_str":"6528403","profile_image_url":"http://a0.twimg.com/profile_images/1240591244/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:45 +0000","from_user":"sortiee","id_str":"41190125924917248","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30a2\u30cb\u30e1\u5b9f\u6cc1\u306ftwitter\u306e\u764c","id":41190125924917248,"from_user_id":6528403,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sites.google.com/site/peraperaprv/Home" rel="nofollow">P3:PeraPeraPrv</a>"},{"from_user_id_str":"186058304","profile_image_url":"http://a0.twimg.com/profile_images/1250454564/IMG_0210_normal.JPG","created_at":"Fri, 25 Feb 2011 17:37:37 +0000","from_user":"00o8o00","id_str":"41190090386448384","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @fuefukioyasumi: \u3082\u3046\u3044\u3044\u3002\u300c\u671d\u751f\u300d\u306a\u3093\u304b\u3044\u3044\u3002BBC\u3082CNN\u3082\u82f1\u8a9e\u653e\u9001\u3060\u3002\u307f\u3093\u306a\u3001\u30c6\u30ec\u30d3\u3092\u3076\u3061\u3063\u3068\u5207\u3063\u3066Twitter\u3092\u898b\u3088\u3046\u3002\u3053\u3053\u306b\u300c\u751f\u304d\u305f\u60c5\u5831\u300d\u304c\u6d41\u308c\u3066\u3044\u308b\u3002\u300c\u751f\u304d\u305f\u53eb\u3073\u300d\u304c\u3042\u308b\u3002\u3053\u3053\u304b\u3089\u3067\u3082\u6b74\u53f2\u306e\u8ee2\u63db\u70b9\u3092\u611f\u3058\u308b\u4e8b\u304c\u3067\u304d\u308b\u306e\u3060\u3002 @gjmorley #libjp","id":41190090386448384,"from_user_id":186058304,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"49219631","profile_image_url":"http://a2.twimg.com/profile_images/1231873117/__2-colornow__2__normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:33 +0000","from_user":"irisgazer","id_str":"41190073227550720","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3067\u3059\u3088\u306d\u3047 RT @minamitaiheiyou: \u6545\u306b\u30cd\u30bf\u30d0\u30ec\u3092\u3059\u308b\u306e\u3082\u81ea\u7531\u3002\u30cd\u30bf\u3070\u308c\u3057\u305f\u4eba\u3092\u30c7\u30a3\u30b9\u308b\u306e\u3082\u81ea\u7531\u3002\u3042\u3068\u306f\u5404\u3005\u306e\u88c1\u91cf\u3067\u4e57\u308a\u5207\u3063\u3066\u304f\u3060\u3055\u3044\u3088\u3081\u3093\u3069\u304f\u3055\u3044\u306a RT @kihirokiro: Twitter\u3067\u30cd\u30bf\u30d0\u30ec\u4e91\u3005\u3044\u3063\u3066\u3082\u5143\u3005Twitter\u3063\u3066\u300c\u500b\u4eba\u306e\u72ec\u308a\u8a00\u300d\u3060\u308d","id":41190073227550720,"from_user_id":49219631,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"98560114","profile_image_url":"http://a0.twimg.com/profile_images/1252332545/IMGP8170_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:32 +0000","from_user":"qess0093","id_str":"41190070706905088","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30b7\u30e5\u30fc\u30c6\u30a3\u304f\u305d\u3046\u305c\u3048\uff57 RT @syu_thi_bot: \u3044\u3064\u307e\u3067Twitter\u3084\u3063\u3066\u308b\u3093\u3060\u3044\uff1f\u3044\u3044\u52a0\u6e1b\u73fe\u5b9f\u306b\u623b\u308a\u306a\u3088\u3002\u3053\u3053\u306f\u30ad\u30df\u305f\u3061\u4e09\u6b21\u5143\u306e\u4eba\u9593\u304c\u3044\u308b\u3079\u304d\u5834\u6240\u3058\u3083\u306a\u3044\u3093\u3060\u3088\u3002\u305d\u3093\u306a\u306e\u57fa\u672c\u3060\u308d\uff01\uff01","id":41190070706905088,"from_user_id":98560114,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"197459334","profile_image_url":"http://a3.twimg.com/profile_images/1210698414/shiratorishoko_normal.png","created_at":"Fri, 25 Feb 2011 17:37:31 +0000","from_user":"SyokoShiratori","id_str":"41190064243478528","metadata":{"result_type":"recent"},"to_user_id":null,"text":"+0.50kg \u540c\u3058\u304f\u30c0\u30a4\u30a8\u30c3\u30c8\u4e2d\u3067\u3059\u3002\u3088\u304f\u3053\u306e\u30b5\u30a4\u30c8\u3067\u4f53\u91cd\u5831\u544a\u3057\u3066\u307e\u3059\u266a http://bit.ly/fhN2fM RT @msophiah \u3046\u3046\u3046\u30fb\u30fb\u30fb\u304a\u8179\u3059\u3044\u305f\u301c\u30fb\u30fb\u30fb\u6211\u6162\u3001\u6211\u6162\u3001\u6211\u6162\u3002\u30c0\u30a4\u30a8\u30c3\u30c8\u3001\u30c0\u30a4\u30a8\u30c3\u30c8\u3001\u30c0\u30a4\u30a8\u30c3\u30c8\u3002","id":41190064243478528,"from_user_id":197459334,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://mob-mc.com" rel="nofollow">\uff08\u4eee\u79f0\uff09\u30c4\u30a4\u30af\u30ea\u30c3\u30af twiclick</a>"},{"from_user_id_str":"180410237","profile_image_url":"http://a3.twimg.com/profile_images/1254473979/icon_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:30 +0000","from_user":"ka_ph","id_str":"41190062184079360","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u5b9a\u671fpost\u3011\u30d5\u30a7\u30eb\u30c7\u30a3\u30ca\u30f3\u30c8bot( http://twitter.com/ferdinand_bot )\u4f5c\u308a\u307e\u3057\u305f\u3002\u304a\u5b50\u69d8\u306e\u540d\u524d\u304a\u501f\u308a\u3055\u305b\u3066\u304f\u308c\u308b\u65b9\u3044\u307e\u3057\u305f\u3089@ka_ph\u307e\u3067\u304a\u9858\u3044\u3057\u307e\u3059\u3002","id":41190062184079360,"from_user_id":180410237,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twittbot.net/" rel="nofollow">twittbot.net</a>"},{"from_user_id_str":"52283906","profile_image_url":"http://a3.twimg.com/profile_images/387644016/10100654519_s_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:26 +0000","from_user":"rolling_bean","id_str":"41190043313913856","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3081\u307e\u3044\u304c\u3057\u307e\u3059\u306d\u301cRT @yurikalin:\u30b3\u30a4\u30c4\u30e9\u5168\u54e1\u3044\u306a\u304f\u306a\u3063\u305f\u3089\u3001\u660e\u308b\u304f\u306a\u308b\u3060\u308d\u3046\u306a\u3041\uff5e\u266a\uff1e\u65e5\u672c\u306e\u30d3\u30b8\u30e7\u30f3 RT roll \u65e5\u7d4c\uff06CSIS\u30b7\u30f3\u30dd\u30b8\u30a6\u30e0\u300c\u5b89\u4fdd\u6539\u5b9a50\u5468\u5e74\u3001\u3069\u3046\u306a\u308b\u65e5\u7c73\u95a2\u4fc2\u300d http://bit.ly/dES8PY\u3000http://bit.ly/ihg0GT","id":41190043313913856,"from_user_id":52283906,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://tabtter.jp" rel="nofollow">\u30bf\u30d6\u30c3\u30bf\u30fc</a>"},{"from_user_id_str":"351896","profile_image_url":"http://a3.twimg.com/profile_images/1179865336/icon12911887173020_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:26 +0000","from_user":"cicada","id_str":"41190043292925952","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4e2d\u5b66\u53d7\u9a13\u7a0b\u5ea6\u306e\u7b97\u6570\u306e\u554f\u984c\u3092\u51fa\u3059BOT http://twitter.com/arithmetic_bot \u6c17\u306b\u306f\u306a\u308b\u304c\u3001\u3061\u3083\u3093\u3068\u898b\u308b\u65e5\u304c\u6765\u308b\u3060\u308d\u3046\u304b\u30fb\u30fb\u3000#tearai\uff1a\u30ed\u30b3\u30e9\u30dc\u5bae\u5d0e\u770c http://locolabo.com/mz/ #mzlf","id":41190043292925952,"from_user_id":351896,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://locolabo.com/mz/" rel="nofollow">\u30ed\u30b3\u30e9\u30dc\u5bae\u5d0e\u770c</a>"},{"from_user_id_str":"744554","profile_image_url":"http://a1.twimg.com/profile_images/1088753125/11868894_normal.gif","created_at":"Fri, 25 Feb 2011 17:37:20 +0000","from_user":"Febreze","id_str":"41190019020505088","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30cd\u30bf\u30d0\u30ec\u3042\u307e\u308a\u6c17\u306b\u3057\u306a\u3044\u30bf\u30a4\u30d7\u3060\u3051\u3069\u306a\u3093\u304b\u3053\u3046Twitter\u958b\u304f\u3060\u3051\u3067\u30ac\u30f3\u30ac\u30f3\u30cd\u30bf\u30d0\u30ec\u5165\u3063\u3066\u304f\u308b\u306e\u306f\u306a\u3093\u3068\u3082\u8a00\u3048\u306a\u3044\u306a\u3002","id":41190019020505088,"from_user_id":744554,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"203371794","profile_image_url":"http://a1.twimg.com/profile_images/1226537594/___normal.png","created_at":"Fri, 25 Feb 2011 17:37:16 +0000","from_user":"himeko24","id_str":"41190004139114496","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6b21\u3044\u3063\u3066\u307f\u3088\u30fc\u3000\u306f\u3044\u3053\u308c\u3000 \u6fc0\u5b89\u26052010\u5e74\u590f\u65b0\u30c7\u30b6\u30a4\u30f3\u2605\u30bb\u30af\u30b7\u30fc\u306a\u9023\u4f53\u5f0f\u7121\u5730\u6c34\u7740 \u80f8\u30d1\u30c3\u30c9\u4ed8\u304dQ122 http://bit.ly/h72C4i","id":41190004139114496,"from_user_id":203371794,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.google.co.jp" rel="nofollow">himeko24</a>"},{"from_user_id_str":"119988932","profile_image_url":"http://a3.twimg.com/profile_images/1214344633/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:16 +0000","from_user":"7na_love_6sa","id_str":"41190002000007169","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30d6\u30ed\u30b0\u66f4\u65b0\u3057\u307e\u3057\u305f\uff01Twitter\uff06mixi\u304b\u3089\u3082\u30b3\u30e1\u30f3\u30c8\u5b9c\u3057\u304f\u306d\u266a\n\u300c\u30cd\u30a4\u30eb\u30c1\u30a7\u30f3\u30b8\u266a\u300d http://amba.to/hy0Do2","id":41190002000007169,"from_user_id":119988932,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"217408835","profile_image_url":"http://a1.twimg.com/profile_images/1215428655/____4.0157_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:12 +0000","from_user":"nikubenki1123","id_str":"41189985424125952","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @x68k: \u57fa\u672c\u7684\u306bTwitter\u4e0a\u3067\u306f"\u597d\u304d\u306b\u3084\u308c\u3070\u3044\u3044"\u3060\u3051\u3069\u3001\u540d\u524d\u3082\u30a2\u30a4\u30b3\u30f3\u3082\u30a2\u30f3\u30bf\u3058\u3083\u306a\u3044\u305f\u304f\u3055\u3093\u306e\u4eba\u305f\u3061\u306e\u9b42\u304c\u3053\u3082\u3063\u305f\u3082\u306e\u306a\u306e\u3060\u304b\u3089\u3001\u305d\u308c\u3060\u3051\u306f"\u80cc\u8ca0\u3048"\u3068\u601d\u3046\uff1e\u30ad\u30e3\u30e9\u30af\u30bf\u30fc\u30a2\u30ab\u30a6\u30f3\u30c8","id":41189985424125952,"from_user_id":217408835,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://tweetlogix.com" rel="nofollow">Tweetlogix</a>"},{"from_user_id_str":"139137996","profile_image_url":"http://a0.twimg.com/profile_images/1087408006/cut_work_18_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:12 +0000","from_user":"fujiokayouko","id_str":"41189984354566144","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u591c\u4e2d\u306bTwitter\u3092\u306a\u3093\u3068\u306a\u304f\u8997\u3044\u305f\u3089\u3082\u306e\u3059\u3054\u3044\u307e\u3069\u30de\u30aeTL\u3067","id":41189984354566144,"from_user_id":139137996,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://mobile.twitter.com" rel="nofollow">Mobile Web</a>"},{"from_user_id_str":"61221002","profile_image_url":"http://a3.twimg.com/profile_images/554916301/_1259757374_61_normal.png","created_at":"Fri, 25 Feb 2011 17:37:08 +0000","from_user":"hiromk63","id_str":"41189970613903360","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @kenji_kohashi \u7121\u4e8b\u6620\u753b\u88fd\u4f5c\u306e\u5831\u544a\u306f\u3067\u304d\u305f\u3051\u3069\u4eca\u3060\u7de8\u96c6\u306f\u7d9a\u3044\u3066\u307e\u3059w \u305d\u3093\u306a\u3068\u3053\u3067 \u6620\u753b\u300cDON'T STOP!\u300d\u306eTwitter \u30a2\u30ab\u30a6\u30f3\u30c8 @DONTSTOPMOVIE \u3082\u958b\u59cb\u3001\u3082\u3057\u826f\u304b\u3063\u305f\u3089\u30d5\u30a9\u30ed\u30fc\u3057\u3066\u304f\u3060\u3055\u3044\uff01\u50d5\u3082\u542b\u3081\u6620\u753b\u88fd\u4f5c\u95a2\u4fc2\u8005\u304c\u6c17\u9577\u306b\u3064\u3076\u3084\u304d\u307e\u3059","id":41189970613903360,"from_user_id":61221002,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"147393812","profile_image_url":"http://a1.twimg.com/profile_images/1114001122/hana_10_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:07 +0000","from_user":"tubasa_uki","id_str":"41189965924667392","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\uff10\uff10\uff17\u3082\u3073\u3063\u304f\u308a\u3000\u5927\u56fd\u306e\u5927\u7d71\u9818\u9078\u304b\u3089\u3000\u5cf6\u56fd\u306e\u5730\u65b9\u9078\u306e\u9078\u6319\u307e\u3067\u306b\u3082\u3000\u6697\u8e8d\u3057\u3066\u3044\u308b\uff3e\uff3e\u3000\u3053\u306eTwitter \u30b9\u30ad\u30e3\u30f3\u30c0\u30eb\u3084\u60aa\u8cea\u306a\u4e8b\u4ef6\u306b\u3082\u7d61\u3080\u304c\u3000Twitter\u304b\u3089\u767a\u4fe1\u3055\u308c\u305f\u3000\u5e73\u548c\u3078\u306e\u8ca2\u732e\u306f\u3000\u307e\u3055\u306b\u30ce\u30fc\u3079\u30eb\u5e73\u548c\u8cde\u3082\u306e http://bit.ly/esjWDG #dotubo_ss","id":41189965924667392,"from_user_id":147393812,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twittbot.net/" rel="nofollow">twittbot.net</a>"},{"from_user_id_str":"96081746","profile_image_url":"http://a0.twimg.com/profile_images/1244505419/illust832_normal.png","created_at":"Fri, 25 Feb 2011 17:37:07 +0000","from_user":"kazukt","id_str":"41189963131387904","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3046\u308b\u304a\u307c\u7d75\u3001\u4ed6\u306e\u4eba\u306e\u3082\u898b\u3066\u3044\u305f\u3089\u3084\u305f\u3089\u30de\u30f3\u30ac\u306e\u30ad\u30e3\u30e9\u30af\u30bf\u30fc\u3067\u3080\u3061\u3083\u304f\u3061\u3083\u4e0a\u624b\u3044\u4eba\u304c\uff01\u2026\u3068\u3001\u30d7\u30ed\u30d5\u30a3\u30fc\u30eb\u898b\u305f\u3089\u3001\u306a\u3093\u3068\u3054\u672c\u4eba\u304c\u66f8\u3044\u3066\u3044\u3089\u3063\u3057\u3083\u3063\u305f\u3002Twitter\u3063\u3066\u30b9\u30b4\u30a4\u308f\u3002","id":41189963131387904,"from_user_id":96081746,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://janetter.net/" rel="nofollow">Janetter</a>"},{"from_user_id_str":"86306230","profile_image_url":"http://a1.twimg.com/profile_images/593004766/j2j_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:03 +0000","from_user":"excite_j2j","id_str":"41189949927596032","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u79c1\u306f\u3001\u65e9\u7a32\u7530\u5927\u5b66\u30aa\u30fc\u30d7\u30f3\u30ab\u30ec\u30c3\u30b8\u306e\u5b66\u751f\u306e\u8003\u3048\u3066\u3044\u308b\u3001\u5352\u696d\u751fSoudai /\u65e9\u7a32\u7530\u30ab\u30fc\u30c9\u4f1a\u54e1/ Soudai\u5b66\u751f\u89aa/\u3001\u8ab0\u304b\u304c\u30aa\u30fc\u30d7\u30f3\u30ab\u30ec\u30c3\u30b8\u65e9\u7a32\u7530\u5927\u5b662000\u5186\u306e\u5165\u5834\u6599\u306e\u30e1\u30f3\u30d0\u30fc\u3092\u7d39\u4ecb\u3057\u3066\u304f\u308c\u305f\u65b9\u304c\u305a\u3063\u3068\u5b89\u4e0a\u304c\u308a\u3060\u3002 (\u5143\u767a\u8a00 http://bit.ly/esxiwT )","id":41189949927596032,"from_user_id":86306230,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://d.hatena.ne.jp/fn7" rel="nofollow">\u65e5\u672c\u8a9e\u65e5\u672c\u8a9e\u7ffb\u8a33\u30b8\u30a7\u30cd\u30ec\u30fc\u30bf</a>"},{"from_user_id_str":"120927161","profile_image_url":"http://a0.twimg.com/profile_images/1230006483/20110131_13022_26776_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:00 +0000","from_user":"FRISKFOSSILFANG","id_str":"41189933855158272","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @syu_thi_bot: \u3044\u3064\u307e\u3067Twitter\u3084\u3063\u3066\u308b\u3093\u3060\u3044\uff1f\u3044\u3044\u52a0\u6e1b\u73fe\u5b9f\u306b\u623b\u308a\u306a\u3088\u3002\u3053\u3053\u306f\u30ad\u30df\u305f\u3061\u4e09\u6b21\u5143\u306e\u4eba\u9593\u304c\u3044\u308b\u3079\u304d\u5834\u6240\u3058\u3083\u306a\u3044\u3093\u3060\u3088\u3002\u305d\u3093\u306a\u306e\u57fa\u672c\u3060\u308d\uff01\uff01","id":41189933855158272,"from_user_id":120927161,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twittbot.net/" rel="nofollow">twittbot.net</a>"},{"from_user_id_str":"228973151","profile_image_url":"http://a1.twimg.com/sticky/default_profile_images/default_profile_0_normal.png","created_at":"Fri, 25 Feb 2011 17:36:59 +0000","from_user":"daisuke1589","id_str":"41189931887890432","metadata":{"result_type":"recent"},"to_user_id":null,"text":"twitter\u3063\u3066\u52dd\u624b\u306b\u30d5\u30a9\u30ed\u30fc\u3057\u3066\u3082\u3044\u3044\u3093\u3060\u3063\u3051\uff1f","id":41189931887890432,"from_user_id":228973151,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"54314110","profile_image_url":"http://a2.twimg.com/profile_images/1193541240/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:57 +0000","from_user":"Alohazuki","id_str":"41189922668953600","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Twitter\u306e\u5e83\u5cf6\u5f01\u3082\u3042\u3063\u305f\u3093\u3060\u306d\u3002","id":41189922668953600,"from_user_id":54314110,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.flight.co.jp/iPhone/TweetMe/" rel="nofollow">TweetMe for iPhone</a>"},{"from_user_id_str":"72594681","profile_image_url":"http://a3.twimg.com/profile_images/1227240916/____normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:56 +0000","from_user":"uri4ichi","id_str":"41189916922744832","metadata":{"result_type":"recent"},"to_user_id":226852303,"text":"@7_fuka Twitter\u304b\u3076\u308c\u306f\u3001\u3059\u3050\u306bD\u306b\u8d70\u308b\u306e\u3067\u3002\u306a\u3093\u3060\u304b\u5fae\u7b11\u307e\u3057\u3044\u306e\u3067\u3059( \u2579\u25e1\u2579)","id":41189916922744832,"from_user_id":72594681,"to_user":"7_fuka","geo":null,"iso_language_code":"ja","to_user_id_str":"226852303","source":"<a href="http://sites.google.com/site/yorufukurou/" rel="nofollow">YoruFukurou</a>"},{"from_user_id_str":"168393854","profile_image_url":"http://a3.twimg.com/profile_images/1253554518/GuNp3xVS_normal","created_at":"Fri, 25 Feb 2011 17:36:55 +0000","from_user":"makonyanhime","id_str":"41189913701515264","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6589\u85e4\u3055\u3093\u3082\u30c0\u30e1\u3060...\u4eca\u591c\u306fTwitter\u5909\u3060\u306a\u3041(;_;)","id":41189913701515264,"from_user_id":168393854,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://mobile.twitter.com" rel="nofollow">Twitter for Android</a>"},{"from_user_id_str":"122636787","profile_image_url":"http://a2.twimg.com/profile_images/1189607563/DSC01987_normal.JPG","created_at":"Fri, 25 Feb 2011 17:36:54 +0000","from_user":"enpy1217","id_str":"41189908500594688","metadata":{"result_type":"recent"},"to_user_id":null,"text":"twitter\u4e45\u3057\u3076\u308a\u306b\u958b\u3044\u305f\u3002\u3068\u3066\u3082\u591a\u5fd9\u3060\u3063\u305f\u3002\u75b2\u308c\u305f\u3002\u304a\u98a8\u5442\u306b\u3082\u5165\u308c\u306a\u304b\u3063\u305f\u3002\u30ad\u30bf\u30cd\u2026","id":41189908500594688,"from_user_id":122636787,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.flight.co.jp/iPhone/TweetMe/" rel="nofollow">TweetMe for iPhone</a>"},{"from_user_id_str":"81663694","profile_image_url":"http://a3.twimg.com/profile_images/1177576126/__normal.png","created_at":"Fri, 25 Feb 2011 17:36:51 +0000","from_user":"progmiya","id_str":"41189895494049792","metadata":{"result_type":"recent"},"to_user_id":94050844,"text":"@hirasai_skyhigh \u6674\u308c\u541b\u3002\u30cd\u30bf\u30d0\u30ec\u306f\u898b\u305f\u304f\u306a\u3044\u3051\u3069\u30012ch\u3082twitter\u3082\u3084\u308a\u305f\u3044\u306e\u304c\u4eba\u3068\u8a00\u3046\u3082\u306e\u3088","id":41189895494049792,"from_user_id":81663694,"to_user":"hirasai_skyhigh","geo":null,"iso_language_code":"ja","to_user_id_str":"94050844","source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"159237469","profile_image_url":"http://a3.twimg.com/profile_images/1140433484/______2_normal.png","created_at":"Fri, 25 Feb 2011 17:36:50 +0000","from_user":"hikari_juku","id_str":"41189892096532480","metadata":{"result_type":"recent"},"to_user_id":135634241,"text":"@sssukimasuky \n\u4f55\u304b\u3042\u3063\u305f\u98a8\u3067\u3059\u306d\uff08\u7b11\uff09\u3000\u78ba\u304b\u306bTwitter\u306f\u6c17\u8efd\u3067\u3059\u3057\u306d\u3002\u30e1\u30fc\u30eb\u306b\u306a\u308b\u3068\u30d5\u30c3\u30c8\u30ef\u30fc\u30af\u304c\u91cd\u304f\u306a\u308b\u5834\u5408\u3082\u3042\u308b\u304b\u3082\u3057\u308c\u307e\u305b\u3093\u306d\u3002\u305d\u3046\u8003\u3048\u308b\u3068\u3059\u3054\u3044\u6642\u4ee3\u3060\u3002","id":41189892096532480,"from_user_id":159237469,"to_user":"sssukimasuky","geo":null,"iso_language_code":"ja","to_user_id_str":"135634241","source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"141915990","profile_image_url":"http://a0.twimg.com/profile_images/1248969898/icon679566266564378764images_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:48 +0000","from_user":"adashino_","id_str":"41189886878949376","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @fuefukioyasumi: \u3082\u3046\u3044\u3044\u3002\u300c\u671d\u751f\u300d\u306a\u3093\u304b\u3044\u3044\u3002BBC\u3082CNN\u3082\u82f1\u8a9e\u653e\u9001\u3060\u3002\u307f\u3093\u306a\u3001\u30c6\u30ec\u30d3\u3092\u3076\u3061\u3063\u3068\u5207\u3063\u3066Twitter\u3092\u898b\u3088\u3046\u3002\u3053\u3053\u306b\u300c\u751f\u304d\u305f\u60c5\u5831\u300d\u304c\u6d41\u308c\u3066\u3044\u308b\u3002\u300c\u751f\u304d\u305f\u53eb\u3073\u300d\u304c\u3042\u308b\u3002\u3053\u3053\u304b\u3089\u3067\u3082\u6b74\u53f2\u306e\u8ee2\u63db\u70b9\u3092\u611f\u3058\u308b\u4e8b\u304c\u3067\u304d\u308b\u306e\u3060\u3002 @gjmorley #libjp","id":41189886878949376,"from_user_id":141915990,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"111308629","profile_image_url":"http://a1.twimg.com/profile_images/1137421845/mmooton_normal.png","created_at":"Fri, 25 Feb 2011 17:36:46 +0000","from_user":"mmooton","id_str":"41189877940748288","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @minponjp: \u3010\u3064\u3076\u3084\u304f\u3060\u3051\u306710000\u5186\u5546\u54c1\u5238GET\u3011<<visa\u30ae\u30d5\u30c8\u30ab\u30fc\u30c910000\u5186\u5206\u3092\u6bce\u6708\u62bd\u9078\u3067\u30d7\u30ec\u30bc\u30f3\u30c8>> \u21d2\u8a73\u3057\u304f\u306f\u4e0b\u306e\uff35\uff32\uff2c\u3088\u308a\u2193\u2193\u2193\u2193\u2193 http://minpon.jp/user_data/twitter_campaign.php","id":41189877940748288,"from_user_id":111308629,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twittbot.net/" rel="nofollow">twittbot.net</a>"},{"from_user_id_str":"140945098","profile_image_url":"http://a0.twimg.com/profile_images/1198948281/b7664c71-87bc-4187-9d46-a61ab8d41b96_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:46 +0000","from_user":"waruimayuko","id_str":"41189877122867200","metadata":{"result_type":"recent"},"to_user_id":113371008,"text":"@toumeisyoujyo \u3042\u3053\u3061\u3083\u3093Twitter\u3084\u3063\u3066\u305f\u306e\u306d\u3002\u307e\u3060\u304a\u5e2d\u3042\u308b\u305d\u3046\u306a\u306e\u3067\u662f\u975e\uff01","id":41189877122867200,"from_user_id":140945098,"to_user":"toumeisyoujyo","geo":null,"iso_language_code":"ja","to_user_id_str":"113371008","source":"<a href="http://twimi.jp/?r=via" rel="nofollow">twimi\u2606new</a>"},{"from_user_id_str":"167512527","profile_image_url":"http://a1.twimg.com/profile_images/1172286365/newspaper_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:45 +0000","from_user":"KoranKaget","id_str":"41189871775252480","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://bit.ly/93Eeud RT @motocentrism \u30d6\u30ed\u30b0\u8a18\u4e8b\u66f8\u304d\u307e\u3057\u305f\u30fc\uff1a MotoGP\u3000\u30d6\u30c3\u30af\u30e1\u30fc\u30ab\u30fc\u306b\u898b\u308b\u5404\u30e9\u30a4\u30c0\u30fc\u306e\u4e0b\u99ac\u8a55 - http://goo.gl/xVe6... http://bit.ly/hDYxyx @motogpudpate","id":41189871775252480,"from_user_id":167512527,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"160251772","profile_image_url":"http://a3.twimg.com/profile_images/1150692471/_____normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:45 +0000","from_user":"keikochaki","id_str":"41189870781075456","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u300c\u305a\u3063\u3068twitter\u3084\u3063\u3066\u308b\u3088\u306d\u300d\u3068\u6012\u3089\u308c\u3066\u3057\u307e\u3063\u305f(\u82e6\u7b11)","id":41189870781075456,"from_user_id":160251772,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twtr.jp" rel="nofollow">Keitai Web</a>"},{"from_user_id_str":"211565766","profile_image_url":"http://a2.twimg.com/sticky/default_profile_images/default_profile_5_normal.png","created_at":"Fri, 25 Feb 2011 17:36:42 +0000","from_user":"sayap1yo","id_str":"41189858236043264","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u304a\u98df\u4e8b\u4f1a\u884c\u304d\u305f\u304b\u3063\u305f\u3051\u3069\n\u53cb\u9054\u3068\u904a\u3093\u3067\u307e\u3093\u305f\ue056\ue326\n\nTwitter\u898b\u3066\u307e\u3057\u305f\u3051\u3069\n\u3064\u3076\u3084\u304f\u30bf\u30a4\u30df\u30f3\u30b0\n\u5931\u3063\u3066\u305f\u3060\u3051\u3067\u3059( \u00b4 \u25bd ` )\uff89\u7b11","id":41189858236043264,"from_user_id":211565766,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.nibirutech.com" rel="nofollow">TwitBird</a>"},{"from_user_id_str":"19603191","profile_image_url":"http://a1.twimg.com/profile_images/1254077264/116_normal.gif","created_at":"Fri, 25 Feb 2011 17:36:40 +0000","from_user":"Purple_Flash","id_str":"41189851873157120","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @syu_thi_bot: \u3044\u3064\u307e\u3067Twitter\u3084\u3063\u3066\u308b\u3093\u3060\u3044\uff1f\u3044\u3044\u52a0\u6e1b\u73fe\u5b9f\u306b\u623b\u308a\u306a\u3088\u3002\u3053\u3053\u306f\u30ad\u30df\u305f\u3061\u4e09\u6b21\u5143\u306e\u4eba\u9593\u304c\u3044\u308b\u3079\u304d\u5834\u6240\u3058\u3083\u306a\u3044\u3093\u3060\u3088\u3002\u305d\u3093\u306a\u306e\u57fa\u672c\u3060\u308d\uff01\uff01","id":41189851873157120,"from_user_id":19603191,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twittbot.net/" rel="nofollow">twittbot.net</a>"},{"from_user_id_str":"215930291","profile_image_url":"http://a0.twimg.com/profile_images/1247906106/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:30 +0000","from_user":"minori_millie","id_str":"41189810055938048","metadata":{"result_type":"recent"},"to_user_id":212972774,"text":"@c_c_chika \u7b11\u3063\u3066\u305d\u3046\u3060\u306a\u3063\u3066\u601d\u3063\u3066\u305f(o^^o)\u30c1\u30ab\u306e\u7b11\u3044\u58f0\u304c\u805e\u3053\u3048\u3066\u304d\u305f\u3082\u3093\u3002mail\u306bTwitter\u3067\u5927\u5fd9\u3057\u3084\u3002","id":41189810055938048,"from_user_id":215930291,"to_user":"c_c_chika","geo":null,"iso_language_code":"ja","to_user_id_str":"212972774","source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"197459334","profile_image_url":"http://a3.twimg.com/profile_images/1210698414/shiratorishoko_normal.png","created_at":"Fri, 25 Feb 2011 17:36:30 +0000","from_user":"SyokoShiratori","id_str":"41189809586311168","metadata":{"result_type":"recent"},"to_user_id":null,"text":"+0.90kg \u30c0\u30a4\u30a8\u30c3\u30c8\u5fdc\u63f4\u3057\u3066\u307e\u3059\u3002(*^^*)\u30c0\u30a4\u30a8\u30c3\u30c8\u4f53\u91cd\u5831\u544a\u306e\u3064\u3076\u3084\u304d\u3067\u3059\u3002 http://bit.ly/fhN2fM RT @hayayumi \u3053\u3093\u306a\u6642\u9593\u306b\u3084\u304d\u306b\u304f\u30fc\u266b\u30c0\u30a4\u30a8\u30c3\u30c8\u671f\u9593\u306a\u306e\u306b\u306d....","id":41189809586311168,"from_user_id":197459334,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://mob-mc.com" rel="nofollow">\uff08\u4eee\u79f0\uff09\u30c4\u30a4\u30af\u30ea\u30c3\u30af twiclick</a>"},{"from_user_id_str":"12337665","profile_image_url":"http://a0.twimg.com/profile_images/1146194926/pixiv-icon_normal.png","created_at":"Fri, 25 Feb 2011 17:36:27 +0000","from_user":"t_a_k_i","id_str":"41189797364121600","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Google\u30ea\u30fc\u30c0\u30fc\u3067\u30b5\u30a4\u30c8\u306e\u66f4\u65b0\u30c1\u30a7\u30c3\u30af\u3059\u308b\u3088\u308a\u3001Twitter\u30a2\u30ab\u30a6\u30f3\u30c8\u3092\u30d5\u30a9\u30ed\u30fc\u3057\u3066\u66f4\u65b0\u3092\u77e5\u308b\u307b\u3046\u304c\u4fbf\u5229\u3060\u306a\u3053\u308c","id":41189797364121600,"from_user_id":12337665,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sites.google.com/site/yorufukurou/" rel="nofollow">YoruFukurou</a>"},{"from_user_id_str":"104862453","profile_image_url":"http://a3.twimg.com/profile_images/1248609864/Image014_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:25 +0000","from_user":"yuz_ume","id_str":"41189787943714816","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @fuefukioyasumi: \u3082\u3046\u3044\u3044\u3002\u300c\u671d\u751f\u300d\u306a\u3093\u304b\u3044\u3044\u3002BBC\u3082CNN\u3082\u82f1\u8a9e\u653e\u9001\u3060\u3002\u307f\u3093\u306a\u3001\u30c6\u30ec\u30d3\u3092\u3076\u3061\u3063\u3068\u5207\u3063\u3066Twitter\u3092\u898b\u3088\u3046\u3002\u3053\u3053\u306b\u300c\u751f\u304d\u305f\u60c5\u5831\u300d\u304c\u6d41\u308c\u3066\u3044\u308b\u3002\u300c\u751f\u304d\u305f\u53eb\u3073\u300d\u304c\u3042\u308b\u3002\u3053\u3053\u304b\u3089\u3067\u3082\u6b74\u53f2\u306e\u8ee2\u63db\u70b9\u3092\u611f\u3058\u308b\u4e8b\u304c\u3067\u304d\u308b\u306e\u3060\u3002 @gjmorley #libjp","id":41189787943714816,"from_user_id":104862453,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"213846746","profile_image_url":"http://a1.twimg.com/profile_images/1242263342/haruhi1_normal.png","created_at":"Fri, 25 Feb 2011 17:36:23 +0000","from_user":"sloth888jpgame","id_str":"41189778409922560","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u643a\u5e2f\u96fb\u8a71\u7528\u306eTwitter\u3092\u5229\u7528\u3057\u305f\u30b2\u30fc\u30e0\u3092\u77e5\u3063\u3066\u3044\u308b\u4eba\u306f\u3001\u7d39\u4ecb\u3057\u3066\u304f\u3060\u3055\u3044\u3002 #TwitterGame","id":41189778409922560,"from_user_id":213846746,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twittbot.net/" rel="nofollow">twittbot.net</a>"},{"from_user_id_str":"17484724","profile_image_url":"http://a2.twimg.com/profile_images/1138677235/iconue_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:22 +0000","from_user":"tsutcho","id_str":"41189777831231490","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30a2\u30aa\u30b7\u30de\u3055\u3093twitter\u306b\u7acb\u3064\u30fb\u30fb\u30fb\u3060\u3068\u30fb\u30fb\u30fb\uff1f\uff12\u756a\u76ee\u306e\u30d5\u30a9\u30ed\u30ef\u30fc\u306e\u5ea7\u3092\u3044\u305f\u3060\u3044\u3066\u304a\u3053\u3046","id":41189777831231490,"from_user_id":17484724,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"220041064","profile_image_url":"http://a1.twimg.com/sticky/default_profile_images/default_profile_0_normal.png","created_at":"Fri, 25 Feb 2011 17:36:21 +0000","from_user":"sloth888jp_bot5","id_str":"41189772521254914","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6642\u3005\u3001TwiAll\uff08\u30c4\u30a4\u30aa\u30fc\u30eb\uff09\u3067Twitter\u306e\u81ea\u52d5\u30d5\u30a9\u30ed\u30fc\u30fb\u30d5\u30a9\u30ed\u30fc\u8fd4\u3057\u3092\u3057\u3066\u3044\u307e\u3059\u3002","id":41189772521254914,"from_user_id":220041064,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twittbot.net/" rel="nofollow">twittbot.net</a>"},{"from_user_id_str":"177693537","profile_image_url":"http://a0.twimg.com/profile_images/1240130924/20110207213206_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:21 +0000","from_user":"Na_Okinawa","id_str":"41189769912397824","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @ebizo66: \u30ea\u30d3\u30a2\u30fb\u30c8\u30ea\u30dd\u30ea\u306eTw\uff1a\u6551\u6025\u8eca\u304c\u6765\u305f\u304c\u3001\u8ca0\u50b7\u8005\u3092\u8eca\u5185\u3067\u6bba\u5bb3\u3057\u3066\u3044\u305f\u3001\u3068\u3002\uff08\u6ec5\u8336\u82e6\u8336\u3060\uff01\uff09http://ow.ly/43pQ2 #libjp","id":41189769912397824,"from_user_id":177693537,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"147006592","profile_image_url":"http://a2.twimg.com/profile_images/1251306448/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:19 +0000","from_user":"takasu_rika","id_str":"41189763532865536","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @kihirokiro: Twitter\u3067\u30cd\u30bf\u30d0\u30ec\u4e91\u3005\u3044\u3063\u3066\u3082\u5143\u3005Twitter\u3063\u3066\u300c\u500b\u4eba\u306e\u72ec\u308a\u8a00\u300d\u3060\u308d","id":41189763532865536,"from_user_id":147006592,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"100239985","profile_image_url":"http://a1.twimg.com/profile_images/733461294/CIMG0207_normal.JPG","created_at":"Fri, 25 Feb 2011 17:36:19 +0000","from_user":"strangebarjun","id_str":"41189762182152192","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Twitter\u3092\u59cb\u3081\u3066\u3001\u305d\u308d\u305d\u308d\u4e00\u5e74\u306b\u306a\u308a\u307e\u3059\u3002\u632f\u308a\u8fd4\u308b\u3068\u3001\u307c\u304f\u306e\u4eba\u9593\u6027\u3092\u305d\u3063\u304f\u308a\u53cd\u6620\u3059\u308b\u304c\u5982\u304f\u3001\u534a\u7aef\u3067\u3059\u306d\u3002\u60c5\u5831\u53ce\u96c6\u30c4\u30fc\u30eb\u3001\u60c5\u5831\u767a\u4fe1\u30c4\u30fc\u30eb\u3001\u30b3\u30df\u30e5\u30cb\u30b1\u30fc\u30b7\u30e7\u30f3\u30c4\u30fc\u30eb\u3001\u3069\u308c\u3082\u6a5f\u80fd\u3057\u5207\u308c\u3066\u3044\u306a\u3044\u306a\u3042\u3001\u3068\u3002\u305d\u3057\u3066\u3042\u308b\u306e\u306f\u300c\u3069\u3053\u304b\u3089\u3082\u76f8\u624b\u306b\u3055\u308c\u3066\u3044\u306a\u3044\u300d\u3068\u3044\u3046\u3001\u65e2\u77e5\u306e\u73fe\u5b9f\u3067\u3059\u3002","id":41189762182152192,"from_user_id":100239985,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.echofon.com/" rel="nofollow">Echofon</a>"},{"from_user_id_str":"126390384","profile_image_url":"http://a2.twimg.com/profile_images/1176065038/nemunemu_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:18 +0000","from_user":"gesukapper","id_str":"41189757476286464","metadata":{"result_type":"recent"},"to_user_id":80935865,"text":"@tatsugorou \u306a\u3093\u304b\u4e16\u306e\u4e2d\u306b\u306f\u611a\u75f4\u3082\u4e0b\u30cd\u30bf\u3082\u8a00\u3044\u653e\u984c\u306etwitter\u3068\u3044\u3046\u3082\u306e\u304c\u3042\u308b\u305d\u3046\u3067\u3059\u3002","id":41189757476286464,"from_user_id":126390384,"to_user":"tatsugorou","geo":null,"iso_language_code":"ja","to_user_id_str":"80935865","source":"<a href="http://janetter.net/" rel="nofollow">Janetter</a>"},{"from_user_id_str":"196059029","profile_image_url":"http://a1.twimg.com/profile_images/1208831726/ruka2_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:17 +0000","from_user":"luka_m_bot","id_str":"41189756666777600","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u308f\u305f\u3057\u3082twitter\u306f\u3058\u3081\u307e\u3057\u305f","id":41189756666777600,"from_user_id":196059029,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www24.atpages.jp/aoi2/bot.php" rel="nofollow">\u5de1\u308b\u97f3</a>"},{"from_user_id_str":"88135613","profile_image_url":"http://a3.twimg.com/profile_images/1088552877/P9280150_normal.JPG","created_at":"Fri, 25 Feb 2011 17:36:14 +0000","from_user":"Roko38","id_str":"41189740321587200","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\uff46\uff42\u306b\u30ed\u30b0\u30a4\u30f3\u3059\u308b\u6a5f\u4f1a\u304c\u65e5\u306b\u65e5\u306b\u5897\u3048\u3066\u304d\u305f\uff3e\uff3e \u6163\u308c\u3066\u304f\u308b\u3068\u3042\u3063\u3061\u306e\u304c\u9762\u767d\u3044\uff06\u4f7f\u3044\u52dd\u624b\u304c\u3044\u3044\u3088\u3046\u306a\u6c17\u304c\u3059\u308b\u3002\u8907\u5408\u7684\u306b\u8272\u3005\u51fa\u6765\u307e\u3059\u3088\u306d\u2026\u3063\u3066\u3001\u601d\u3063\u305f\u3053\u3068\u3092\u545f\u304f\u306e\u306fTwitter\u3060\u3063\u305f\u308a\u3067\u3059\u304c\u2026(^_^; \u305d\u3057\u3066\u81ea\u5206\u306e\u5834\u5408\u306f\u30c4\u30a4\u3068\u9023\u52d5\u3057\u3065\u3089\u3044\u72b6\u6cc1\u3060\u3063\u305f\u308a\u3067\u2026\u3002","id":41189740321587200,"from_user_id":88135613,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"110825211","profile_image_url":"http://a2.twimg.com/profile_images/1108977866/o_t_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:12 +0000","from_user":"kou_nanjyo","id_str":"41189731941363712","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @x68k: \u57fa\u672c\u7684\u306bTwitter\u4e0a\u3067\u306f"\u597d\u304d\u306b\u3084\u308c\u3070\u3044\u3044"\u3060\u3051\u3069\u3001\u540d\u524d\u3082\u30a2\u30a4\u30b3\u30f3\u3082\u30a2\u30f3\u30bf\u3058\u3083\u306a\u3044\u305f\u304f\u3055\u3093\u306e\u4eba\u305f\u3061\u306e\u9b42\u304c\u3053\u3082\u3063\u305f\u3082\u306e\u306a\u306e\u3060\u304b\u3089\u3001\u305d\u308c\u3060\u3051\u306f"\u80cc\u8ca0\u3048"\u3068\u601d\u3046\uff1e\u30ad\u30e3\u30e9\u30af\u30bf\u30fc\u30a2\u30ab\u30a6\u30f3\u30c8","id":41189731941363712,"from_user_id":110825211,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://tweetlogix.com" rel="nofollow">Tweetlogix</a>"},{"from_user_id_str":"2095960","profile_image_url":"http://a2.twimg.com/profile_images/1248999075/majiresu2_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:10 +0000","from_user":"guldeen","id_str":"41189726945947648","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3042\u308a\u3083\u307e\u3041\u3002\u25bchttp://bit.ly/et4vVa \uff3b\u89d2\u5ddd\u66f8\u5e97\uff3d\u300c\u30b6\u30fb\u30b9\u30cb\u30fc\u30ab\u30fc\u300d\u4f11\u520a\u3078\u3000\u300c\u6dbc\u5bae\u30cf\u30eb\u30d2\u300d\u751f\u3093\u3060\u30e9\u30ce\u30d9\u96d1\u8a8c18\u5e74\u3067\u5e55 via http://twitter.com/lkj777","id":41189726945947648,"from_user_id":2095960,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"164121549","profile_image_url":"http://a1.twimg.com/profile_images/1251758789/m_108-07ae3_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:09 +0000","from_user":"hachi_touhi","id_str":"41189719299727360","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30cd\u30bf\u30d0\u30ec\u6c17\u306b\u3057\u3066\u305f\u3089Twitter\u3084\u3063\u3066\u3089\u308c\u306a\u3044ww","id":41189719299727360,"from_user_id":164121549,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twicca.r246.jp/" rel="nofollow">twicca</a>"},{"from_user_id_str":"194494659","profile_image_url":"http://a3.twimg.com/profile_images/1249717822/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:08 +0000","from_user":"tomonattomo","id_str":"41189715415801856","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3046\u308f\u3001\u660e\u65e5\u671d\u304b\u3089\u30d0\u30a4\u30c8\u3084\u306e\u306b\u306a\u3093\u3060\u3053\u306e\u306d\u3075\u304b\u3057\u3002\u3042\u3001\u591c\u66f4\u304b\u3057\u3002\u30d1\u30d4\u30eb\u30b9\u3068BUMP\u3001\u3048\u307f\u3068Twitter\u306eDM\u3057\u3059\u304e\u305f\u306a\u2026","id":41189715415801856,"from_user_id":194494659,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://mixi.jp/promotion.pl?id=voice_twitter" rel="nofollow"> mixi \u30dc\u30a4\u30b9 </a>"},{"from_user_id_str":"97224364","profile_image_url":"http://a3.twimg.com/profile_images/1150074355/fb8bcca60d340862c053a756377bfae8_normal.jpeg","created_at":"Fri, 25 Feb 2011 17:36:06 +0000","from_user":"xxxheat","id_str":"41189709174677504","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Twitter\u5b8c\u5168\u306b\u30d0\u30b0\u3063\u3066\u308borz","id":41189709174677504,"from_user_id":97224364,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"}],"max_id":41190705623732224,"since_id":38643906774044672,"refresh_url":"?since_id=41190705623732224&q=twitter","next_page":"?page=2&max_id=41190705623732224&rpp=100&lang=ja&q=twitter","results_per_page":100,"page":1,"completed_in":0.093336,"warning":"adjusted since_id to 38643906774044672 (), requested since_id was older than allowed -- since_id removed for pagination.","since_id_str":"38643906774044672","max_id_str":"41190705623732224","query":"twitter"}

benchmarks/json-data/jp50.jsondeleted−1

@@ -1 +0,0 @@

1−{"results":[{"from_user_id_str":"2458313","profile_image_url":"http://a2.twimg.com/profile_images/1203653060/fure091226_normal.png","created_at":"Thu, 27 Jan 2011 20:30:04 +0000","from_user":"19princess","id_str":"30724239224995840","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6d77\u6674\u300c\u672c\u65e5\u306e\u6771\u4eac\u306e\u304a\u5929\u6c17\u306f\u6674\u6642\u3005\u66c7\u3067\u3057\u3087\u3046\u3002\u6700\u9ad8\u6c17\u6e29\u306f8\u5ea6\u3001\u6700\u4f4e\u6c17\u6e29\u306f1\u5ea6\u3067\u3059\u3002\u3042\u306a\u305f\u306e\u4eca\u65e5\u306e\u4eba\u751f\u306b\u3068\u3073\u3063\u304d\u308a\u306e\u304a\u5929\u6c17\u3092\u2665\u300d","id":30724239224995840,"from_user_id":2458313,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://babyprincess.sakura.ne.jp/about/" rel="nofollow">\u5929\u4f7f\u5bb6\u306e\u88cf\u5c71</a>"},{"from_user_id_str":"66578965","profile_image_url":"http://a0.twimg.com/profile_images/1183763267/fossetta_normal.png","created_at":"Thu, 27 Jan 2011 20:00:04 +0000","from_user":"Fossetta_Tokyo","id_str":"30716689779785729","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u304a\u306f\u3088\u3046\u3054\u3056\u3044\u307e\u3059!!\u6771\u4eac\u90fd\u3001\u672c\u65e5\u306e\u304a\u5929\u6c17\u306f\u6674\u6642\u3005\u66c7\u3002\u6700\u9ad8\u6c17\u6e298\u5ea6\u3001\u6700\u4f4e\u6c17\u6e291\u5ea6\u3002\u6771\u4eac\u5730\u65b9\u3067\u306f\u3001\u7a7a\u6c17\u306e\u4e7e\u71e5\u3057\u305f\u72b6\u614b\u304c\u7d9a\u3044\u3066\u3044\u307e\u3059\u3002\u706b\u306e\u53d6\u308a\u6271\u3044\u306b\u6ce8\u610f\u3057\u3066\u4e0b\u3055\u3044\u3002\u4f0a\u8c46\u8af8\u5cf6\u3068\u5c0f\u7b20\u539f\u8af8\u5cf6\u306b\u306f\u3001\u5f37\u98a8\u3001\u6ce2\u6d6a\u3001\u4e7e\u71e5\u3001\u971c\u306e\u6ce8\u610f\u5831\u3092\u767a\u8868\u4e2d\u3067\u3059\u3002","id":30716689779785729,"from_user_id":66578965,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://bit.ly/Fossetta" rel="nofollow">\u30d5\u30a9\u30bb\u30c3\u30bf ver.3.1.1</a>"},{"from_user_id_str":"104041146","profile_image_url":"http://a2.twimg.com/profile_images/863965118/001jwatokyo_normal.jpg","created_at":"Thu, 27 Jan 2011 19:44:33 +0000","from_user":"jwa_tokyo","id_str":"30712787537756160","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6c17\u8c61\u5e81\u304b\u3089\u6771\u4eac\u306e\u5929\u6c17\u4e88\u5831\u304c\u767a\u8868\u3055\u308c\u307e\u3057\u305f\u3000\u305d\u306e\u5929\u6c17\u4e88\u5831\u3092\u3053\u3053\u3067\u3064\u3076\u3084\u3053\u3046\u304b\u306a\u3041\uff5e\uff1f\u3000\u8003\u3048\u4e2d\u3000\u307e\u3066\u6b21\u53f7\uff08\u7b11","id":30712787537756160,"from_user_id":104041146,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.docodemo.jp/twil/" rel="nofollow">Twil2 (Tweet Anytime, Anywhere by Mail)</a>"},{"from_user_id_str":"144500192","profile_image_url":"http://a3.twimg.com/a/1294874399/images/default_profile_3_normal.png","created_at":"Thu, 27 Jan 2011 18:59:33 +0000","from_user":"kyo4to4","id_str":"30701462774358016","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u90fd \u516b\u4e08\u5cf6 - \u4eca\u65e5\u306e\u5929\u6c17\u306f\u30fb\u30fb\u30fb\u66c7\u306e\u3061\u6674\u3067\u3059\u306e\uff01","id":30701462774358016,"from_user_id":144500192,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/kyo4to4" rel="nofollow">lost-sheep-bot</a>"},{"from_user_id_str":"165724582","profile_image_url":"http://a0.twimg.com/profile_images/1222842347/163087_1256281064506_1753997852_484926_2761052_n_normal.jpg","created_at":"Thu, 27 Jan 2011 17:39:06 +0000","from_user":"Rifqi_19931020","id_str":"30681213748387840","metadata":{"result_type":"recent"},"to_user_id":113796067,"text":"@CHLionRagbaby \u30b1\u30f3\u3061\u3083\u3093\u3001\u671d\u4eca\u307e\u3067\u306e\u81ea\u5206\u306e\u30db\u30fc\u30e0\u30a8\u30ea\u30a2\u304b\u3089\u307e\u3060\u975e\u5e38\u306b\u5bd2\u3044\u3068\u96e8\u304c\u964d\u3063\u3066\u3044\u305f..\u3069\u306e\u3088\u3046\u306b\u73fe\u5728\u306e\u6771\u4eac\u306e\u5929\u6c17\uff1f","id":30681213748387840,"from_user_id":165724582,"to_user":"CHLionRagbaby","geo":null,"iso_language_code":"ja","to_user_id_str":"113796067","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"120911929","profile_image_url":"http://a0.twimg.com/profile_images/772435076/20100312___capture2_normal.png","created_at":"Thu, 27 Jan 2011 17:28:30 +0000","from_user":"Cirno_fan","id_str":"30678546020040705","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u65e5\u306e\u6771\u4eac\u306e\u5929\u6c17\u306f\u3001\u66c7\u6642\u3005\u6674\u3067\u6700\u9ad8\u6c17\u6e29\u306f8\u2103\uff01 \u6700\u4f4e\u6c17\u6e29\u306f2\u2103\u3060\u3063\u305f\u3088\uff01 RT @mimi22999 \uff08\uff65\u2200\uff65\uff09\uff4c\u3001\u865a\u5f31\u306a\u8005\u306b\u3068\u3063\u3066\u3001\u6717\u3089\u304b\u306a\u9854\u306f\u4e0a\u5929\u6c17\u3068\u540c\u3058\u304f\u3089\u3044\u3046\u308c\u3057\u3044\u3082\u306e\u3060\u3002\u30d5\u30e9\u30f3\u30af\u30ea\u30f3 #tenki #bot","id":30678546020040705,"from_user_id":120911929,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://blog.livedoor.jp/fairycirno/archives/34686.html" rel="nofollow">\u5e7b\u60f3\u90f7 \u9727\u306e\u6e56</a>"},{"from_user_id_str":"65976527","profile_image_url":"http://a0.twimg.com/profile_images/452810990/little_italies_____normal.jpg","created_at":"Thu, 27 Jan 2011 17:00:03 +0000","from_user":"heta_weather01","id_str":"30671388754845696","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u30d8\u30bf\u5929\u3011Tere hommikust.\u30a8\u30b9\u30c8\u30cb\u30a2\u3067\u3059\u3002\u4eca\u65e5\u306e\u6771\u4eac\u306e\u5929\u6c17\u306f\u6674\u6642\u3005\u66c7\u3067\u660e\u65e5\u306f\u66c7\u308a\u3067\u3059\u3002\u3061\u306a\u307f\u306b\u50d5\u306e\u3068\u3053\u308d\u3067\u306f\u66c7\u308a\u3067\u6c17\u6e29-7\u2103\u3067\u3059\u3002\u3061\u306a\u307f\u306b\u30b9\u30ab\u30a4\u30d7\u306e\u958b\u767a\u672c\u90e8\u306f\u50d5\u306e\u5bb6\u306b\u3042\u308b\u3093\u3067\u3059\u3002","id":30671388754845696,"from_user_id":65976527,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www15.atpages.jp/~kageyanma/" rel="nofollow">\u5730\u7403\u306e\u4e2d</a>"},{"from_user_id_str":"7278433","profile_image_url":"http://a3.twimg.com/profile_images/1218965303/michael-1_normal.png","created_at":"Thu, 27 Jan 2011 16:50:16 +0000","from_user":"shimohiko","id_str":"30668926035689472","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3042\u308a\u3002\n\u3010\u7f8e\u4eba\u5929\u6c17/\u6771\u4eac\u3011\u7f8e\u4eba\u5929\u6c17\u30ad\u30e3\u30b9\u30bf\u30fc\u306e"\u3055\u3042\u3084\u3093\u3055\u3093"\u306b\u3088\u308b\u3068\u300c1/29(\u571f)\u306f\u304f\u3082\u308a\u3067\u3001\u964d\u6c34\u78ba\u738740%\u3001\u6700\u9ad8\u6c17\u6e29\u306f6\u2103\u3067\u6700\u4f4e\u6c17\u6e29\u306f1\u2103\u3067\u3059\u300d\u7f8e\u4eba\u5929\u6c17\u21d2http://bit.ly/djB8th http://twitpic.com/3twnl0 #bt_tenki","id":30668926035689472,"from_user_id":7278433,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://bijintenki.jp" rel="nofollow">bijintenki.jp</a>"},{"from_user_id_str":"61770","profile_image_url":"http://a3.twimg.com/profile_images/1206955079/tw172a_normal.png","created_at":"Thu, 27 Jan 2011 16:40:52 +0000","from_user":"rsky","id_str":"30666561853333504","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3075\u3068\u591c\u7a7a\u3092\u898b\u4e0a\u3052\u3066\u30aa\u30ea\u30aa\u30f3\u304c\u898b\u3048\u306a\u304f\u3066\u300c\u6771\u4eac\u306b\u306f\u7a7a\u304c\u306a\u3044\u300d\u3068\u667a\u6075\u5b50\u306e\u3088\u3046\u306a\u3053\u3068\u3092\u601d\u3063\u305f\u308f\u3051\u3060\u304c\u3001\u305f\u3076\u3093\u534a\u5206\u3050\u3089\u3044\u306f\u5929\u6c17\u306e\u305b\u3044\u3067\u3059","id":30666561853333504,"from_user_id":61770,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"103259265","profile_image_url":"http://a0.twimg.com/profile_images/767857973/anime_icon_normal.gif","created_at":"Thu, 27 Jan 2011 16:37:42 +0000","from_user":"liveshowonly","id_str":"30665765698928640","metadata":{"result_type":"recent"},"to_user_id":null,"text":"iPhone\u5929\u6c17\u3002\u6771\u4eac4\u2103\u3063\u3066\u7d50\u69cb\u5bd2\u304f\u306a\u3044\u3058\u3083\u3093\u3002\uff08\u78ba\u304b\u306b\u3082\u306e\u51c4\u304f\u5bd2\u3044\u8a33\u3067\u306f\u7121\u3044\uff09\u3002\u798f\u5ca1\u5e02\u306f1\u2103\u3060\u3002\u52dd\u3061\u3060\u305c\u3002Rock'n'roll","id":30665765698928640,"from_user_id":103259265,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"165242761","profile_image_url":"http://a1.twimg.com/profile_images/1147334744/SN3E00600001_normal.jpg","created_at":"Thu, 27 Jan 2011 16:37:35 +0000","from_user":"deuxavril0502","id_str":"30665736556912640","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6b8b\u5ff5\u3001\u79c1\u306f\u6c96\u7e04\u3067\u3059(>_<)\u3067\u3082\u304a\u5929\u6c17\u826f\u3055\u305d\u3046\u3067\u826f\u304b\u3063\u305f\u306d\u3002\u3053\u3061\u3089\u306f\u96e8\u3088\uff5eRT @rinandy2010: \u305d\u3046\u3067\u3059\u3063\u266a\u51fa\u5f35\u3067(^^)\u304a\u306d\u3048\u3055\u307e\u306f\u6771\u4eac\u3067\u3059\u304b\uff1f\u3081\u3063\u3061\u3083\u5929\u6c17\u826f\u304f\u3066\u3073\u3063\u304f\u308a\u3067\u3059\u3002\u624b\u888b\u3068\u304b\u5168\u7136\u3044\u3089\u306a\u3044\u3067\u3059\u306d\u30fc RT @deuxavril0502 \u6771\u4eac\u306a\u306e\u30fc\uff1f","id":30665736556912640,"from_user_id":165242761,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.echofon.com/" rel="nofollow">Echofon</a>"},{"from_user_id_str":"163900288","profile_image_url":"http://a1.twimg.com/profile_images/1210224823/icon12945064955238_normal.jpg","created_at":"Thu, 27 Jan 2011 16:24:37 +0000","from_user":"nyao_yurichan","id_str":"30662472734089216","metadata":{"result_type":"recent"},"to_user_id":100985873,"text":"@ray_ko302 \u767a\u898b\u3042\u308a\u304c\u3068\u3067\u3059\u3045\u3002\u3053\u3061\u3089\u3067\u3082\u3088\u308d\u3057\u304f\u306d\u3002\u6771\u4eac\u306f\u4eca\u65e5\u3082\u4e7e\u71e5\u3067\u5927\u5909\u3088\u3002\u305d\u3063\u3061\u3068\u771f\u9006\u306e\u5929\u6c17\u3060\u306d\u3002\u30a2\u30a4\u30b9\u30d0\u30fc\u30f3\u304d\u3092\u3064\u3051\u3066\u3088\u306d\u3002","id":30662472734089216,"from_user_id":163900288,"to_user":"ray_ko302","geo":null,"iso_language_code":"ja","to_user_id_str":"100985873","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"49227098","profile_image_url":"http://a3.twimg.com/profile_images/965007882/____normal.jpg","created_at":"Thu, 27 Jan 2011 15:52:26 +0000","from_user":"dosannko6","id_str":"30654371016478720","metadata":{"result_type":"recent"},"to_user_id":108570870,"text":"@peke_hajiP \u4ffa\u304c\u6771\u4eac \u6765\u3066\u6700\u521d\u306b\u9a5a\u3044\u305f\u306e\u304c\u3001\u5929\u6c17\u4e88\u5831\u3067\u82b1\u7c89\u60c5\u5831\u304c\u6d41\u308c\u308b\u3053\u3068\u3067\u3001\u6700\u521d\u306b\u8a66\u3057\u305f\u306e\u304c \u30b4\u30ad\u69d8 \u53ec\u559a\u306e\u5100\u5f0f\u3067\u3059\u304a\uff1f","id":30654371016478720,"from_user_id":49227098,"to_user":"peke_hajip","geo":null,"iso_language_code":"ja","to_user_id_str":"108570870","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"71148934","profile_image_url":"http://a0.twimg.com/profile_images/1209223630/image_normal.jpg","created_at":"Thu, 27 Jan 2011 15:46:49 +0000","from_user":"123keiko","id_str":"30652958311981058","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u9727\u5cf6\u306e\u964d\u7070\u306e\u30cb\u30e5\u30fc\u30b9\u3092\u898b\u3066\u601d\u3044\u51fa\u3057\u307e\u3057\u305f\u3002\u4e0a\u4eac\u3057\u305f\u59cb\u3081\u306e\u9803\u3001\u6771\u4eac\u306f1\u5e74\u4e2d\u3001\u7070\u304c\u964d\u3089\u306a\u3044\u304b\u3089\u7a7a\u6c17\u304c\u6f84\u3093\u3067\u3066\u904e\u3054\u3057\u3084\u3059\u3044\u306a\u3041\u3001\u3068\u601d\u3063\u305f\u306a\u3041\u3001\u3063\u3066\u3002\n\u5b9f\u5bb6\u306f\u51ac\u306e\u5b63\u7bc0\u98a8\u3067\u685c\u5cf6\u306e\u7070\u304c\u964d\u308b\u5730\u533a\u3067\u3057\u305f\u3002\u9e7f\u5150\u5cf6\u306e\u5929\u6c17\u4e88\u5831\u3067\u306f\u3001\u6bce\u65e5\u3001\u685c\u5cf6\u4e0a\u7a7a\u306e\u98a8\u5411\u304d\u4e88\u5831\u304c\u3067\u307e\u3059\u3002\u3053\u308c\u304b\u3089\u306f\u9727\u5cf6\u3082\u304b\u306a\uff1f","id":30652958311981058,"from_user_id":71148934,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"91124773","profile_image_url":"http://a3.twimg.com/profile_images/1139308356/prof101007_3-1_normal.jpg","created_at":"Thu, 27 Jan 2011 15:43:35 +0000","from_user":"sanposuruhito","id_str":"30652146277945345","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u5bb5\u306e\u90fd\u5fc3\u306f\u3001\u8eab\u3082\u5f15\u304d\u7de0\u307e\u308b\u3068\u3044\u3046\u3088\u308a\u306f\u51cd\u3048\u308b\u7a0b\u306e\u51b7\u6c17\u3092\u611f\u3058\u308b\u5bd2\u3044\u591c\u3067\u3059\u3002\u660e\u65e5\u65e5\u4e2d\u306e\u6771\u4eac\u306e\u5929\u6c17\u306f\u3001\u5915\u65b9\u306b\u591a\u5c11\u96f2\u304c\u51fa\u308b\u5834\u6240\u304c\u3042\u308a\u305d\u3046\u306a\u3082\u306e\u306e\u6982\u306d\u6674\u308c\u7a7a\u304c\u5e83\u304c\u308a\u7d9a\u3051\u305d\u3046\u3067\u3059\u3002\u6700\u9ad8\u6c17\u6e29\u306f\u30015-6\u5ea6\u4f4d\u3068\u306a\u308a\u305d\u3046\u3067\u3059\u3002#weather_tokyo","id":30652146277945345,"from_user_id":91124773,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://projects.playwell.jp/go/Saezuri" rel="nofollow">Saezuri</a>"},{"from_user_id_str":"104712480","profile_image_url":"http://a3.twimg.com/profile_images/1204016928/icon5087697006727791368kuro2_normal.jpg","created_at":"Thu, 27 Jan 2011 15:31:51 +0000","from_user":"asongfor_xx","id_str":"30649192296751104","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u7f8e\u4eba\u5929\u6c17\u304b\u3089tweet\u3059\u308b\u3068\u3053\u3093\u306a\u611f\u3058\u306a\u3093\u3060\u306a\u3002 RT asongfor_xx: \u3010\u7f8e\u4eba\u5929\u6c17/\u6771\u4eac\u3011\u7f8e\u4eba\u5929\u6c17\u30ad\u30e3\u30b9\u30bf\u30fc\u306e"\u304b\u306a\u3053\u3055\u3093"\u306b\u3088\u308b\u3068\u300c1/28(\u91d1)\u306f\u6674\u6642\u3005\u304f\u3082\u308a\u3067\u3001\u964d\u6c34\u78ba\u73870%\u3001\u6700\u9ad8\u6c17\u6e29\u306f8\u2103\u3067\u6700\u4f4e\u6c17\u6e29\u306f1\u2103\u3067\u3059\u300d\u7f8e\u4eba\u5929\u6c17\u21d2http://bit.ly/djB8th","id":30649192296751104,"from_user_id":104712480,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twipple.jp/" rel="nofollow">\u3064\u3044\u3063\u3077\u308b for iPhone</a>"},{"from_user_id_str":"165965113","profile_image_url":"http://a0.twimg.com/profile_images/1200885316/shogomeguro_normal.jpg","created_at":"Thu, 27 Jan 2011 15:24:35 +0000","from_user":"shogomeguro","id_str":"30647362477105152","metadata":{"result_type":"recent"},"to_user_id":null,"text":"2011.1.26 \u793e\u7a93\u304b\u3089\u3002\u4e0d\u601d\u8b70\u306a\u5929\u6c17\u3067\u3053\u306e\u5f8c\u96ea\u304c\u3061\u3089\u3064\u3044\u305f\u3093\u3060\u3088\u306d\u3002\u6771\u4eac\u306e\u521d\u96ea\u3067\u3057\u305f\u3002 http://instagr.am/p/BO_xn/","id":30647362477105152,"from_user_id":165965113,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://instagr.am" rel="nofollow">instagram</a>"},{"from_user_id_str":"166018520","profile_image_url":"http://a0.twimg.com/profile_images/1207460953/100-40030_normal.jpg","created_at":"Thu, 27 Jan 2011 15:18:17 +0000","from_user":"115nayume","id_str":"30645776254238722","metadata":{"result_type":"recent"},"to_user_id":118384679,"text":"@dancinpea09 \u6771\u4eac\u3001\u660e\u65e5\u3082\u5929\u6c17\u826f\u3044\u307f\u305f\u3044\u3067\u3001\u3088\u304b\u3063\u305f\u3067\u3059\u306d\u30fc\u266a \u30ca\u30a4\u30b9\u30c8\u30ea\u30c3\u30d7\uff01\u304a\u3084\u3059\u307f\u306a\u3055\u3044\u3002 http://twitpic.com/3tvun3","id":30645776254238722,"from_user_id":166018520,"to_user":"dancinpea09","geo":null,"iso_language_code":"ja","to_user_id_str":"118384679","source":"<a href="http://tweetli.st/" rel="nofollow">TweetList!</a>"},{"from_user_id_str":"202937674","profile_image_url":"http://a1.twimg.com/profile_images/1218797578/______2_normal.jpg","created_at":"Thu, 27 Jan 2011 15:11:48 +0000","from_user":"ryuusisan","id_str":"30644146498699264","metadata":{"result_type":"recent"},"to_user_id":203058384,"text":"@manaasutakshi \u6771\u4eac\u306f\u964d\u3063\u3066\u306a\u3044\u3093\u3067\u3059\u304b\u30fb\u30fb\u30fb\u5929\u6c17\u4e88\u5831\u306b\u3088\u308b\u3068\u660e\u65e5\u3082\u6771\u4eac\u306f\u964d\u3089\u306a\u3044\u305d\u3046\u3067\u3059\u306d\uff01\uff01\u79c1\u306e\u4f4f\u3093\u3067\u3044\u308b\u3068\u3053\u308d\u306f\u5fae\u5999\u306b\u964d\u308a\u305d\u3046\u3067\u51fa\u52e4\u6642\u306b\u964d\u3063\u3066\u305f\u3089\u3061\u3087\u3063\u3068\u5acc\u3060\u306a\u3041\u3000\u306a\u3093\u3066\u601d\u3044\u307e\u3059","id":30644146498699264,"from_user_id":202937674,"to_user":"manaasutakshi","geo":null,"iso_language_code":"ja","to_user_id_str":"203058384","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"3222182","profile_image_url":"http://a0.twimg.com/profile_images/1199090957/ProfilePhoto_normal.png","created_at":"Thu, 27 Jan 2011 15:09:35 +0000","from_user":"44mune","id_str":"30643589545459713","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u7f8e\u4eba\u5929\u6c17/\u6771\u4eac\u3011\u7f8e\u4eba\u5929\u6c17\u30ad\u30e3\u30b9\u30bf\u30fc\u306e"\u306e\u308a\u3055\u3093"\u306b\u3088\u308b\u3068\u300c1/28(\u91d1)\u306f\u304f\u3082\u308a\u306e\u3061\u6674\u3067\u3001\u964d\u6c34\u78ba\u738710%\u3001\u6700\u9ad8\u6c17\u6e29\u306f9\u2103\u3067\u6700\u4f4e\u6c17\u6e29\u306f2\u2103\u3067\u3059\u300d http://twitpic.com/3tvruh","id":30643589545459713,"from_user_id":3222182,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://bijintenki.jp" rel="nofollow">bijintenki.jp</a>"},{"from_user_id_str":"154341982","profile_image_url":"http://a0.twimg.com/profile_images/1155496864/_____normal.jpg","created_at":"Thu, 27 Jan 2011 15:02:39 +0000","from_user":"slave_420_bot","id_str":"30641845490946049","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u30f3\u3068\u3053\u899a\u3048\u3066\u308b\u306e\u306f\u300c\u672d\u5e4c\u300d\u300c\u4ed9\u53f0\u300d\u300c\u6771\u4eac\u300d\u300c\u5927\u962a\u300d\u300c\u540d\u53e4\u5c4b\u300d\u300c\u798f\u5ca1\u300d\u306e\u4eca\u65e5\u3068\u660e\u65e5\u306e\u5929\u6c17\u3060\u306a\u3002\u5929\u6c17\u304c\u77e5\u308a\u305f\u3044\u6642\u306f\u300c\u5834\u6240\u300d\u3068\u300c\u4eca\u65e5\u306e\u5929\u6c17\u300d\u304b\u300c\u660e\u65e5\u306e\u5929\u6c17\u300d\u3092\u304a\u7533\u3057\u4ed8\u3051\u304f\u3060\u3055\u3044\u3001\u304a\u5b22\u69d8\uff1f","id":30641845490946049,"from_user_id":154341982,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://bot.syoyu.net/" rel="nofollow">\u7adc\u30f6\u5cf0\u90b8\u306e\u3069\u3053\u304b</a>"},{"from_user_id_str":"72042678","profile_image_url":"http://a3.twimg.com/profile_images/1198771027/larxene_normal.jpg","created_at":"Thu, 27 Jan 2011 15:01:57 +0000","from_user":"larxene_bot","id_str":"30641668772339712","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u65e5\u306e\u5929\u6c17\u306f \u672d\u5e4c\u304c\u6674\u308c \u4ed9\u53f0\u304c\u66c7\u6642\u3005\u96ea \u6771\u4eac\u304c\u6674\u306e\u3061\u66c7 \u540d\u53e4\u5c4b\u304c\u6674\u6642\u3005\u66c7 \u5927\u962a\u304c\u6674\u6642\u3005\u66c7 \u798f\u5ca1\u304c\u6674\u308c \u3089\u3057\u3044\u308f\u3088 \u6ce8\u610f\u3057\u306a\u3055\u3044","id":30641668772339712,"from_user_id":72042678,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www4.kiwi-us.com/~yuuna/larxene_bot_manual/index.html" rel="nofollow">\u5fd8\u5374\u306e\u57ce \u5730\u4e0a\u306e12\u968e</a>"},{"from_user_id_str":"101331893","profile_image_url":"http://a1.twimg.com/sticky/default_profile_images/default_profile_0_normal.png","created_at":"Thu, 27 Jan 2011 15:01:34 +0000","from_user":"yoshiftan","id_str":"30641572240424961","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306e\u5929\u6c17\u4e88\u5831\u3092\u898b\u3066\u3073\u3063\u304f\u308a\uff01\u6691\u305d\u3046\u3060\u306a\u3053\u308a\u3083\u3002","id":30641572240424961,"from_user_id":101331893,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"Keitai Mail"},{"from_user_id_str":"65207550","profile_image_url":"http://a3.twimg.com/profile_images/448731969/_________R_normal.jpg","created_at":"Thu, 27 Jan 2011 15:01:33 +0000","from_user":"kabuyo","id_str":"30641566469066752","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u5929\u6c17\u4e88\u5831\u3067\u306f\u6771\u4eac\u3067\u306f\u4e7e\u71e5\u6ce8\u610f\u5831\u304c\u7d9a\u3044\u3066\u3044\u308b\u3089\u3057\u3044\u306e\u306b\u3001\u306a\u305c\u79c1\u304c\u5e72\u3057\u305f\u6d17\u6fef\u7269\u306f\u96e8\u306b\u6fe1\u308c\u3066\u3057\u307e\u3063\u305f\u306e\u3060\u308d\u3046\u304b\u2025\u3000\u3088\u3063\u307d\u3069\u904b\u304c\u60aa\u3044\u3089\u3057\u3044\u2025","id":30641566469066752,"from_user_id":65207550,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"80309352","profile_image_url":"http://a1.twimg.com/profile_images/1223620418/image_normal.jpg","created_at":"Thu, 27 Jan 2011 14:54:30 +0000","from_user":"mikutyan","id_str":"30639792026812416","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306e\u660e\u65e5\u306e\u5929\u6c17\u6559\u3048\u3066","id":30639792026812416,"from_user_id":80309352,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"80309352","profile_image_url":"http://a1.twimg.com/profile_images/1223620418/image_normal.jpg","created_at":"Thu, 27 Jan 2011 14:53:06 +0000","from_user":"mikutyan","id_str":"30639439847890944","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u660e\u65e5\u306e\u6771\u4eac\u306e\u5929\u6c17\u306a\u3093\u3060\u308d\u3046 \u96e8\u964d\u3063\u305f\u3089\u56f0\u308b\u3002","id":30639439847890944,"from_user_id":80309352,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"120911929","profile_image_url":"http://a0.twimg.com/profile_images/772435076/20100312___capture2_normal.png","created_at":"Thu, 27 Jan 2011 14:47:19 +0000","from_user":"Cirno_fan","id_str":"30637984684449792","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3042\u305f\u3044\u30c1\u30eb\u30ce\uff01\u30dc\u30c3\u30c8\u3060\u3051\u3069\u5929\u6c17\u4e88\u5831\u3082\u3067\u304d\u308b\u3088\uff01\u300c\u6771\u4eac\u306e\u4eca\u65e5\u306e\u5929\u6c17\u6559\u3048\u3066\u300d\u307f\u305f\u3044\u306bTL\u767a\u8a00\u3057\u3066\u304f\u308c\u308c\u3070\u8abf\u3079\u3066\u3042\u3052\u308b\uff01 #followme #followmejp #followmevip #tenki","id":30637984684449792,"from_user_id":120911929,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://blog.livedoor.jp/fairycirno/archives/34686.html" rel="nofollow">\u5e7b\u60f3\u90f7 \u9727\u306e\u6e56</a>"},{"from_user_id_str":"33858777","profile_image_url":"http://a0.twimg.com/profile_images/352864695/muga_normal.jpg","created_at":"Thu, 27 Jan 2011 14:46:12 +0000","from_user":"collonist","id_str":"30637702105796610","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u3063\u3066\u51ac\u306f\u57fa\u672c\u7684\u306b\u6674\u308c\u3066\u308b\u304b\u3089\u3001\u5929\u6c17\u4e88\u5831\u898b\u306a\u304f\u3066\u3082\u5168\u7136\u554f\u984c\u306a\u3044\u3002\u5c71\u5f62\u3060\u3068\u660e\u65e5\u306f\u3069\u3093\u3060\u3051\u96ea\u304c\u964d\u308b\u306e\u304b\u3001\u3069\u3093\u3060\u3051\u5bd2\u3044\u306e\u304b\u628a\u63e1\u3057\u3066\u3068\u304d\u305f\u3044\u306e\u3067\u3001\u5929\u6c17\u4e88\u5831\u306f\u5fc5\u305a\u30c1\u30a7\u30c3\u30af\u3057\u3066\u305f\u306e\u3060\u304c\u3002","id":30637702105796610,"from_user_id":33858777,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"79336228","profile_image_url":"http://a0.twimg.com/profile_images/1130029876/zmanmu_normal.png","created_at":"Thu, 27 Jan 2011 14:30:23 +0000","from_user":"atsuki777","id_str":"30633725041573890","metadata":{"result_type":"recent"},"to_user_id":null,"text":"MXTV\u306e\u5929\u6c17\u4e88\u5831\u521d\u3081\u3066\u898b\u305f\u3051\u3069\u6771\u4eac\u753a\u7530\u516b\u738b\u5b50\u3063\u3066\u5730\u57df\u8868\u793a\u304c\u2026w\u516b\u738b\u5b50\u3068\u753a\u7530\u306f\u6771\u4eac\u3058\u3083\u306a\u3044\u306e\u304bwww","id":30633725041573890,"from_user_id":79336228,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.echofon.com/" rel="nofollow">Echofon</a>"},{"from_user_id_str":"90576097","profile_image_url":"http://a0.twimg.com/profile_images/1203320254/nanami1_normal.png","created_at":"Thu, 27 Jan 2011 14:28:26 +0000","from_user":"dycroft","id_str":"30633234245099521","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306e\u660e\u65e5\u306e\u304a\u5929\u6c17\u3067\u3059","id":30633234245099521,"from_user_id":90576097,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"147215268","profile_image_url":"http://a2.twimg.com/profile_images/1198555202/ichika-7.4.0-3P_normal.gif","created_at":"Thu, 27 Jan 2011 14:28:23 +0000","from_user":"kiaran5032","id_str":"30633222211637248","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306e\u660e\u65e5\u306e\u304a\u5929\u6c17\u3067\u3059\u3002\u6674\u308c\u6642\u3005\u304f\u3082\u308a #MX","id":30633222211637248,"from_user_id":147215268,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"1741599","profile_image_url":"http://a0.twimg.com/profile_images/1205744888/950637_normal.jpg","created_at":"Thu, 27 Jan 2011 14:28:21 +0000","from_user":"dasaitama","id_str":"30633212535382016","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306e\u3001\u660e\u65e5\u306e\u304a\u5929\u6c17\u3067\u3059","id":30633212535382016,"from_user_id":1741599,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"34140879","profile_image_url":"http://a3.twimg.com/profile_images/1186413535/__6_normal.jpg","created_at":"Thu, 27 Jan 2011 14:28:17 +0000","from_user":"ryuji_chaos","id_str":"30633197016449024","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306e\u660e\u65e5\u306e\u304a\u5929\u6c17\u3067\u3059\u3002","id":30633197016449024,"from_user_id":34140879,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"1400","profile_image_url":"http://a0.twimg.com/profile_images/1198556839/westerndog_20090104_320x320_normal.jpg","created_at":"Thu, 27 Jan 2011 14:28:16 +0000","from_user":"westerndog","id_str":"30633191232503808","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306e\u660e\u65e5\u306e\u304a\u5929\u6c17\u3067\u3059","id":30633191232503808,"from_user_id":1400,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"89239832","profile_image_url":"http://a3.twimg.com/profile_images/519522846/noriko_normal.jpg","created_at":"Thu, 27 Jan 2011 14:15:01 +0000","from_user":"Noriko_Fujimoto","id_str":"30629857234788352","metadata":{"result_type":"recent"},"to_user_id":115645219,"text":"@nossa430402 \u5bcc\u5c71\u306f\u3059\u3054\u3044\u96ea\u307f\u305f\u3044\u3067\u3059\u306d\uff5e\uff08\u5bd2\u3063\uff09\u3000\u6771\u4eac\u306f\u305d\u306e\u5206\u6bce\u65e5\u826f\u3044\u5929\u6c17\u3067\u3059\u3002\u5bd2\u3044\u3051\u3069\u30fb\u30fb\u30fb\u3002","id":30629857234788352,"from_user_id":89239832,"to_user":"nossa430402","geo":null,"iso_language_code":"ja","to_user_id_str":"115645219","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"107265539","profile_image_url":"http://a0.twimg.com/sticky/default_profile_images/default_profile_3_normal.png","created_at":"Thu, 27 Jan 2011 14:01:10 +0000","from_user":"kurumasuki330","id_str":"30626371826884608","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u9031\u571f\u66dc\u65e5\u3001\u8eca\u3067\u6771\u4eac\u304b\u3089\u6771\u540d\u3001\u7c73\u539f\u7d4c\u7531\u3067\u91d1\u6ca2\u306e\u5b9f\u5bb6\u3078\u3002\u305d\u3057\u3066\u3001\u6708\u66dc\u65e5\u306b\u6771\u4eac\u3078\u5e30\u308b\u30b9\u30b1\u30b8\u30e5\u30fc\u30eb\u3002\u5929\u6c17\u4e88\u5831\u3060\u3068\u4eca\u9031\u672b\u3001\u5317\u9678\u5730\u65b9\u306f\u5927\u96ea\uff01\u5e30\u308c\u308b\u304b\u81ea\u4fe1\u304c\u306a\u304f\u306a\u3063\u3066\u304d\u305f\u3002\u307e\u305f\u3001\u305d\u306e\u6642\u5b9f\u6cc1\u4e2d\u7d99\u3057\u307e\u3059\u3002","id":30626371826884608,"from_user_id":107265539,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twtr.jp" rel="nofollow">Keitai Web</a>"},{"from_user_id_str":"155313166","profile_image_url":"http://a3.twimg.com/profile_images/1167554721/73931_1408370184003_1674923704_920888_5686998_n_normal.jpg","created_at":"Thu, 27 Jan 2011 14:00:50 +0000","from_user":"takuya_aoki","id_str":"30626287127105536","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306f\u3081\u3063\u3061\u3083\u3044\u3044\u5929\u6c17\u3067\u904e\u3054\u3057\u3084\u3059\u3044\u3051\u3069\u30c9\u30e9\u30a4\u30a2\u30a4\u306b\u306f\u3061\u3087\u3063\u3068\u304d\u3064\u3044\u306a\u30fb\u30fb\u30fb\u76ee\u85ac\u304c\u624b\u653e\u305b\u306a\u3044","id":30626287127105536,"from_user_id":155313166,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"179984398","profile_image_url":"http://a1.twimg.com/profile_images/1182382310/g4350_normal.jpg","created_at":"Thu, 27 Jan 2011 13:52:50 +0000","from_user":"aiilabo","id_str":"30624271902449664","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30d6\u30ed\u30b0\u66f4\u65b0 \u25c6\u611f\u60c5\u3092\u307f\u3064\u3081\u308b\u65b9\u6cd5 - \u3053\u3053\u6570\u65e5\u3001\u6642\u6298\u96e8\u304c\u30d1\u30e9\u30d1\u30e9\u3000\u5fae\u5999\u306a\u5929\u6c17\u306e\u6771\u4eac\u304b\u3089\u3042\u308b\u304c\u307e\u307e\u3067\u3059\u3002 \n\n \u4eca\u65e5\u306f\u3001\u6628\u65e5\u306e\u300c\u30de\u30a4\u30ca\u30b9\u611f\u60c5\u306f\u60aa\u3067\u3059\u304b\uff1f\n.. \u27aa http://am6.jp/e3e9tS","id":30624271902449664,"from_user_id":179984398,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://feedtweet.am6.jp/" rel="nofollow">\u261e feedtweet.jp \u261c</a>"},{"from_user_id_str":"185992391","profile_image_url":"http://a2.twimg.com/profile_images/1192695844/otenki_normal.png","created_at":"Thu, 27 Jan 2011 13:00:37 +0000","from_user":"otenki_luci_bot","id_str":"30611130938298368","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u767a\u58f2\u65e5\u304b\u2026\u2026\u541b\u305f\u3061\u306b\u3068\u3063\u3066\u306f\u591a\u5206\u300190\u65e5\u5f8c\u306e\u3053\u3068\u3060\u3002\u3055\u3066\u660e\u65e5\u306e\u6771\u4eac\u90fd\u306e\u5929\u6c17\u306f\u6674\u306e\u3061\u66c7\u3001\u6700\u9ad8\u6c17\u6e29\u306f8\u5ea6\u3060\u305d\u3046\u3060\u3002\u3055\u3059\u304c\u306b\u4f55\u304b\u7740\u305f\u65b9\u304c\u3044\u3044\u305e\u3001\u30a4\u30fc\u30ce\u30c3\u30af\u3002","id":30611130938298368,"from_user_id":185992391,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/otenki_luci_bot" rel="nofollow">\u304a\u3066\u3093\u304d\u308b\u3057\u3075\u3047\u308b</a>"},{"from_user_id_str":"65976527","profile_image_url":"http://a0.twimg.com/profile_images/452810990/little_italies_____normal.jpg","created_at":"Thu, 27 Jan 2011 13:00:04 +0000","from_user":"heta_weather01","id_str":"30610995843964928","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u30d8\u30bf\u5929\u3011Jo napot.\u30cf\u30f3\u30ac\u30ea\u30fc\u3067\u3059\u3002\u6771\u4eac\u306e\u5929\u6c17\u306f\u6674\u306e\u3061\u66c7\u3067\u660e\u65e5\u306f\u6674\u6642\u3005\u66c7\u3001\u79c1\u306e\u3068\u3053\u308d\u3067\u306f\u66c7\u308a\u3067-2\u2103\u3067\u3059\u3002\u3048\u3001\u3053\u306e\u30d5\u30e9\u30a4\u30d1\u30f3\u3067\u3059\u304b\uff1f\u2026\u3061\u3087\u3063\u3068\u500b\u4eba\u7684\u306b\u6bb4\u308a\u305f\u3044\u4eba\u304c\u3044\u308b\u3093\u3067\u3059\u266a","id":30610995843964928,"from_user_id":65976527,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www15.atpages.jp/~kageyanma/" rel="nofollow">\u5730\u7403\u306e\u4e2d</a>"},{"from_user_id_str":"109740077","profile_image_url":"http://a0.twimg.com/profile_images/1212763349/1d3d3821-6b3a-449f-a636-05b95ce3d5d8_normal.png","created_at":"Thu, 27 Jan 2011 12:59:41 +0000","from_user":"snow_arai","id_str":"30610896141156354","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306f\u3001\u30ab\u30e9\u30ab\u30e9\u9023\u7d9a\u3000\uff13\u4f4d\u30bf\u30a4 - \u65e9\u8d77\u304d\u2606\u304a\u5929\u6c17\u2606ONAIR\u65e5\u8a18\uff1a\u65e5\u7d4c\u30a6\u30fc\u30de\u30f3\u30aa\u30f3\u30e9\u30a4\u30f3 http://j.mp/hxP3Di","id":30610896141156354,"from_user_id":109740077,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"53407951","profile_image_url":"http://a1.twimg.com/profile_images/397960795/airman_normal.jpg","created_at":"Thu, 27 Jan 2011 12:57:32 +0000","from_user":"Airman2009","id_str":"30610355541508096","metadata":{"result_type":"recent"},"to_user_id":null,"text":". @04mmy22 @qsk1 \u98a8\u3068\u96f2\u30fb\u30fb\u30fb\u98db\u884c\u6a5f\u306e\u5927\u5c0f\u554f\u308f\u305a\u3001\u3053\u308c\u3070\u304b\u308a\u306f\u3069\u3046\u3057\u3088\u3046\u3082\u7121\u3044\u3067\u3059\u3088\u306d\u3002 \u6700\u8fd1\u306e\u5357\u6771\u4eac\u306e\u5929\u6c17\u306f\u5909\u3067\u3059\u306d\u3002\u3002\u3002","id":30610355541508096,"from_user_id":53407951,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"111826019","profile_image_url":"http://a1.twimg.com/profile_images/1121742732/DVC00052_normal.jpg","created_at":"Thu, 27 Jan 2011 12:51:12 +0000","from_user":"nijiks","id_str":"30608762859421696","metadata":{"result_type":"recent"},"to_user_id":100014282,"text":"@sanaeru \u79c1\u3053\u3093\u306a\u5929\u6c17\u306e\u4e2d\uff64\u4e8c\u6cca\u4e09\u65e5\u3067\u660e\u65e5\u304b\u3089\u6771\u4eac\u884c\u304f\u3093\u3067\u3059\u3051\u3069\u2026\uff61\u65e5\u66dc\u65e5\u98db\u884c\u6a5f\u98db\u3076\u304b\u3057\u3089\u2026\uff1f","id":30608762859421696,"from_user_id":111826019,"to_user":"sanaeru","geo":null,"iso_language_code":"ja","to_user_id_str":"100014282","source":"<a href="http://z.twipple.jp/" rel="nofollow">\u3064\u3044\u3063\u3077\u308b/twipple</a>"},{"from_user_id_str":"164951488","profile_image_url":"http://a3.twimg.com/profile_images/799082230/twitter_normal.jpg","created_at":"Thu, 27 Jan 2011 12:47:49 +0000","from_user":"minorif_jp","id_str":"30607912309096448","metadata":{"result_type":"recent"},"to_user_id":105078670,"text":"@ecco_HIRADO \u5e73\u6238\u725b\u3063\u3066\u5143\u306f\u30aa\u30e9\u30f3\u30c0\u304b\u3089\u304d\u305f\u725b\u306a\u3093\u3060\u306d\u3002\u304a\u3044\u3057\u305d\u3046\u2026\u3002\u5e73\u6238\u306f\u3088\u304b\u6240\u305f\u3043\u3002\u3042\u305f\u3044\u3052\u3047\u3093\u5b9f\u5bb6\u3093\u65b9\u306f\u30c0\u30d6\u30eb\u706b\u5c71\u3084\u9ce5\u30a4\u30f3\u30d5\u30eb\u3067\u5927\u5909\u3084\u3063\u3069\u3002\u6771\u4eac\u3093\u826f\u304b\u3068\u3053\u306f\u5929\u6c17\u306e\u5fc3\u914d\u305b\u305a\u66ae\u3089\u305b\u308b\u3068\u3053\u3058\u3083\u3063\u3069\u3093\u3002","id":30607912309096448,"from_user_id":164951488,"to_user":"ecco_HIRADO","geo":null,"iso_language_code":"ja","to_user_id_str":"105078670","source":"<a href="http://z.twipple.jp/" rel="nofollow">\u3064\u3044\u3063\u3077\u308b/twipple</a>"},{"from_user_id_str":"10456803","profile_image_url":"http://a1.twimg.com/profile_images/145280215/vot_icon_normal.png","created_at":"Thu, 27 Jan 2011 12:43:37 +0000","from_user":"vot_","id_str":"30606853377363968","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3086\u3063\u304f\u308a\u5929\u6c17\u4e88\u5831\u3067\u3059\u3002\u6771\u4eac\u90fd,\u5927\u5cf6\u5730\u65b9\u300228\u65e5\uff08\u91d1\u66dc\u65e5\u306e\u5929\u6c17\u306f\u6674\u308c\u306e\u3061\u66c7\u308a\u3001\u6700\u9ad8\u6c17\u6e29\u306f7\u5ea6 \u6700\u4f4e\u6c17\u6e29\u306f1\u5ea6\u3067\u3057\u3087\u3046\u3002","id":30606853377363968,"from_user_id":10456803,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://voiceoftwitter.com" rel="nofollow">\uff56\uff4f\uff49\uff43\uff45 \uff4f\uff46 \uff54\uff57\uff49\uff54\uff54\uff45\uff52</a>"},{"from_user_id_str":"23900716","profile_image_url":"http://a3.twimg.com/profile_images/1092646332/twitter_icon_normal.png","created_at":"Thu, 27 Jan 2011 12:38:00 +0000","from_user":"keiyama","id_str":"30605442639990784","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u7f8e\u4eba\u5929\u6c17/\u6771\u4eac\u3011\u7f8e\u4eba\u5929\u6c17\u30ad\u30e3\u30b9\u30bf\u30fc\u306e"\u30c8\u30e2\u30b3\u3055\u3093"\u306b\u3088\u308b\u3068\u300c1/27(\u6728)\u306f\u304f\u3082\u308a\u306e\u3061\u6674\u3067\u3001\u964d\u6c34\u78ba\u738710%\u3001\u6700\u9ad8\u6c17\u6e29\u306f9\u2103\u3067\u6700\u4f4e\u6c17\u6e29\u306f2\u2103\u3067\u3059\u300d\u7f8e\u4eba\u5929\u6c17\u21d2http://bit.ly/djB8th http://twitpic.com/3tuekm #bt_tenki","id":30605442639990784,"from_user_id":23900716,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://bijintenki.jp" rel="nofollow">bijintenki.jp</a>"},{"from_user_id_str":"32018516","profile_image_url":"http://a0.twimg.com/profile_images/1089472069/237_normal.jpg","created_at":"Thu, 27 Jan 2011 12:36:28 +0000","from_user":"DigJandG","id_str":"30605057460281344","metadata":{"result_type":"recent"},"to_user_id":196050661,"text":"@kosumoworld55 \u5929\u6c17\u4e88\u5831\u3092\u898b\u3066\u3044\u3064\u3082\u601d\u3046\u3093\u3060\u3002\u4f55\u3067\u6a2a\u6d5c\u3042\u305f\u308a\u306f\u3044\u3064\u3082\u597d\u3044\u5929\u6c17\u306a\u3093\u3060\u3002\u6771\u4eac\u3082\u3002\u3061\u306a\u307f\u306b\u516c\u9b5a\u306f\u3042\u3093\u307e\u308a\u597d\u304d\u3067\u306f\u3042\u308a\u307e\u305b\u3093\u3002\u306a\u3093\u304b\u81ed\u304f\u3063\u3066\u3002\u3067\u3082\u3001\u7435\u7436\u6e56\u3067\u516c\u9b5a\u3063\u3066\u3042\u307e\u308a\u805e\u304b\u306a\u3044\u69d8\u306a\u30fb\u30fb\u30fb\u3002\u4ffa\u304c\u91e3\u308a\u3092\u3057\u306a\u3044\u304b\u3089\u304b\u306a\uff1f","id":30605057460281344,"from_user_id":32018516,"to_user":"kosumoworld55","geo":null,"iso_language_code":"ja","to_user_id_str":"196050661","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"90935348","profile_image_url":"http://a1.twimg.com/sticky/default_profile_images/default_profile_0_normal.png","created_at":"Thu, 27 Jan 2011 12:34:34 +0000","from_user":"sorakeiko","id_str":"30604575937396737","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u95a2\u6771\u5730\u65b9\u306e\u660e\u65e5\u306e\u5929\u6c17\u2015\u7d9a\u304d\u3002\u660e\u65e5\u671d\u6700\u4f4e\u6c17\u6e29\u30fb\u8ed2\u4e26\u307f\u6c37\u70b9\u4e0b\u30fb\u5b87\u90fd\u5bae\u3001\u6c34\u6238\u30de\u30a4\u30ca\u30b95\u5ea6\u30fb\u6771\u4eac\u3001\u6a2a\u6d5c1\u5ea6\u3002\u6700\u9ad8\u6c17\u6e29\u30fb\u4eca\u65e5\u3088\u308a3\u5ea6\u524d\u5f8c\u4f4e\u304f5\uff5e8\u5ea6\u30fb\u6771\u4eac\u3001\u5343\u84498\u5ea6\u3002\u5411\u3053\u3046\u4e00\u9031\u9593\u30fb\u4e7e\u71e5\u3057\u305f\u6674\u308c\u7d9a\u304f\u30fb\uff08\u571f\uff09\u4f0a\u8c46\u8af8\u5cf6\u306b\u51b7\u305f\u3044\u96e8\u3084\u96ea\u304c\u898b\u3089\u308c\u305d\u3046\u3060\u304c\u3001\u95a2\u6771\u306e\u4e7e\u3044\u305f\u72b6\u614b\u7d9a\u304f\u3002","id":30604575937396737,"from_user_id":90935348,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"6113557","profile_image_url":"http://a3.twimg.com/profile_images/1227080026/profile_red_herencia_normal.png","created_at":"Thu, 27 Jan 2011 12:33:57 +0000","from_user":"fmoto7","id_str":"30604423327653888","metadata":{"result_type":"recent"},"to_user_id":null,"text":""\u6771\u4eac\u6c34\u904b\u7528\u30bb\u30f3\u30bf\u30fc\u306f\u3001\u524d\u534a\u6226\u304c\u7d42\u308f\u3063\u305f\u3068\u3053\u308d\u3067\u4e00\u6c17\u306b\u6c34\u5727\u9ad8\u3081\u3001\u5f8c\u534a\u6226\u59cb\u307e\u308b\u3068\u6c34\u5727\u4e0b\u3052\u3001\u7d42\u308f\u308b\u3068\u307e\u305f\u3059\u3050\u4e0a\u3052\u308b\u3002\u30c6\u30ec\u30d3\u306e\u8996\u8074\u3001\u305d\u306e\u65e5\u306e\u5929\u6c17\u306a\u3069\u30e9\u30a4..." http://tumblr.com/xjy1cwiwrm","id":30604423327653888,"from_user_id":6113557,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.tumblr.com/" rel="nofollow">Tumblr</a>"},{"from_user_id_str":"118092912","profile_image_url":"http://a3.twimg.com/profile_images/1225330653/____normal.PNG","created_at":"Thu, 27 Jan 2011 12:29:13 +0000","from_user":"saechuchun","id_str":"30603231042207744","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3067\u3082\u5730\u9707\u306e\u8a71\u984c\u306e\u3068\u304d\u306e\u300c\u3082\u3057\u6771\u4eac\u3067\u76f4\u4e0b\u578b\u5730\u9707\u304c\u8d77\u304d\u305f\u3089\u300d\u3068\u304b\u5929\u6c17\u4e88\u5831\u306e\u3068\u304d\u306f\u897f\u3067\u96e8\u3060\u308d\u3046\u3068\u300c\u6771\u4eac\u3067\u306f\u301c\u65e5\u9593\u4e7e\u71e5\u3057\u3066\u307e\u3059\u306d\u30fc\u300d\u3068\u304b\u305d\u3046\u3044\u3046\u30ad\u30fc\u5c40\u306e\u95a2\u6771\u4e2d\u5fc3\u4e3b\u7fa9\u306f\u597d\u304d\u3067\u306f\u306a\u3044","id":30603231042207744,"from_user_id":118092912,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twtr.jp" rel="nofollow">Keitai Web</a>"}],"max_id":30724239224995840,"since_id":28179956995457024,"refresh_url":"?since_id=30724239224995840&q=%E6%9D%B1%E4%BA%AC%E3%80%80%E5%A4%A9%E6%B0%97","next_page":"?page=2&max_id=30724239224995840&rpp=50&lang=ja&q=%E6%9D%B1%E4%BA%AC%E3%80%80%E5%A4%A9%E6%B0%97","results_per_page":50,"page":1,"completed_in":0.170202,"warning":"adjusted since_id to 28179956995457024 (), requested since_id was older than allowed -- since_id removed for pagination.","since_id_str":"28179956995457024","max_id_str":"30724239224995840","query":"%E6%9D%B1%E4%BA%AC%E3%80%80%E5%A4%A9%E6%B0%97"}

benchmarks/json-data/numbers.jsondeleted−1

@@ -1 +0,0 @@

1−[1.15, 1.3224999999999998, 1.5208749999999998, 1.7490062499999994, 2.0113571874999994, 2.313060765624999, 2.6600198804687487, 3.0590228625390607, 3.5178762919199196, 4.045557735707907, 4.652391396064092, 5.350250105473706, 6.152787621294761, 7.075705764488975, 8.137061629162321, 9.357620873536668, 10.761264004567169, 12.375453605252241, 14.231771646040077, 16.36653739294609, 18.821518001888, 21.644745702171196, 24.891457557496874, 28.625176191121405, 32.918952619789614, 37.856795512758055, 43.535314839671756, 50.06561206562252, 57.57545387546589, 66.21177195678577, 76.14353775030362, 87.56506841284916, 100.69982867477653, 115.804802975993, 133.17552342239193, 153.15185193575073, 176.1246297261133, 202.5433241850303, 232.9248228127848, 267.86354623470254, 308.04307816990786, 354.24953989539404, 407.3869708797031, 468.49501651165855, 538.7692689884072, 619.5846593366683, 712.5223582371685, 819.4007119727437, 942.3108187686552, 1083.6574415839534, 1246.2060578215462, 1433.136966494778, 1648.1075114689947, 1895.323638189344, 2179.622183917745, 2506.565511505407, 2882.5503382312177, 3314.9328889659, 3812.172822310785, 4383.998745657402, 5041.598557506012, 5797.838341131914, 6667.5140923017, 7667.641206146955, 8817.787387068996, 10140.455495129345, 11661.523819398746, 13410.752392308557, 15422.365251154839, 17735.720038828065, 20396.078044652273, 23455.489751350113, 26973.813214052625, 31019.885196160518, 35672.867975584595, 41023.79817192228, 47177.36789771062, 54253.97308236721, 62392.06904472228, 71750.87940143062, 82513.5113116452, 94890.53800839197, 109124.11870965076, 125492.73651609836, 144316.6469935131, 165964.14404254008, 190858.76564892105, 219487.5804962592, 252410.71757069806, 290272.32520630275, 333813.17398724816, 383885.1500853353, 441467.9225981356, 507688.1109878559, 583841.3276360342, 671417.5267814393, 772130.1557986551, 887949.6791684533, 1021142.1310437213, 1174313.4507002793, 1350460.4683053212, 1553029.5385511192, 1785983.969333787, 2053881.564733855, 2361963.7994439327, 2716258.369360523, 3123697.124764601, 3592251.6934792907, 4131089.447501184, 4750752.864626361, 5463365.794320315, 6282870.663468362, 7225301.262988616, 8309096.452436907, 9555460.920302443, 10988780.058347808, 12637097.067099977, 14532661.627164973, 16712560.871239718, 19219445.001925673, 22102361.752214525, 25417716.0150467, 29230373.417303704, 33614929.42989926, 38657168.84438414, 44455744.17104176, 51124105.79669802, 58792721.66620272, 67611629.91613312, 77753374.40355308, 89416380.56408603, 102828837.64869894, 118253163.29600377, 135991137.79040432, 156389808.45896497, 179848279.7278097, 206825521.68698114, 237849349.94002828, 273526752.4310325, 314555765.2956874, 361739130.09004045, 415999999.60354644, 478399999.5440784, 550159999.4756901, 632683999.3970436, 727586599.3066001, 836724589.20259, 962233277.5829784, 1106568269.2204251, 1272553509.6034887, 1463436536.044012, 1682952016.4506137, 1935394818.9182055, 2225704041.755936, 2559559648.019326, 2943493595.222225, 3385017634.5055585, 3892770279.681392, 4476685821.6336, 5148188694.87864, 5920416999.1104355, 6808479548.977001, 7829751481.32355, 9004214203.522081, 10354846334.050394, 11908073284.157951, 13694284276.781643, 15748426918.29889, 18110690956.04372, 20827294599.450275, 23951388789.367817, 27544097107.772987, 31675711673.938934, 36427068425.02977, 41891128688.78423, 48174797992.10186, 55401017690.91714, 63711170344.5547, 73267845896.2379, 84258022780.67358, 96896726197.77461, 111431235127.4408, 128145920396.5569, 147367808456.04044, 169472979724.44647, 194893926683.11343, 224128015685.58044, 257747218038.41748, 296409300744.1801, 340870695855.80707, 392001300234.1781, 450801495269.3048, 518421719559.70044, 596184977493.6555, 685612724117.7037, 788454632735.3593, 906722827645.6631, 1042731251792.5125, 1199140939561.3892, 1379012080495.5974, 1585863892569.937, 1823743476455.4275, 2097304997923.7415, 2411900747612.3022, 2773685859754.1475, 3189738738717.2695, 3668199549524.8594, 4218429481953.5884, 4851193904246.626, 5578872989883.619, 6415703938366.162, 7378059529121.086, 8484768458489.248, 9757483727262.635, 11221106286352.03, 12904272229304.832, 14839913063700.555, 17065900023255.637, 19625785026743.98, 22569652780755.58, 25955100697868.91, 29848365802549.246, 34325620672931.63, 39474463773871.375, 45395633339952.07, 52204978340944.88, 60035725092086.61, 69041083855899.59, 79397246434284.53, 91306833399427.2, 105002858409341.27, 120753287170742.45, 138866280246353.81, 159696222283306.88, 183650655625802.88, 211198253969673.3, 242877992065124.28, 279309690874892.9, 321206144506126.8, 369387066182045.8, 424795126109352.6, 488514395025755.5, 561791554279618.75, 646060287421561.5, 742969330534795.8, 854414730115015.0, 982576939632267.1, 1129963480577107.2, 1299458002663673.2, 1494376703063224.0, 1718533208522707.5, 1976313189801113.5, 2272760168271280.5, 2613674193511972.0, 3005725322538767.5, 3456584120919582.5, 3975071739057519.5, 4571332499916147.0, 5257032374903569.0, 6045587231139104.0, 6952425315809969.0, 7995289113181464.0, 9194582480158682.0, 1.0573769852182484e+16, 1.2159835330009856e+16, 1.3983810629511332e+16, 1.6081382223938032e+16, 1.8493589557528736e+16, 2.1267627991158044e+16, 2.4457772189831748e+16, 2.8126438018306508e+16, 3.234540372105248e+16, 3.719721427921035e+16, 4.27767964210919e+16, 4.919331588425568e+16, 5.657231326689403e+16, 6.505816025692813e+16, 7.481688429546734e+16, 8.603941693978744e+16, 9.894532948075555e+16, 1.1378712890286886e+17, 1.3085519823829918e+17, 1.5048347797404406e+17, 1.7305599967015066e+17, 1.9901439962067325e+17, 2.288665595637742e+17, 2.6319654349834032e+17, 3.026760250230913e+17, 3.48077428776555e+17, 4.002890430930382e+17, 4.603323995569939e+17, 5.29382259490543e+17, 6.087895984141244e+17, 7.00108038176243e+17, 8.051242439026793e+17, 9.258928804880812e+17, 1.0647768125612933e+18, 1.224493334445487e+18, 1.4081673346123103e+18, 1.6193924348041567e+18, 1.8623013000247798e+18, 2.1416464950284966e+18, 2.462893469282771e+18, 2.8323274896751867e+18, 3.257176613126464e+18, 3.7457531050954337e+18, 4.3076160708597484e+18, 4.95375848148871e+18, 5.696822253712016e+18, 6.551345591768818e+18, 7.53404743053414e+18, 8.66415454511426e+18, 9.963777726881399e+18, 1.1458344385913608e+19, 1.3177096043800648e+19, 1.5153660450370744e+19, 1.7426709517926355e+19, 2.0040715945615307e+19, 2.30468233374576e+19, 2.650384683807624e+19, 3.047942386378767e+19, 3.505133744335582e+19, 4.030903805985919e+19, 4.635539376883806e+19, 5.330870283416377e+19, 6.130500825928833e+19, 7.0500759498181575e+19, 8.10758734229088e+19, 9.323725443634512e+19, 1.0722284260179688e+20, 1.233062689920664e+20, 1.4180220934087634e+20, 1.6307254074200778e+20, 1.8753342185330894e+20, 2.1566343513130526e+20, 2.4801295040100103e+20, 2.8521489296115116e+20, 3.2799712690532385e+20, 3.7719669594112236e+20, 4.337762003322907e+20, 4.988426303821342e+20, 5.7366902493945437e+20, 6.597193786803724e+20, 7.586772854824282e+20, 8.724788783047925e+20, 1.0033507100505113e+21, 1.1538533165580878e+21, 1.326931314041801e+21, 1.5259710111480708e+21, 1.7548666628202813e+21, 2.0180966622433234e+21, 2.3208111615798217e+21, 2.668932835816795e+21, 3.0692727611893135e+21, 3.529663675367711e+21, 4.059113226672867e+21, 4.667980210673796e+21, 5.368177242274866e+21, 6.173403828616095e+21, 7.099414402908508e+21, 8.164326563344784e+21, 9.388975547846502e+21, 1.0797321880023475e+22, 1.2416920162026996e+22, 1.4279458186331043e+22, 1.64213769142807e+22, 1.8884583451422802e+22, 2.171727096913622e+22, 2.497486161450665e+22, 2.872109085668265e+22, 3.3029254485185042e+22, 3.798364265796279e+22, 4.368118905665721e+22, 5.0233367415155795e+22, 5.7768372527429155e+22, 6.643362840654352e+22, 7.639867266752504e+22, 8.78584735676538e+22, 1.0103724460280185e+23, 1.1619283129322213e+23, 1.3362175598720545e+23, 1.5366501938528623e+23, 1.7671477229307915e+23, 2.0322198813704103e+23, 2.3370528635759717e+23, 2.687610793112367e+23, 3.090752412079222e+23, 3.554365273891105e+23, 4.0875200649747705e+23, 4.700648074720986e+23, 5.405745285929133e+23, 6.216607078818502e+23, 7.149098140641278e+23, 8.221462861737468e+23, 9.454682290998088e+23, 1.0872884634647801e+24, 1.250381732984497e+24, 1.4379389929321714e+24, 1.653629841871997e+24, 1.9016743181527962e+24, 2.1869254658757156e+24, 2.5149642857570727e+24, 2.8922089286206334e+24, 3.326040267913728e+24, 3.824946308100787e+24, 4.3986882543159046e+24, 5.05849149246329e+24, 5.817265216332783e+24, 6.6898549987827e+24, 7.693333248600105e+24, 8.84733323589012e+24, 1.0174433221273637e+25, 1.1700598204464681e+25, 1.3455687935134384e+25, 1.547404112540454e+25, 1.779514729421522e+25, 2.04644193883475e+25, 2.353408229659962e+25, 2.7064194641089563e+25, 3.1123823837253e+25, 3.5792397412840944e+25, 4.116125702476708e+25, 4.733544557848214e+25, 5.443576241525446e+25, 6.260112677754262e+25, 7.199129579417401e+25, 8.27899901633001e+25, 9.52084886877951e+25, 1.0948976199096437e+26, 1.25913226289609e+26, 1.4480021023305035e+26, 1.665202417680079e+26, 1.9149827803320907e+26, 2.202230197381904e+26, 2.5325647269891895e+26, 2.9124494360375676e+26, 3.349316851443203e+26, 3.8517143791596826e+26, 4.429471536033635e+26, 5.09389226643868e+26, 5.857976106404481e+26, 6.736672522365153e+26, 7.747173400719924e+26, 8.909249410827912e+26, 1.0245636822452099e+27, 1.1782482345819913e+27, 1.35498546976929e+27, 1.5582332902346833e+27, 1.7919682837698857e+27, 2.0607635263353683e+27, 2.3698780552856732e+27, 2.725359763578524e+27, 3.1341637281153025e+27, 3.6042882873325974e+27, 4.1449315304324867e+27, 4.7666712599973594e+27, 5.481671948996963e+27, 6.303922741346507e+27, 7.249511152548482e+27, 8.336937825430755e+27, 9.587478499245366e+27, 1.102560027413217e+28, 1.2679440315251995e+28, 1.4581356362539794e+28, 1.6768559816920761e+28, 1.9283843789458875e+28, 2.2176420357877703e+28, 2.5502883411559357e+28, 2.932831592329326e+28, 3.3727563311787245e+28, 3.8786697808555327e+28, 4.460470247983863e+28, 5.129540785181441e+28, 5.8989719029586575e+28, 6.783817688402455e+28, 7.801390341662823e+28, 8.971598892912247e+28, 1.0317338726849081e+29, 1.1864939535876443e+29, 1.3644680466257909e+29, 1.5691382536196593e+29, 1.8045089916626083e+29, 2.0751853404119993e+29, 2.3864631414737988e+29, 2.7444326126948684e+29, 3.1560975045990984e+29, 3.629512130288963e+29, 4.173938949832307e+29, 4.800029792307153e+29, 5.520034261153225e+29, 6.348039400326208e+29, 7.300245310375139e+29, 8.39528210693141e+29, 9.65457442297112e+29, 1.1102760586416787e+30, 1.2768174674379305e+30, 1.46834008755362e+30, 1.6885911006866628e+30, 1.941879765789662e+30, 2.2331617306581113e+30, 2.568135990256828e+30, 2.9533563887953516e+30, 3.396359847114654e+30, 3.905813824181852e+30, 4.491685897809129e+30, 5.165438782480498e+30, 5.940254599852573e+30, 6.831292789830458e+30, 7.855986708305026e+30, 9.034384714550779e+30, 1.0389542421733396e+31, 1.1947973784993405e+31, 1.3740169852742412e+31, 1.5801195330653773e+31, 1.817137463025184e+31, 2.0897080824789613e+31, 2.4031642948508052e+31, 2.7636389390784257e+31, 3.1781847799401893e+31, 3.6549124969312175e+31, 4.2031493714709e+31, 4.833621777191535e+31, 5.558665043770264e+31, 6.392464800335803e+31, 7.3513345203861735e+31, 8.454034698444098e+31, 9.722139903210713e+31, 1.1180460888692319e+32, 1.2857530021996165e+32, 1.478615952529559e+32, 1.7004083454089925e+32, 1.9554695972203414e+32, 2.2487900368033926e+32, 2.586108542323901e+32, 2.974024823672486e+32, 3.420128547223359e+32, 3.933147829306862e+32, 4.523120003702891e+32, 5.2015880042583246e+32, 5.981826204897073e+32, 6.879100135631634e+32, 7.910965155976377e+32, 9.097609929372833e+32, 1.0462251418778757e+33, 1.2031589131595571e+33, 1.3836327501334904e+33, 1.591177662653514e+33, 1.8298543120515409e+33, 2.104332458859272e+33, 2.4199823276881623e+33, 2.7829796768413863e+33, 3.200426628367594e+33, 3.6804906226227334e+33, 4.232564216016143e+33, 4.867448848418564e+33, 5.597566175681348e+33, 6.437201102033549e+33, 7.402781267338582e+33, 8.513198457439368e+33, 9.790178226055273e+33, 1.1258704959963564e+34, 1.2947510703958096e+34, 1.488963730955181e+34, 1.712308290598458e+34, 1.9691545341882266e+34, 2.2645277143164603e+34, 2.604206871463929e+34, 2.994837902183518e+34, 3.4440635875110457e+34, 3.960673125637702e+34, 4.554774094483357e+34, 5.237990208655861e+34, 6.023688739954239e+34, 6.927242050947375e+34, 7.96632835858948e+34, 9.161277612377902e+34, 1.0535469254234585e+35, 1.2115789642369772e+35, 1.3933158088725236e+35, 1.6023131802034022e+35, 1.8426601572339122e+35, 2.119059180818999e+35, 2.4369180579418488e+35, 2.8024557666331258e+35, 3.2228241316280944e+35, 3.706247751372308e+35, 4.262184914078154e+35, 4.901512651189877e+35, 5.636739548868358e+35, 6.482250481198611e+35, 7.454588053378403e+35, 8.572776261385162e+35, 9.858692700592935e+35, 1.1337496605681875e+36, 1.3038121096534156e+36, 1.499383926101428e+36, 1.7242915150166418e+36, 1.982935242269138e+36, 2.2803755286095084e+36]

benchmarks/json-data/twitter1.jsondeleted−1

@@ -1 +0,0 @@

1−{"results":[{"from_user_id_str":"80430860","profile_image_url":"http://a2.twimg.com/profile_images/536455139/icon32_normal.png","created_at":"Wed, 26 Jan 2011 07:07:02 +0000","from_user":"kazu_yamamoto","id_str":"30159761706061824","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell Server Pages \u3063\u3066\u3001\u307e\u3060\u7d9a\u3044\u3066\u3044\u305f\u306e\u304b\uff01","id":30159761706061824,"from_user_id":80430860,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"}],"max_id":30159761706061824,"since_id":0,"refresh_url":"?since_id=30159761706061824&q=haskell","next_page":"?page=2&max_id=30159761706061824&rpp=1&q=haskell","results_per_page":1,"page":1,"completed_in":0.012606,"since_id_str":"0","max_id_str":"30159761706061824","query":"haskell"}

benchmarks/json-data/twitter10.jsondeleted−1

@@ -1 +0,0 @@

1−{"results":[{"from_user_id_str":"207858021","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Wed, 26 Jan 2011 04:30:38 +0000","from_user":"pboudarga","id_str":"30120402839666689","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I'm at Rolla Sushi Grill (27737 Bouquet Canyon Road, #106, Btw Haskell Canyon and Rosedell Drive, Saugus) http://4sq.com/gqqdhs","id":30120402839666689,"from_user_id":207858021,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://foursquare.com" rel="nofollow">foursquare</a>"},{"from_user_id_str":"69988683","profile_image_url":"http://a0.twimg.com/profile_images/1211955817/avatar_7888_normal.gif","created_at":"Wed, 26 Jan 2011 04:25:23 +0000","from_user":"YNK33","id_str":"30119083059978240","metadata":{"result_type":"recent"},"to_user_id":null,"text":"hsndfile 0.5.0: Free and open source Haskell bindings for libsndfile http://bit.ly/gHaBWG Mac Os","id":30119083059978240,"from_user_id":69988683,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"81492","profile_image_url":"http://a1.twimg.com/profile_images/423894208/Picture_7_normal.jpg","created_at":"Wed, 26 Jan 2011 04:24:28 +0000","from_user":"satzz","id_str":"30118851488251904","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Emacs\u306e\u30e2\u30fc\u30c9\u8868\u793a\u304c\u4eca(Ruby Controller Outputz RoR Flymake REl hs)\u3068\u306a\u3063\u3066\u3066\u3088\u304f\u308f\u304b\u3089\u306a\u3044\u3093\u3060\u3051\u3069\u6700\u5f8c\u306eREl\u3068\u304bhs\u3063\u3066\u4f55\u3060\u308d\u3046\u2026haskell\u3068\u304b2\u5e74\u4ee5\u4e0a\u66f8\u3044\u3066\u306a\u3044\u3051\u3069\u2026","id":30118851488251904,"from_user_id":81492,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"9518356","profile_image_url":"http://a2.twimg.com/profile_images/119165723/ocaml-icon_normal.png","created_at":"Wed, 26 Jan 2011 04:19:19 +0000","from_user":"planet_ocaml","id_str":"30117557788741632","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I so miss #haskell type classes in #ocaml - i want to do something like refinement. Also why does ocaml not have... http://bit.ly/geYRwt","id":30117557788741632,"from_user_id":9518356,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"218059","profile_image_url":"http://a1.twimg.com/profile_images/1053837723/twitter-icon9_normal.jpg","created_at":"Wed, 26 Jan 2011 04:16:32 +0000","from_user":"aprikip","id_str":"30116854940835840","metadata":{"result_type":"recent"},"to_user_id":null,"text":"yatex-mode\u3084haskell-mode\u306e\u3053\u3068\u3067\u3059\u306d\u3001\u308f\u304b\u308a\u307e\u3059\u3002","id":30116854940835840,"from_user_id":218059,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sites.google.com/site/yorufukurou/" rel="nofollow">YoruFukurou</a>"},{"from_user_id_str":"216363","profile_image_url":"http://a1.twimg.com/profile_images/72454310/Tim-Avatar_normal.png","created_at":"Wed, 26 Jan 2011 04:15:30 +0000","from_user":"dysinger","id_str":"30116594684264448","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell in Hawaii tonight for me... #fun","id":30116594684264448,"from_user_id":216363,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.nambu.com/" rel="nofollow">Nambu</a>"},{"from_user_id_str":"1774820","profile_image_url":"http://a2.twimg.com/profile_images/61169291/dan_desert_thumb_normal.jpg","created_at":"Wed, 26 Jan 2011 04:13:36 +0000","from_user":"DanMil","id_str":"30116117682851840","metadata":{"result_type":"recent"},"to_user_id":1594784,"text":"@ojrac @chewedwire @tomheon Haskell isn't a language, it's a belief system. A seductive one...","id":30116117682851840,"from_user_id":1774820,"to_user":"ojrac","geo":null,"iso_language_code":"en","to_user_id_str":"1594784","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"659256","profile_image_url":"http://a0.twimg.com/profile_images/746976711/angular-final_normal.jpg","created_at":"Wed, 26 Jan 2011 04:11:06 +0000","from_user":"djspiewak","id_str":"30115488931520512","metadata":{"result_type":"recent"},"to_user_id":null,"text":"One of the very nice things about Haskell as opposed to SML is the reduced proliferation of identifiers (e.g. andb, orb, etc). #typeclasses","id":30115488931520512,"from_user_id":659256,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://itunes.apple.com/us/app/twitter/id409789998?mt=12" rel="nofollow">Twitter for Mac</a>"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Wed, 26 Jan 2011 04:06:12 +0000","from_user":"listwarenet","id_str":"30114255890026496","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-cafe/84752-re-haskell-cafe-gpl-license-of-h-matrix-and-prelude-numeric.html Re: Haskell-c","id":30114255890026496,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://1e10.org/cloud/" rel="nofollow">1e10</a>"},{"from_user_id_str":"1594784","profile_image_url":"http://a2.twimg.com/profile_images/378515773/square-profile_normal.jpg","created_at":"Wed, 26 Jan 2011 04:01:29 +0000","from_user":"ojrac","id_str":"30113067333324800","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @tomheon: @ojrac @chewedwire Don't worry, learning Haskell will not give you any clear idea what monad means.","id":30113067333324800,"from_user_id":1594784,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"}],"max_id":30120402839666689,"since_id":0,"refresh_url":"?since_id=30120402839666689&q=haskell","next_page":"?page=2&max_id=30120402839666689&rpp=10&q=haskell","results_per_page":10,"page":1,"completed_in":0.012714,"since_id_str":"0","max_id_str":"30120402839666689","query":"haskell"}

benchmarks/json-data/twitter100.jsondeleted−1

@@ -1 +0,0 @@

1−{"results":[{"from_user_id_str":"3646730","profile_image_url":"http://a3.twimg.com/profile_images/404973767/avatar_normal.jpg","created_at":"Wed, 26 Jan 2011 04:35:07 +0000","from_user":"nicolaslara","id_str":"30121530767708160","metadata":{"result_type":"recent"},"to_user_id":18616016,"text":"@josej30 Python y Clojure. Obviamente son diferentes, y cada uno tiene sus ventajas y desventajas. De Haskell faltar\u00eda pattern matching","id":30121530767708160,"from_user_id":3646730,"to_user":"josej30","geo":null,"iso_language_code":"es","to_user_id_str":"18616016","source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"207858021","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Wed, 26 Jan 2011 04:30:38 +0000","from_user":"pboudarga","id_str":"30120402839666689","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I'm at Rolla Sushi Grill (27737 Bouquet Canyon Road, #106, Btw Haskell Canyon and Rosedell Drive, Saugus) http://4sq.com/gqqdhs","id":30120402839666689,"from_user_id":207858021,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://foursquare.com" rel="nofollow">foursquare</a>"},{"from_user_id_str":"69988683","profile_image_url":"http://a0.twimg.com/profile_images/1211955817/avatar_7888_normal.gif","created_at":"Wed, 26 Jan 2011 04:25:23 +0000","from_user":"YNK33","id_str":"30119083059978240","metadata":{"result_type":"recent"},"to_user_id":null,"text":"hsndfile 0.5.0: Free and open source Haskell bindings for libsndfile http://bit.ly/gHaBWG Mac Os","id":30119083059978240,"from_user_id":69988683,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"81492","profile_image_url":"http://a1.twimg.com/profile_images/423894208/Picture_7_normal.jpg","created_at":"Wed, 26 Jan 2011 04:24:28 +0000","from_user":"satzz","id_str":"30118851488251904","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Emacs\u306e\u30e2\u30fc\u30c9\u8868\u793a\u304c\u4eca(Ruby Controller Outputz RoR Flymake REl hs)\u3068\u306a\u3063\u3066\u3066\u3088\u304f\u308f\u304b\u3089\u306a\u3044\u3093\u3060\u3051\u3069\u6700\u5f8c\u306eREl\u3068\u304bhs\u3063\u3066\u4f55\u3060\u308d\u3046\u2026haskell\u3068\u304b2\u5e74\u4ee5\u4e0a\u66f8\u3044\u3066\u306a\u3044\u3051\u3069\u2026","id":30118851488251904,"from_user_id":81492,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"9518356","profile_image_url":"http://a2.twimg.com/profile_images/119165723/ocaml-icon_normal.png","created_at":"Wed, 26 Jan 2011 04:19:19 +0000","from_user":"planet_ocaml","id_str":"30117557788741632","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I so miss #haskell type classes in #ocaml - i want to do something like refinement. Also why does ocaml not have... http://bit.ly/geYRwt","id":30117557788741632,"from_user_id":9518356,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"218059","profile_image_url":"http://a1.twimg.com/profile_images/1053837723/twitter-icon9_normal.jpg","created_at":"Wed, 26 Jan 2011 04:16:32 +0000","from_user":"aprikip","id_str":"30116854940835840","metadata":{"result_type":"recent"},"to_user_id":null,"text":"yatex-mode\u3084haskell-mode\u306e\u3053\u3068\u3067\u3059\u306d\u3001\u308f\u304b\u308a\u307e\u3059\u3002","id":30116854940835840,"from_user_id":218059,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sites.google.com/site/yorufukurou/" rel="nofollow">YoruFukurou</a>"},{"from_user_id_str":"216363","profile_image_url":"http://a1.twimg.com/profile_images/72454310/Tim-Avatar_normal.png","created_at":"Wed, 26 Jan 2011 04:15:30 +0000","from_user":"dysinger","id_str":"30116594684264448","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell in Hawaii tonight for me... #fun","id":30116594684264448,"from_user_id":216363,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.nambu.com/" rel="nofollow">Nambu</a>"},{"from_user_id_str":"1774820","profile_image_url":"http://a2.twimg.com/profile_images/61169291/dan_desert_thumb_normal.jpg","created_at":"Wed, 26 Jan 2011 04:13:36 +0000","from_user":"DanMil","id_str":"30116117682851840","metadata":{"result_type":"recent"},"to_user_id":1594784,"text":"@ojrac @chewedwire @tomheon Haskell isn't a language, it's a belief system. A seductive one...","id":30116117682851840,"from_user_id":1774820,"to_user":"ojrac","geo":null,"iso_language_code":"en","to_user_id_str":"1594784","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"659256","profile_image_url":"http://a0.twimg.com/profile_images/746976711/angular-final_normal.jpg","created_at":"Wed, 26 Jan 2011 04:11:06 +0000","from_user":"djspiewak","id_str":"30115488931520512","metadata":{"result_type":"recent"},"to_user_id":null,"text":"One of the very nice things about Haskell as opposed to SML is the reduced proliferation of identifiers (e.g. andb, orb, etc). #typeclasses","id":30115488931520512,"from_user_id":659256,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://itunes.apple.com/us/app/twitter/id409789998?mt=12" rel="nofollow">Twitter for Mac</a>"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Wed, 26 Jan 2011 04:06:12 +0000","from_user":"listwarenet","id_str":"30114255890026496","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-cafe/84752-re-haskell-cafe-gpl-license-of-h-matrix-and-prelude-numeric.html Re: Haskell-c","id":30114255890026496,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://1e10.org/cloud/" rel="nofollow">1e10</a>"},{"from_user_id_str":"1594784","profile_image_url":"http://a2.twimg.com/profile_images/378515773/square-profile_normal.jpg","created_at":"Wed, 26 Jan 2011 04:01:29 +0000","from_user":"ojrac","id_str":"30113067333324800","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @tomheon: @ojrac @chewedwire Don't worry, learning Haskell will not give you any clear idea what monad means.","id":30113067333324800,"from_user_id":1594784,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"207589736","profile_image_url":"http://a3.twimg.com/profile_images/1225527428/headshot_1_normal.jpg","created_at":"Wed, 26 Jan 2011 04:00:13 +0000","from_user":"ashleevelazq101","id_str":"30112747555397632","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Federal investigation finds safety violations at The Acadia Hospital: By Meg Haskell, BDN Staff The investigatio... http://bit.ly/dONnpn","id":30112747555397632,"from_user_id":207589736,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"17671137","profile_image_url":"http://a2.twimg.com/profile_images/290264834/Haskell-logo-outer-glow_normal.png","created_at":"Wed, 26 Jan 2011 03:58:00 +0000","from_user":"Hackage","id_str":"30112192346984448","metadata":{"result_type":"recent"},"to_user_id":null,"text":"streams 0.4, added by EdwardKmett: Various Haskell 2010 stream comonads http://bit.ly/idBkPe","id":30112192346984448,"from_user_id":17671137,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"17489366","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Wed, 26 Jan 2011 03:58:00 +0000","from_user":"aapnoot","id_str":"30112191881420800","metadata":{"result_type":"recent"},"to_user_id":null,"text":"streams 0.4, added by EdwardKmett: Various Haskell 2010 stream comonads http://bit.ly/idBkPe","id":30112191881420800,"from_user_id":17489366,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"8530482","profile_image_url":"http://a2.twimg.com/profile_images/137867266/n608671563_7396_normal.jpg","created_at":"Wed, 26 Jan 2011 03:50:12 +0000","from_user":"jeffmclamb","id_str":"30110229207187456","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Angel - daemon to run and monitor processes like daemontools or god, written in Haskell http://ff.im/-wNyLk","id":30110229207187456,"from_user_id":8530482,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://friendfeed.com" rel="nofollow">FriendFeed</a>"},{"from_user_id_str":"177539201","profile_image_url":"http://a0.twimg.com/profile_images/1178368800/img_normal.jpeg","created_at":"Wed, 26 Jan 2011 03:46:01 +0000","from_user":"tomheon","id_str":"30109174645919744","metadata":{"result_type":"recent"},"to_user_id":1594784,"text":"@ojrac @chewedwire Don't worry, learning Haskell will not give you any clear idea what monad means.","id":30109174645919744,"from_user_id":177539201,"to_user":"ojrac","geo":null,"iso_language_code":"en","to_user_id_str":"1594784","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"1594784","profile_image_url":"http://a2.twimg.com/profile_images/378515773/square-profile_normal.jpg","created_at":"Wed, 26 Jan 2011 03:44:34 +0000","from_user":"ojrac","id_str":"30108808684503040","metadata":{"result_type":"recent"},"to_user_id":128028225,"text":"@chewedwire @tomheon Why are you making me curious about Haskell? I LIKE not knowing what monad means!!","id":30108808684503040,"from_user_id":1594784,"to_user":"chewedwire","geo":null,"iso_language_code":"en","to_user_id_str":"128028225","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"23750094","profile_image_url":"http://a0.twimg.com/profile_images/951373780/Moeinthecar_normal.jpg","created_at":"Wed, 26 Jan 2011 03:41:54 +0000","from_user":"shokalshab","id_str":"30108140443795456","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I'm at Magnitude Cheer @ Gymnastics Olympica USA (7735 Haskell Ave., btw Saticoy & Strathern, Van Nuys) http://4sq.com/gmXfaL","id":30108140443795456,"from_user_id":23750094,"geo":null,"iso_language_code":"en","place":{"id":"4e4a2a2f86cb2946","type":"poi","full_name":"Gymnastics Olympica USA, Van Nuys"},"to_user_id_str":null,"source":"<a href="http://foursquare.com" rel="nofollow">foursquare</a>"},{"from_user_id_str":"8135112","profile_image_url":"http://a0.twimg.com/profile_images/1165240350/LIMITED_normal.jpg","created_at":"Wed, 26 Jan 2011 03:41:35 +0000","from_user":"Claricei","id_str":"30108059208515584","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @kristenmchugh22: @KeithOlbermann Ryan looks like Jughead w/o the hat. And sounds as mealy-mouthed as Eddie Haskell.","id":30108059208515584,"from_user_id":8135112,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"128028225","profile_image_url":"http://a1.twimg.com/profile_images/1224994593/Coding_Drunk_normal.jpg","created_at":"Wed, 26 Jan 2011 03:40:02 +0000","from_user":"chewedwire","id_str":"30107670367182848","metadata":{"result_type":"recent"},"to_user_id":177539201,"text":"@tomheon Cool, I'll take a look. I feel like I should mention this: http://bit.ly/hVstDM","id":30107670367182848,"from_user_id":128028225,"to_user":"tomheon","geo":null,"iso_language_code":"en","to_user_id_str":"177539201","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"8679778","profile_image_url":"http://a3.twimg.com/profile_images/1195318056/me_nyc_12_18_10_icon_normal.jpg","created_at":"Wed, 26 Jan 2011 03:38:42 +0000","from_user":"kristenmchugh22","id_str":"30107332381777920","metadata":{"result_type":"recent"},"to_user_id":756269,"text":"@KeithOlbermann Ryan looks like Jughead w/o the hat. And sounds as mealy-mouthed as Eddie Haskell.","id":30107332381777920,"from_user_id":8679778,"to_user":"KeithOlbermann","geo":null,"iso_language_code":"en","to_user_id_str":"756269","source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"103316559","profile_image_url":"http://a1.twimg.com/profile_images/1179458751/bc3beab4-d59d-4e78-b13b-50747986cfa2_normal.png","created_at":"Wed, 26 Jan 2011 03:36:15 +0000","from_user":"cityslikr","id_str":"30106719153557504","metadata":{"result_type":"recent"},"to_user_id":null,"text":""Social safety net into a hammock." So says Eddie Haskell with the GOP response. #SOTU","id":30106719153557504,"from_user_id":103316559,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://blackberry.com/twitter" rel="nofollow">Twitter for BlackBerry\u00ae</a>"},{"from_user_id_str":"169063143","profile_image_url":"http://a0.twimg.com/profile_images/1160506212/9697_1_normal.gif","created_at":"Wed, 26 Jan 2011 03:31:52 +0000","from_user":"wrkforce_safety","id_str":"30105614919143424","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Federal investigation finds safety violations at The Acadia Hospital: By Meg Haskell, BDN Staff The investigatio... http://bit.ly/gA60C1","id":30105614919143424,"from_user_id":169063143,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"177539201","profile_image_url":"http://a0.twimg.com/profile_images/1178368800/img_normal.jpeg","created_at":"Wed, 26 Jan 2011 03:29:40 +0000","from_user":"tomheon","id_str":"30105060960632832","metadata":{"result_type":"recent"},"to_user_id":128028225,"text":"@chewedwire Great book on Haskell: http://oreilly.com/catalog/9780596514983","id":30105060960632832,"from_user_id":177539201,"to_user":"chewedwire","geo":null,"iso_language_code":"en","to_user_id_str":"128028225","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"782692","profile_image_url":"http://a0.twimg.com/profile_images/1031304589/Profile.2007.1_normal.jpg","created_at":"Wed, 26 Jan 2011 03:29:19 +0000","from_user":"turnageb","id_str":"30104974591533057","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @ovillalon: Paul Ryan solves the mystery of whatever happened to Eddie Haskell. #sotu","id":30104974591533057,"from_user_id":782692,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"128028225","profile_image_url":"http://a1.twimg.com/profile_images/1224994593/Coding_Drunk_normal.jpg","created_at":"Wed, 26 Jan 2011 03:28:04 +0000","from_user":"chewedwire","id_str":"30104657267265536","metadata":{"result_type":"recent"},"to_user_id":177539201,"text":"@tomheon I always loved the pattern matching in SML and it looks like Haskell is MUCH better at it. I'm messing around now at tryhaskell.org","id":30104657267265536,"from_user_id":128028225,"to_user":"tomheon","geo":null,"iso_language_code":"en","to_user_id_str":"177539201","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"12834082","profile_image_url":"http://a3.twimg.com/profile_images/1083036140/mugshot_normal.png","created_at":"Wed, 26 Jan 2011 03:28:01 +0000","from_user":"ovillalon","id_str":"30104647213518848","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Paul Ryan solves the mystery of whatever happened to Eddie Haskell. #sotu","id":30104647213518848,"from_user_id":12834082,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"13540930","profile_image_url":"http://a1.twimg.com/profile_images/1205312219/23467_350321383101_821143101_5114147_3010041_n_normal.jpg","created_at":"Wed, 26 Jan 2011 03:26:02 +0000","from_user":"goodfox","id_str":"30104146455560192","metadata":{"result_type":"recent"},"to_user_id":10226179,"text":"@billykeene22 Bordeaux is one of my heroes. I was so excited when he accepted the invitation to campus. He's been a great friend to Haskell.","id":30104146455560192,"from_user_id":13540930,"to_user":"billykeene22","geo":null,"iso_language_code":"en","to_user_id_str":"10226179","source":"<a href="http://www.ubertwitter.com/bb/download.php" rel="nofollow">\u00dcberTwitter</a>"},{"from_user_id_str":"18616016","profile_image_url":"http://a2.twimg.com/profile_images/1173522726/214397343_normal.jpg","created_at":"Wed, 26 Jan 2011 03:25:18 +0000","from_user":"josej30","id_str":"30103962313031681","metadata":{"result_type":"recent"},"to_user_id":14870909,"text":"@cris7ian Ahh bueno multiparadigma ya es respetable :) Empezar\u00e9 a explotar la parte funcional de los lenguajes ahora #Haskell","id":30103962313031681,"from_user_id":18616016,"to_user":"Cris7ian","geo":null,"iso_language_code":"es","to_user_id_str":"14870909","source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"14870909","profile_image_url":"http://a2.twimg.com/profile_images/1176930429/oso_yo_normal.png","created_at":"Wed, 26 Jan 2011 03:23:43 +0000","from_user":"Cris7ian","id_str":"30103562360983553","metadata":{"result_type":"recent"},"to_user_id":18616016,"text":"@josej30 hahaha no, es multiparadigma y es bastante lazy. Nothing like haskell, pero s\u00ed, el de Flash","id":30103562360983553,"from_user_id":14870909,"to_user":"josej30","geo":null,"iso_language_code":"es","to_user_id_str":"18616016","source":"<a href="http://www.echofon.com/" rel="nofollow">Echofon</a>"},{"from_user_id_str":"2421643","profile_image_url":"http://a0.twimg.com/profile_images/1190361665/ernestgrumbles-17_normal.jpg","created_at":"Wed, 26 Jan 2011 03:20:24 +0000","from_user":"ernestgrumbles","id_str":"30102730756333568","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Wow... WolframAlpha did not know who Eddie Haskell is. Guess I'll never use that "knowledge engine" again.","id":30102730756333568,"from_user_id":2421643,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"128028225","profile_image_url":"http://a1.twimg.com/profile_images/1224994593/Coding_Drunk_normal.jpg","created_at":"Wed, 26 Jan 2011 03:14:21 +0000","from_user":"chewedwire","id_str":"30101204428132352","metadata":{"result_type":"recent"},"to_user_id":177539201,"text":"@tomheon How is Haskell better/different from CL or Scheme? I honestly don't know, although I'm becoming more curious.","id":30101204428132352,"from_user_id":128028225,"to_user":"tomheon","geo":null,"iso_language_code":"en","to_user_id_str":"177539201","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"13540930","profile_image_url":"http://a1.twimg.com/profile_images/1205312219/23467_350321383101_821143101_5114147_3010041_n_normal.jpg","created_at":"Wed, 26 Jan 2011 03:06:54 +0000","from_user":"goodfox","id_str":"30099329809129473","metadata":{"result_type":"recent"},"to_user_id":null,"text":"A day of vision & speeches. #SOTU now. And a wonderful Haskell Convocation address earlier today by Sinte Gleske President Lionel Bordeaux.","id":30099329809129473,"from_user_id":13540930,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.ubertwitter.com/bb/download.php" rel="nofollow">\u00dcberTwitter</a>"},{"from_user_id_str":"119185220","profile_image_url":"http://a0.twimg.com/profile_images/1089027228/dfg_normal.jpg","created_at":"Wed, 26 Jan 2011 03:03:38 +0000","from_user":"LaLiciouz_03","id_str":"30098510623805440","metadata":{"result_type":"recent"},"to_user_id":null,"text":"The Game with the girl room 330 Haskell follow us...","id":30098510623805440,"from_user_id":119185220,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"18616016","profile_image_url":"http://a2.twimg.com/profile_images/1173522726/214397343_normal.jpg","created_at":"Wed, 26 Jan 2011 02:57:25 +0000","from_user":"josej30","id_str":"30096946144215040","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Voy a extra\u00f1ar Haskell cuando regrese al mundo imperativo. Hay alg\u00fan lenguaje imperativo que tenga este poder funcional? #ci3661","id":30096946144215040,"from_user_id":18616016,"geo":null,"iso_language_code":"es","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"17671137","profile_image_url":"http://a2.twimg.com/profile_images/290264834/Haskell-logo-outer-glow_normal.png","created_at":"Wed, 26 Jan 2011 02:55:32 +0000","from_user":"Hackage","id_str":"30096471814574080","metadata":{"result_type":"recent"},"to_user_id":null,"text":"comonad-transformers 0.9.0, added by EdwardKmett: Haskell 98 comonad transformers http://bit.ly/h6xIsf","id":30096471814574080,"from_user_id":17671137,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"177539201","profile_image_url":"http://a0.twimg.com/profile_images/1178368800/img_normal.jpeg","created_at":"Wed, 26 Jan 2011 02:48:12 +0000","from_user":"tomheon","id_str":"30094626920603649","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Every time I look at Haskell I love it more.","id":30094626920603649,"from_user_id":177539201,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"60792568","profile_image_url":"http://a0.twimg.com/profile_images/1203647517/glenda-flash_normal.jpg","created_at":"Wed, 26 Jan 2011 02:40:42 +0000","from_user":"r_takaishi","id_str":"30092735935422464","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell\u3088\u308aD\u8a00\u8a9e\u304c\u4e0a\u3068\u306f\u601d\u308f\u306a\u304b\u3063\u305f\uff0e http://www.tiobe.com/index.php/content/paperinfo/tpci/index.html","id":30092735935422464,"from_user_id":60792568,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twmode.sf.net/" rel="nofollow">twmode</a>"},{"from_user_id_str":"160145510","profile_image_url":"http://a0.twimg.com/profile_images/1218108166/going_galt_normal.jpg","created_at":"Wed, 26 Jan 2011 02:39:31 +0000","from_user":"wtp1787","id_str":"30092439653974018","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @KLSouth: Eddie Haskell Goes to Washington... "You look really nice tonight, Ms Cleaver"","id":30092439653974018,"from_user_id":160145510,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"96616016","profile_image_url":"http://a1.twimg.com/profile_images/1196978169/Picture0002_normal.jpg","created_at":"Wed, 26 Jan 2011 02:39:20 +0000","from_user":"MelissaRNMBA","id_str":"30092392203816960","metadata":{"result_type":"recent"},"to_user_id":14862975,"text":"@KLSouth At least Eddie Haskell was entertaining.","id":30092392203816960,"from_user_id":96616016,"to_user":"KLSouth","geo":null,"iso_language_code":"en","to_user_id_str":"14862975","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"14862975","profile_image_url":"http://a0.twimg.com/profile_images/421596393/kls_4_normal.JPG","created_at":"Wed, 26 Jan 2011 02:38:29 +0000","from_user":"KLSouth","id_str":"30092178327871489","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Eddie Haskell Goes to Washington... "You look really nice tonight, Ms Cleaver"","id":30092178327871489,"from_user_id":14862975,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Wed, 26 Jan 2011 02:36:17 +0000","from_user":"listwarenet","id_str":"30091626869161984","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-beginners/84641-haskell-beginners-wildcards-in-expressions.html Haskell-beginners - Wild","id":30091626869161984,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://1e10.org/cloud/" rel="nofollow">1e10</a>"},{"from_user_id_str":"24538048","profile_image_url":"http://a2.twimg.com/profile_images/1117267605/rope_normal.jpg","created_at":"Wed, 26 Jan 2011 02:23:14 +0000","from_user":"dbph","id_str":"30088341030440960","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @dnene: Skilled Calisthenics. Haskell code that outputs python which spits ruby which emits the haskell source. http://j.mp/YlQUL via @mfeathers","id":30088341030440960,"from_user_id":24538048,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"158951567","profile_image_url":"http://a3.twimg.com/profile_images/962721419/Logo_3_normal.jpg","created_at":"Wed, 26 Jan 2011 01:58:31 +0000","from_user":"YubaVetTech","id_str":"30082124207886336","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Dr. Haskell has just been awarded the prestigious Hayward Award for \u2018Excellence in Education\u2019. This award honors... http://fb.me/QgQCxd74","id":30082124207886336,"from_user_id":158951567,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.facebook.com/twitter" rel="nofollow">Facebook</a>"},{"from_user_id_str":"158951567","profile_image_url":"http://a3.twimg.com/profile_images/962721419/Logo_3_normal.jpg","created_at":"Wed, 26 Jan 2011 01:56:04 +0000","from_user":"YubaVetTech","id_str":"30081505476743168","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Dr. Haskell has just been awarded the prestigous Haward Award for Excellence in Education. This award honors... http://fb.me/PC9mYmCR","id":30081505476743168,"from_user_id":158951567,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.facebook.com/twitter" rel="nofollow">Facebook</a>"},{"from_user_id_str":"2331498","profile_image_url":"http://a3.twimg.com/profile_images/494632120/me_normal.jpg","created_at":"Wed, 26 Jan 2011 01:43:50 +0000","from_user":"Verus","id_str":"30078427155406848","metadata":{"result_type":"recent"},"to_user_id":79273052,"text":"@kami_joe \u3044\u3084\uff0c\u8ab2\u984c\u306f\u89e3\u6c7a\u5bfe\u8c61(\u30d1\u30ba\u30eb\u3068\u304b)\u3092\u4e0e\u3048\u3089\u308c\u3066\uff0c\u554f\u984c\u5b9a\u7fa9\u3068\u30d7\u30ed\u30b0\u30e9\u30df\u30f3\u30b0(\u6307\u5b9a\u8a00\u8a9e\u306fC++\u3082\u3057\u304f\u306fJava)\u3068\u3044\u3046\u3044\u308f\u3070\u666e\u901a\u306a\u8ab2\u984c\u3067\u306f\u3042\u308b\u3093\u3060\u3051\u3069\uff0e\u95a2\u6570\u578b\u8a00\u8a9e\u306fHaskell\u306e\u6388\u696d\u304c\u307e\u305f\u5225\u306b\u3042\u308b\u306e\uff0e","id":30078427155406848,"from_user_id":2331498,"to_user":"kami_joe","geo":null,"iso_language_code":"ja","to_user_id_str":"79273052","source":"<a href="http://itunes.apple.com/us/app/twitter/id409789998?mt=12" rel="nofollow">Twitter for Mac</a>"},{"from_user_id_str":"79151233","profile_image_url":"http://a2.twimg.com/a/1295051201/images/default_profile_2_normal.png","created_at":"Wed, 26 Jan 2011 01:40:37 +0000","from_user":"cz_newdrafts","id_str":"30077617361125376","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell programming language http://bit.ly/gpPAwB","id":30077617361125376,"from_user_id":79151233,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://tommorris.org/" rel="nofollow">tommorris' hacksample</a>"},{"from_user_id_str":"2331498","profile_image_url":"http://a3.twimg.com/profile_images/494632120/me_normal.jpg","created_at":"Wed, 26 Jan 2011 01:02:57 +0000","from_user":"Verus","id_str":"30068139416879104","metadata":{"result_type":"recent"},"to_user_id":9252720,"text":"@shukukei Java\u3068C\u306f\u3042\u308b\u7a0b\u5ea6\u66f8\u3051\u3066\u3042\u305f\u308a\u307e\u3048\u306a\u3068\u3053\u308d\u304c\u3042\u308b\u304b\u3089\u306a\u30fc\uff0ePython\u306f\u500b\u4eba\u7684\u306b\u611f\u899a\u304c\u5408\u308f\u306a\u3044\uff0e\u611f\u899a\u306a\u306e\u3067\uff0c\u3082\u3046\u3069\u3046\u3057\u3088\u3046\u3082\u306a\u3044\uff57 \u3044\u307e\u306fScala\u3068Haskell\u3092\u3082\u3063\u3068\u6975\u3081\u305f\u3044\u3068\u3053\u308d\uff0e","id":30068139416879104,"from_user_id":2331498,"to_user":"shukukei","geo":null,"iso_language_code":"ja","to_user_id_str":"9252720","source":"<a href="http://itunes.apple.com/us/app/twitter/id409789998?mt=12" rel="nofollow">Twitter for Mac</a>"},{"from_user_id_str":"2781460","profile_image_url":"http://a0.twimg.com/profile_images/82526625/.joeyicon_normal.jpg","created_at":"Wed, 26 Jan 2011 01:02:35 +0000","from_user":"joeyhess","id_str":"30068046538219520","metadata":{"result_type":"recent"},"to_user_id":null,"text":"just figured out that I can use parameterized types to remove a dependency loop in git-annex's type definitions. whee #haskell","id":30068046538219520,"from_user_id":2781460,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://identi.ca" rel="nofollow">identica</a>"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Wed, 26 Jan 2011 00:54:22 +0000","from_user":"listwarenet","id_str":"30065977920061440","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-beginners/84466-haskell-beginners-bytestring-question.html Haskell-beginners - Bytestrin","id":30065977920061440,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://1e10.org/cloud/" rel="nofollow">1e10</a>"},{"from_user_id_str":"1291845","profile_image_url":"http://a0.twimg.com/profile_images/1225743404/ThinOxygen-small-opaque-solidarity_normal.png","created_at":"Wed, 26 Jan 2011 00:52:07 +0000","from_user":"_aaron_","id_str":"30065412242669568","metadata":{"result_type":"recent"},"to_user_id":null,"text":"wanted: librly licensed high level native compiled lang with min runtime (otherwise cobra/mono would be perfect) for win. lua? haskell? ooc?","id":30065412242669568,"from_user_id":1291845,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"5912444","profile_image_url":"http://a2.twimg.com/profile_images/546261026/ssf0xg11_normal.jpg","created_at":"Wed, 26 Jan 2011 00:45:45 +0000","from_user":"shelarcy","id_str":"30063810773516288","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @Hackage: download 0.3.1.1, added by MagnusTherning: High-level file download based on URLs http://bit.ly/eHfiJB","id":30063810773516288,"from_user_id":5912444,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"135993","profile_image_url":"http://a2.twimg.com/profile_images/1190667086/myface2010small_normal.jpg","created_at":"Wed, 26 Jan 2011 00:41:00 +0000","from_user":"kudzu_naoki","id_str":"30062613287141376","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @tanakh: \u9b54\u6cd5Haskell\u5c11\u5973\u5019\u88dc\u3092\u63a2\u3059\u306e\u3082\u5927\u5909\u306a\u3093\u3060","id":30062613287141376,"from_user_id":135993,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"52620546","profile_image_url":"http://a1.twimg.com/profile_images/434693356/twitter-icon_normal.png","created_at":"Wed, 26 Jan 2011 00:40:25 +0000","from_user":"omasanori","id_str":"30062465656033280","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u9b54\u6cd5Haskell\u5c11\u5973\u306e\u4e00\u65e5\u306fGHC HEAD\u306e\u30d3\u30eb\u30c9\u304b\u3089\u59cb\u307e\u308b","id":30062465656033280,"from_user_id":52620546,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.movatwi.jp" rel="nofollow">www.movatwi.jp</a>"},{"from_user_id_str":"52620546","profile_image_url":"http://a1.twimg.com/profile_images/434693356/twitter-icon_normal.png","created_at":"Wed, 26 Jan 2011 00:37:12 +0000","from_user":"omasanori","id_str":"30061656331526144","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @tanakh: \u50d5\u3068\u5951\u7d04\u3057\u3066\u9b54\u6cd5Haskell\u5c11\u5973\u306b\u306a\u308d\u3046\u3088\uff01","id":30061656331526144,"from_user_id":52620546,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"135993","profile_image_url":"http://a2.twimg.com/profile_images/1190667086/myface2010small_normal.jpg","created_at":"Wed, 26 Jan 2011 00:35:42 +0000","from_user":"kudzu_naoki","id_str":"30061282665168896","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @tanakh: \u50d5\u3068\u5951\u7d04\u3057\u3066\u9b54\u6cd5Haskell\u5c11\u5973\u306b\u306a\u308d\u3046\u3088\uff01","id":30061282665168896,"from_user_id":135993,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"1631333","profile_image_url":"http://a1.twimg.com/profile_images/81268862/profile300_normal.jpg","created_at":"Wed, 26 Jan 2011 00:30:02 +0000","from_user":"qnighy","id_str":"30059855884582913","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @tanakh: \u50d5\u3068\u5951\u7d04\u3057\u3066\u9b54\u6cd5Haskell\u5c11\u5973\u306b\u306a\u308d\u3046\u3088\uff01","id":30059855884582913,"from_user_id":1631333,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"9093754","profile_image_url":"http://a1.twimg.com/profile_images/99435906/PHD_3d_col_blk_normal.jpg","created_at":"Wed, 26 Jan 2011 00:26:20 +0000","from_user":"phdwine","id_str":"30058925516656640","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Last weekend of Tri Nations Tasting with PHD wines at Haskell Vineyards. Hope you didn't miss the Pinot Noir tasting last week !","id":30058925516656640,"from_user_id":9093754,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"2119923","profile_image_url":"http://a2.twimg.com/profile_images/1096701078/djayprofile_normal.jpg","created_at":"Wed, 26 Jan 2011 00:21:14 +0000","from_user":"djay75","id_str":"30057639543050240","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @dnene: Skilled Calisthenics. Haskell code that outputs python which spits ruby which emits the haskell source. http://j.mp/YlQUL via @mfeathers","id":30057639543050240,"from_user_id":2119923,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"134323731","profile_image_url":"http://a2.twimg.com/profile_images/1225818824/IMG00518-20110125-1547_normal.jpg","created_at":"Wed, 26 Jan 2011 00:19:30 +0000","from_user":"PrinceOfBrkeley","id_str":"30057205554216960","metadata":{"result_type":"recent"},"to_user_id":167093027,"text":"@PayThaPrince go to haskell.","id":30057205554216960,"from_user_id":134323731,"to_user":"PayThaPrince","geo":null,"iso_language_code":"en","to_user_id_str":"167093027","source":"<a href="http://blackberry.com/twitter" rel="nofollow">Twitter for BlackBerry\u00ae</a>"},{"from_user_id_str":"705857","profile_image_url":"http://a1.twimg.com/profile_images/429483912/ben_twitter_normal.jpg","created_at":"Wed, 26 Jan 2011 00:03:28 +0000","from_user":"bennadel","id_str":"30053166972141569","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Using #Homebrew to install Haskell - the last of the Seven Languages (in Seven Weeks) http://bit.ly/eA9Cv1 This has been some journey.","id":30053166972141569,"from_user_id":705857,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"251466","profile_image_url":"http://a2.twimg.com/profile_images/1194100934/pass_normal.jpg","created_at":"Wed, 26 Jan 2011 00:02:54 +0000","from_user":"simonszu","id_str":"30053025502466048","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Ouh yeah! Ich werde doch produktiv sein, diese Semesterferien. Ich werde funktional Programmieren lernen. #haskell, Baby.","id":30053025502466048,"from_user_id":251466,"geo":null,"iso_language_code":"de","to_user_id_str":null,"source":"<a href="http://www.echofon.com/" rel="nofollow">Echofon</a>"},{"from_user_id_str":"357786","profile_image_url":"http://a0.twimg.com/profile_images/612044841/FM_2010_normal.jpg","created_at":"Tue, 25 Jan 2011 23:59:13 +0000","from_user":"diligiant","id_str":"30052100973006848","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @paulrbrown: "...we only discovered a single bug after compilation." (http://t.co/K0wlEYz) #haskell","id":30052100973006848,"from_user_id":357786,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://itunes.apple.com/us/app/twitter/id409789998?mt=12" rel="nofollow">Twitter for Mac</a>"},{"from_user_id_str":"101597523","profile_image_url":"http://a1.twimg.com/profile_images/1206183256/2010-12-12-204902_normal.jpg","created_at":"Tue, 25 Jan 2011 23:54:46 +0000","from_user":"wlad_kent","id_str":"30050977964892160","metadata":{"result_type":"recent"},"to_user_id":86297184,"text":"@Nilson_Neto Isso eh bem basico. quando vc estiver estudando recurs\u00e3o em Haskell, ai vc vai ver oq eh papo de nerd - kkk - 1\u00ba periodo isso.","id":30050977964892160,"from_user_id":101597523,"to_user":"Nilson_Neto","geo":null,"iso_language_code":"pt","to_user_id_str":"86297184","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Tue, 25 Jan 2011 23:51:22 +0000","from_user":"listwarenet","id_str":"30050123383832577","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-cafe/84336-haskell-cafe-monomorphic-let-bindings-and-darcs.html Haskell-cafe - Monomorph","id":30050123383832577,"from_user_id":144546280,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://1e10.org/cloud/" rel="nofollow">1e10</a>"},{"from_user_id_str":"5776901","profile_image_url":"http://a0.twimg.com/profile_images/472682157/lucabw_normal.JPG","created_at":"Tue, 25 Jan 2011 23:48:40 +0000","from_user":"lsbardel","id_str":"30049446469312512","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Very interesting technology stack these guys use http://bit.ly/ghAjS7 #python #redis #haskell","id":30049446469312512,"from_user_id":5776901,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"3005901","profile_image_url":"http://a0.twimg.com/profile_images/278943006/Lone_Pine_Peak_-_Peter_200x200_normal.jpg","created_at":"Tue, 25 Jan 2011 23:45:48 +0000","from_user":"pmonks","id_str":"30048721110573056","metadata":{"result_type":"recent"},"to_user_id":203834278,"text":"@techielicous Haskell: http://bit.ly/gy3oFi ;-)","id":30048721110573056,"from_user_id":3005901,"to_user":"techielicous","geo":null,"iso_language_code":"en","to_user_id_str":"203834278","source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"162697074","profile_image_url":"http://a2.twimg.com/profile_images/826205838/ryan3_normal.jpg","created_at":"Tue, 25 Jan 2011 23:44:47 +0000","from_user":"TheRonaldMCD","id_str":"30048468781244416","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I'm at Aldi Food Market (4122 Gaston Ave, Haskell, Dallas) http://4sq.com/ekqRY7","id":30048468781244416,"from_user_id":162697074,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://foursquare.com" rel="nofollow">foursquare</a>"},{"from_user_id_str":"203834278","profile_image_url":"http://a0.twimg.com/profile_images/1223375080/me_normal.jpg","created_at":"Tue, 25 Jan 2011 23:44:04 +0000","from_user":"techielicous","id_str":"30048286589067264","metadata":{"result_type":"recent"},"to_user_id":3005901,"text":"@pmonks I was thinking Haskell or Scheme","id":30048286589067264,"from_user_id":203834278,"to_user":"pmonks","geo":null,"iso_language_code":"en","to_user_id_str":"3005901","source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"537690","profile_image_url":"http://a3.twimg.com/profile_images/45665122/nushiostamp_normal.jpg","created_at":"Tue, 25 Jan 2011 23:38:14 +0000","from_user":"nushio","id_str":"30046818658164737","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u305d\u3046\u3044\u3084\u5951\u7d04\u306b\u3088\u308b\u30d7\u30ed\u30b0\u30e9\u30df\u30f3\u30b0\u3068\u304b\u3042\u3063\u305f\u306a\u3002Haskell\u306a\u3093\u304b\u3088\u308a\u3042\u3063\u3061\u306e\u65b9\u304c\u9b54\u6cd5\u5c11\u5973\u547c\u3070\u308f\u308a\u306b\u3075\u3055\u308f\u3057\u3044\u3002","id":30046818658164737,"from_user_id":537690,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"181192","profile_image_url":"http://a2.twimg.com/profile_images/1089890701/q530888600_9828_normal.jpg","created_at":"Tue, 25 Jan 2011 23:38:03 +0000","from_user":"aodag","id_str":"30046772223016960","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @omasanori: \u300c\u3082\u3046\u4f55\u5e74\u3082Haskell\u306e\u3053\u3068\u3057\u304b\u8003\u3048\u3066\u306a\u304b\u3063\u305f\u304b\u3089\u306a\u3001\u30eb\u30fc\u30d7\u306e\u4f7f\u3044\u65b9\u5fd8\u308c\u3066\u305f\u300d","id":30046772223016960,"from_user_id":181192,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.movatwi.jp" rel="nofollow">www.movatwi.jp</a>"},{"from_user_id_str":"5886055","profile_image_url":"http://a3.twimg.com/profile_images/85531669/ichi_normal.jpg","created_at":"Tue, 25 Jan 2011 23:37:53 +0000","from_user":"kanaya","id_str":"30046729243983873","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u9e97\u3057\u3044\u3002\u201c@omasanori: \u300c\u3082\u3046\u4f55\u5e74\u3082Haskell\u306e\u3053\u3068\u3057\u304b\u8003\u3048\u3066\u306a\u304b\u3063\u305f\u304b\u3089\u306a\u3001\u30eb\u30fc\u30d7\u306e\u4f7f\u3044\u65b9\u5fd8\u308c\u3066\u305f\u300d\u201d","id":30046729243983873,"from_user_id":5886055,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://itunes.apple.com/app/twitter/id333903271?mt=8" rel="nofollow">Twitter for iPad</a>"},{"from_user_id_str":"52620546","profile_image_url":"http://a1.twimg.com/profile_images/434693356/twitter-icon_normal.png","created_at":"Tue, 25 Jan 2011 23:36:26 +0000","from_user":"omasanori","id_str":"30046367187476481","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u300c\u3082\u3046\u4f55\u5e74\u3082Haskell\u306e\u3053\u3068\u3057\u304b\u8003\u3048\u3066\u306a\u304b\u3063\u305f\u304b\u3089\u306a\u3001\u30eb\u30fc\u30d7\u306e\u4f7f\u3044\u65b9\u5fd8\u308c\u3066\u305f\u300d","id":30046367187476481,"from_user_id":52620546,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.movatwi.jp" rel="nofollow">www.movatwi.jp</a>"},{"from_user_id_str":"1659992","profile_image_url":"http://a1.twimg.com/profile_images/504488750/1_normal.jpg","created_at":"Tue, 25 Jan 2011 23:16:13 +0000","from_user":"finalfusion","id_str":"30041278544609280","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @necocen: Haskell\u306e\u30df\u30b5\u30ef\u3001\u3068\u3044\u3046\u3082\u306e\u3092\u8003\u3048\u3066\u307f\u3066\u3071\u3063\u3068\u3057\u306a\u3044","id":30041278544609280,"from_user_id":1659992,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"272513","profile_image_url":"http://a2.twimg.com/profile_images/320244078/Mike_Painting2_normal.png","created_at":"Tue, 25 Jan 2011 23:05:09 +0000","from_user":"mikehadlow","id_str":"30038492373319680","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Just written the same simple program in C#, F# and Haskell: 18, 12 and 9 LoC respectively. And I'm much better at C# than F# or Haskell.","id":30038492373319680,"from_user_id":272513,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"89393264","profile_image_url":"http://a0.twimg.com/profile_images/1169486472/020_portland_me_normal.jpg","created_at":"Tue, 25 Jan 2011 23:01:28 +0000","from_user":"newsportlandme","id_str":"30037564589084673","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Governor's Choice to Run Maine DOC Under Scrutiny - MPBN: State Rep. Anne Haskell, a Portland Democrat, says Mai... http://bit.ly/fO30gC","id":30037564589084673,"from_user_id":89393264,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"38138","profile_image_url":"http://a3.twimg.com/profile_images/1212565885/Screen_shot_2011-01-11_at_5.28.47_PM_normal.png","created_at":"Tue, 25 Jan 2011 22:59:55 +0000","from_user":"michaelneale","id_str":"30037174615281664","metadata":{"result_type":"recent"},"to_user_id":null,"text":"The haskell EvilMangler http://t.co/P2Tls7J","id":30037174615281664,"from_user_id":38138,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://itunes.apple.com/us/app/twitter/id409789998?mt=12" rel="nofollow">Twitter for Mac</a>"},{"from_user_id_str":"45692","profile_image_url":"http://a3.twimg.com/profile_images/1177741507/dogkarno_r_normal.jpg","created_at":"Tue, 25 Jan 2011 22:45:06 +0000","from_user":"karno","id_str":"30033448286552064","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell\u3063\u3066\u95a2\u6570\u306b\u30ab\u30ec\u30fc\u7c89\u3076\u3061\u8fbc\u3080\u3068\u304b\u306a\u3093\u3068\u304b","id":30033448286552064,"from_user_id":45692,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://yubitter.com/" rel="nofollow">yubitter</a>"},{"from_user_id_str":"27605","profile_image_url":"http://a2.twimg.com/profile_images/15826632/meron_normal.jpg","created_at":"Tue, 25 Jan 2011 22:44:23 +0000","from_user":"celeron1ghz","id_str":"30033268761956352","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @necocen: Haskell\u306e\u30df\u30b5\u30ef\u3001\u3068\u3044\u3046\u3082\u306e\u3092\u8003\u3048\u3066\u307f\u3066\u3071\u3063\u3068\u3057\u306a\u3044","id":30033268761956352,"from_user_id":27605,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"12901","profile_image_url":"http://a1.twimg.com/profile_images/56091349/haruhi_nagato-Y_normal.jpg","created_at":"Tue, 25 Jan 2011 22:43:30 +0000","from_user":"necocen","id_str":"30033044035346432","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u307e\u3042Haskell\u77e5\u3089\u3093\u3057\u306d","id":30033044035346432,"from_user_id":12901,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"12901","profile_image_url":"http://a1.twimg.com/profile_images/56091349/haruhi_nagato-Y_normal.jpg","created_at":"Tue, 25 Jan 2011 22:42:54 +0000","from_user":"necocen","id_str":"30032894856531968","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell\u306e\u30df\u30b5\u30ef\u3001\u3068\u3044\u3046\u3082\u306e\u3092\u8003\u3048\u3066\u307f\u3066\u3071\u3063\u3068\u3057\u306a\u3044","id":30032894856531968,"from_user_id":12901,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"10821270","profile_image_url":"http://a0.twimg.com/profile_images/1195474259/Salto_Marlon_normal.jpg","created_at":"Tue, 25 Jan 2011 22:35:09 +0000","from_user":"jjedMoriAnktah","id_str":"30030942106025984","metadata":{"result_type":"recent"},"to_user_id":null,"text":""A Haskell program that outputs a Python program that outputs a Ruby program that outputs the original Haskell program" http://is.gd/E6Julu","id":30030942106025984,"from_user_id":10821270,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"7554762","profile_image_url":"http://a0.twimg.com/profile_images/100515212/ajay-photo_normal.jpg","created_at":"Tue, 25 Jan 2011 22:34:30 +0000","from_user":"comatose_kid","id_str":"30030780205899776","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @bumptech: Bump Dev Blog - Why we use Haskell at Bump http://devblog.bu.mp/haskell-at-bump","id":30030780205899776,"from_user_id":7554762,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"148474705","profile_image_url":"http://a0.twimg.com/profile_images/1119234716/fur_hat_-_gilbeys_vodka_-_life_-_11-30-1962_normal.JPG","created_at":"Tue, 25 Jan 2011 22:29:19 +0000","from_user":"landmvintage","id_str":"30029476003840000","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @faerymoongodess: Magnificent Miriam Haskell Baroque Pearl Necklace by @MercyMadge http://etsy.me/hqRl51","id":30029476003840000,"from_user_id":148474705,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"37715508","profile_image_url":"http://a1.twimg.com/profile_images/1207891411/ballerina_normal.jpg","created_at":"Tue, 25 Jan 2011 22:24:52 +0000","from_user":"faerymoongodess","id_str":"30028356326002688","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Magnificent Miriam Haskell Baroque Pearl Necklace by @MercyMadge http://etsy.me/hqRl51","id":30028356326002688,"from_user_id":37715508,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"17671137","profile_image_url":"http://a2.twimg.com/profile_images/290264834/Haskell-logo-outer-glow_normal.png","created_at":"Tue, 25 Jan 2011 22:17:16 +0000","from_user":"Hackage","id_str":"30026442456694784","metadata":{"result_type":"recent"},"to_user_id":null,"text":"base16-bytestring 0.1.0.0, added by BryanOSullivan: Fast base16 (hex) encoding and deconding for ByteStrings http://bit.ly/eu75TN","id":30026442456694784,"from_user_id":17671137,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"199750997","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Tue, 25 Jan 2011 22:12:07 +0000","from_user":"benreads","id_str":"30025146991382528","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Writing Systems Software in a Functional Language -- brief, but fun. I want to see how well they can make Systems Haskell perform at scale.","id":30025146991382528,"from_user_id":199750997,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"35359797","profile_image_url":"http://a1.twimg.com/profile_images/1173453785/48893_521140819_1896062_q_normal.jpg","created_at":"Tue, 25 Jan 2011 22:09:45 +0000","from_user":"jcawthorne1","id_str":"30024549265309696","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Just saw Jeff Haskell give the middle finger!! Lol awesome","id":30024549265309696,"from_user_id":35359797,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"13540930","profile_image_url":"http://a1.twimg.com/profile_images/1205312219/23467_350321383101_821143101_5114147_3010041_n_normal.jpg","created_at":"Tue, 25 Jan 2011 22:06:44 +0000","from_user":"goodfox","id_str":"30023790381498369","metadata":{"result_type":"recent"},"to_user_id":null,"text":"At the Haskell Convocation. (@ Haskell Indian Nations U Auditorium) http://4sq.com/eKKXyn","id":30023790381498369,"from_user_id":13540930,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://foursquare.com" rel="nofollow">foursquare</a>"},{"from_user_id_str":"14674418","profile_image_url":"http://a2.twimg.com/profile_images/238230125/IMG_1030-1_normal.jpg","created_at":"Tue, 25 Jan 2011 22:02:31 +0000","from_user":"sanityinc","id_str":"30022731919523840","metadata":{"result_type":"recent"},"to_user_id":371289,"text":"@xshay Haskell's great, but Clojure's similarly lazy in all the ways that matter, and is more practical for day-to-day use.","id":30022731919523840,"from_user_id":14674418,"to_user":"xshay","geo":null,"iso_language_code":"en","to_user_id_str":"371289","source":"<a href="http://www.echofon.com/" rel="nofollow">Echofon</a>"},{"from_user_id_str":"371289","profile_image_url":"http://a2.twimg.com/profile_images/1113482439/me-brisbane_normal.jpg","created_at":"Tue, 25 Jan 2011 21:58:29 +0000","from_user":"xshay","id_str":"30021714444292096","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Just made a lazy sequence of prime numbers in haskell. I'm smitten.","id":30021714444292096,"from_user_id":371289,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://itunes.apple.com/us/app/twitter/id409789998?mt=12" rel="nofollow">Twitter for Mac</a>"},{"from_user_id_str":"199453873","profile_image_url":"http://a3.twimg.com/a/1294785484/images/default_profile_3_normal.png","created_at":"Tue, 25 Jan 2011 21:48:40 +0000","from_user":"stackfeed","id_str":"30019243982454784","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Practical Scala reference manual, for searching things like method names: Hello, \n\nInspired by\nHaskell API Searc... http://bit.ly/g4zWZQ","id":30019243982454784,"from_user_id":199453873,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"17489366","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Tue, 25 Jan 2011 21:45:32 +0000","from_user":"aapnoot","id_str":"30018455189065728","metadata":{"result_type":"recent"},"to_user_id":null,"text":"download 0.3.1, added by MagnusTherning: High-level file download based on URLs http://bit.ly/i8mYvi","id":30018455189065728,"from_user_id":17489366,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"17489366","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Tue, 25 Jan 2011 21:45:31 +0000","from_user":"aapnoot","id_str":"30018452601180160","metadata":{"result_type":"recent"},"to_user_id":null,"text":"download 0.3.1.1, added by MagnusTherning: High-level file download based on URLs http://bit.ly/eHfiJB","id":30018452601180160,"from_user_id":17489366,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"17671137","profile_image_url":"http://a2.twimg.com/profile_images/290264834/Haskell-logo-outer-glow_normal.png","created_at":"Tue, 25 Jan 2011 21:45:31 +0000","from_user":"Hackage","id_str":"30018451867176960","metadata":{"result_type":"recent"},"to_user_id":null,"text":"download 0.3.1, added by MagnusTherning: High-level file download based on URLs http://bit.ly/i8mYvi","id":30018451867176960,"from_user_id":17671137,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"138502705","profile_image_url":"http://a1.twimg.com/profile_images/1083845614/yclogo_normal.gif","created_at":"Tue, 25 Jan 2011 21:45:04 +0000","from_user":"newsyc100","id_str":"30018340839755777","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell improves log processing 4x over Python http://devblog.bu.mp/haskell-at-bump (http://bit.ly/gQxxR8)","id":30018340839755777,"from_user_id":138502705,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://news.ycombinator.com" rel="nofollow">newsyc</a>"},{"from_user_id_str":"1578246","profile_image_url":"http://a0.twimg.com/profile_images/59312315/avatar_simpson_small_normal.jpg","created_at":"Tue, 25 Jan 2011 21:43:32 +0000","from_user":"magthe","id_str":"30017953801969665","metadata":{"result_type":"recent"},"to_user_id":null,"text":"New version of download uploaded to #hackage #haskell","id":30017953801969665,"from_user_id":1578246,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://api.supertweet.net" rel="nofollow">MyAuth API Proxy</a>"},{"from_user_id_str":"135838970","profile_image_url":"http://a2.twimg.com/profile_images/1079929891/logo_normal.png","created_at":"Tue, 25 Jan 2011 21:37:51 +0000","from_user":"reward999","id_str":"30016525180084224","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Found Great Dane (Main & Haskell- Dallas): We found a great dane. 214-712-0000 http://bit.ly/fQ8iBw","id":30016525180084224,"from_user_id":135838970,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"137719265","profile_image_url":"http://a2.twimg.com/profile_images/1092224079/8__4__normal.jpg","created_at":"Tue, 25 Jan 2011 21:34:22 +0000","from_user":"WeiMatas","id_str":"30015646020411392","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Fourth day Rez party Eddie Haskell County in second life \u2013 which took place in cabaret Tadd","id":30015646020411392,"from_user_id":137719265,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://dlvr.it" rel="nofollow">dlvr.it</a>"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Tue, 25 Jan 2011 21:33:21 +0000","from_user":"listwarenet","id_str":"30015392571195392","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-cafe/83889-haskell-cafe-gpl-license-of-h-matrix-and-prelude-numeric.html Haskell-cafe -","id":30015392571195392,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://1e10.org/cloud/" rel="nofollow">1e10</a>"}],"max_id":30121530767708160,"since_id":0,"refresh_url":"?since_id=30121530767708160&q=haskell","next_page":"?page=2&max_id=30121530767708160&rpp=100&q=haskell","results_per_page":100,"page":1,"completed_in":1.195569,"since_id_str":"0","max_id_str":"30121530767708160","query":"haskell"}

benchmarks/json-data/twitter20.jsondeleted−1

@@ -1 +0,0 @@

1−{"results":[{"from_user_id_str":"166199691","profile_image_url":"http://a2.twimg.com/profile_images/1252958188/38_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:26 +0000","from_user":"_classicc","id_str":"41191052790603776","metadata":{"result_type":"recent"},"to_user_id":null,"text":"my twitter is actin slow today.","id":41191052790603776,"from_user_id":166199691,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"138835410","profile_image_url":"http://a1.twimg.com/profile_images/1250985094/243321801_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:26 +0000","from_user":"amereronday","id_str":"41191050307567616","metadata":{"result_type":"recent"},"to_user_id":null,"text":"twitter jail, here i come.","id":41191050307567616,"from_user_id":138835410,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"359548","profile_image_url":"http://a2.twimg.com/profile_images/53612334/don_otvos_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:26 +0000","from_user":"donnyo","id_str":"41191050110451712","metadata":{"result_type":"recent"},"to_user_id":7074534,"text":"@stlsmallbiz I see there is currently a Twitter promo too....tempting....","id":41191050110451712,"from_user_id":359548,"to_user":"stlsmallbiz","geo":null,"iso_language_code":"en","place":{"id":"82b7b2f97b12261d","type":"poi","full_name":"Yammer Inc, San Francisco"},"to_user_id_str":"7074534","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"122523770","profile_image_url":"http://a0.twimg.com/profile_images/1073533262/11646_1076222405045_1810798478_156114_3663737_n_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:26 +0000","from_user":"msBreChan","id_str":"41191049720238080","metadata":{"result_type":"recent"},"to_user_id":null,"text":"so twitter gt spam now -_-","id":41191049720238080,"from_user_id":122523770,"geo":{"type":"Point","coordinates":[35.2213,-80.8276]},"iso_language_code":"en","place":{"id":"4d5ed95f830e9b41","type":"neighborhood","full_name":"Elizabeth, Charlotte"},"to_user_id_str":null,"source":"<a href="http://mobile.twitter.com" rel="nofollow">Twitter for Android</a>"},{"from_user_id_str":"229024950","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_6_normal.png","created_at":"Fri, 25 Feb 2011 17:41:25 +0000","from_user":"NinaMaechik","id_str":"41191047853912064","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Glad I can remember my twitter password! LOL! Hugs to Nick from his aunties...","id":41191047853912064,"from_user_id":229024950,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"215545822","profile_image_url":"http://a2.twimg.com/profile_images/1239909540/RTL_normal.png","created_at":"Fri, 25 Feb 2011 17:41:25 +0000","from_user":"RightToLaugh","id_str":"41191047371558912","metadata":{"result_type":"recent"},"to_user_id":null,"text":"#Bacon wrapped dates http://bit.ly/hUxVC9 Just like my grandma used to make http://twitter.com/#","id":41191047371558912,"from_user_id":215545822,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"217845526","profile_image_url":"http://a0.twimg.com/sticky/default_profile_images/default_profile_3_normal.png","created_at":"Fri, 25 Feb 2011 17:41:25 +0000","from_user":"TheShoeLooker","id_str":"41191047052804096","metadata":{"result_type":"recent"},"to_user_id":38033240,"text":"@ShoeDazzle love love love to twitter or blog about your deals and shoes!\ntheshoelooker.blogspot.com","id":41191047052804096,"from_user_id":217845526,"to_user":"shoedazzle","geo":null,"iso_language_code":"en","to_user_id_str":"38033240","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"24953438","profile_image_url":"http://a3.twimg.com/profile_images/1181252763/76820_10150100014748783_677998782_7386695_4377006_n_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:25 +0000","from_user":"liljermaine32","id_str":"41191046025056256","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Twitter fam I gotta question 4 ya is texas south or midwest #arguments","id":41191046025056256,"from_user_id":24953438,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://mobile.twitter.com" rel="nofollow">Twitter for Android</a>"},{"from_user_id_str":"122451024","profile_image_url":"http://a2.twimg.com/profile_images/1143400129/100706-ETCanada_201134_1__normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:25 +0000","from_user":"Kim_DEon","id_str":"41191045161164801","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Help @CARE @EvaLongoria and ME use Twitter to change the lives of girls in poverty across the world! Ready? Go to http://TwitChange.com NOW!","id":41191045161164801,"from_user_id":122451024,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"128351479","profile_image_url":"http://a3.twimg.com/profile_images/1150198829/Kirby_Photo__edit__normal.JPG","created_at":"Fri, 25 Feb 2011 17:41:24 +0000","from_user":"TheDaveKirby","id_str":"41191043894493184","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Maybe its time to clean house...MY HOUSE http://bit.ly/ejG22P","id":41191043894493184,"from_user_id":128351479,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"87512773","profile_image_url":"http://a0.twimg.com/profile_images/1252511106/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:24 +0000","from_user":"supportthehood","id_str":"41191043206610946","metadata":{"result_type":"recent"},"to_user_id":2467330,"text":"@eastcoastmp3 #FF it's the way twitter works !!!","id":41191043206610946,"from_user_id":87512773,"to_user":"eastcoastmp3","geo":null,"iso_language_code":"en","to_user_id_str":"2467330","source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"149894545","profile_image_url":"http://a0.twimg.com/profile_images/1219334400/patrick_camo_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:24 +0000","from_user":"suburbpat","id_str":"41191040912330752","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I havent had a rib session on twitter in a while.......I wanna Rib with a nigga with alot followers lol","id":41191040912330752,"from_user_id":149894545,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"97749622","profile_image_url":"http://a0.twimg.com/profile_images/1254640781/IMG1633A_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:24 +0000","from_user":"jrricardosantos","id_str":"41191040547430400","metadata":{"result_type":"recent"},"to_user_id":101017476,"text":"@yofzs pq tirou o CAPS LOCK? kkkk tava bem legal...hehehe eu estou no t\u00e9dio...kkk tbm estou no twitter e msn..aff!!","id":41191040547430400,"from_user_id":97749622,"to_user":"yofzs","geo":null,"iso_language_code":"en","to_user_id_str":"101017476","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"94381536","profile_image_url":"http://a1.twimg.com/profile_images/1174777929/41509_100001699300415_3521888_n_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:23 +0000","from_user":"DonNieves","id_str":"41191038978752512","metadata":{"result_type":"recent"},"to_user_id":151926400,"text":"@TiiH13 cheira meu ovo, no email, no orkut, no msn, no facebook, no twitter, no skype, no spark, no ICQ e no google talk","id":41191038978752512,"from_user_id":94381536,"to_user":"TiiH13","geo":null,"iso_language_code":"en","to_user_id_str":"151926400","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"211858432","profile_image_url":"http://a3.twimg.com/profile_images/1231906180/JonasBrothers_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:23 +0000","from_user":"OriginalJBfans","id_str":"41191038328651776","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I literally forgot about this twitter... so whats occuring followers?","id":41191038328651776,"from_user_id":211858432,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"90317132","profile_image_url":"http://a3.twimg.com/profile_images/1230085056/254101635_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:23 +0000","from_user":"Just2smooth","id_str":"41191036936126464","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Wassup twitter","id":41191036936126464,"from_user_id":90317132,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://ubersocial.com" rel="nofollow">\u00dcberSocial</a>"},{"from_user_id_str":"144771504","profile_image_url":"http://a1.twimg.com/profile_images/1243343836/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:23 +0000","from_user":"ima_b_b_badman","id_str":"41191036638339072","metadata":{"result_type":"recent"},"to_user_id":null,"text":"i been M.I.A. all day twitter my bad","id":41191036638339072,"from_user_id":144771504,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"207922664","profile_image_url":"http://a2.twimg.com/profile_images/1237106108/258356167_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:22 +0000","from_user":"itsthecarter_","id_str":"41191036013391873","metadata":{"result_type":"recent"},"to_user_id":null,"text":"twitter is a stupid addiction.","id":41191036013391873,"from_user_id":207922664,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://ubersocial.com" rel="nofollow">\u00dcberSocial</a>"},{"from_user_id_str":"150000649","profile_image_url":"http://a0.twimg.com/profile_images/1237789059/belllaa_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:22 +0000","from_user":"angelicabrvo","id_str":"41191035707207680","metadata":{"result_type":"recent"},"to_user_id":null,"text":"que hubo twitter? huy que feoxd","id":41191035707207680,"from_user_id":150000649,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://blackberry.com/twitter" rel="nofollow">Twitter for BlackBerry\u00ae</a>"},{"from_user_id_str":"185713003","profile_image_url":"http://a2.twimg.com/profile_images/1191421540/163229_177015295661467_154687431227587_492170_2147500_n_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:22 +0000","from_user":"downbytheshores","id_str":"41191033945595905","metadata":{"result_type":"recent"},"to_user_id":null,"text":"follow us on twitter\nwww.twitter.com/downbytheshores http://fb.me/DhDS915e","id":41191033945595905,"from_user_id":185713003,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.facebook.com/twitter" rel="nofollow">Facebook</a>"}],"max_id":41191052790603776,"since_id":38643906774044672,"refresh_url":"?since_id=41191052790603776&q=twitter","next_page":"?page=2&max_id=41191052790603776&rpp=20&lang=en&q=twitter","results_per_page":20,"page":1,"completed_in":0.128719,"warning":"adjusted since_id to 38643906774044672 (), requested since_id was older than allowed -- since_id removed for pagination.","since_id_str":"38643906774044672","max_id_str":"41191052790603776","query":"twitter"}

benchmarks/json-data/twitter50.jsondeleted−1

@@ -1 +0,0 @@

1−{"results":[{"from_user_id_str":"207858021","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Wed, 26 Jan 2011 04:30:38 +0000","from_user":"pboudarga","id_str":"30120402839666689","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I'm at Rolla Sushi Grill (27737 Bouquet Canyon Road, #106, Btw Haskell Canyon and Rosedell Drive, Saugus) http://4sq.com/gqqdhs","id":30120402839666689,"from_user_id":207858021,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://foursquare.com" rel="nofollow">foursquare</a>"},{"from_user_id_str":"69988683","profile_image_url":"http://a0.twimg.com/profile_images/1211955817/avatar_7888_normal.gif","created_at":"Wed, 26 Jan 2011 04:25:23 +0000","from_user":"YNK33","id_str":"30119083059978240","metadata":{"result_type":"recent"},"to_user_id":null,"text":"hsndfile 0.5.0: Free and open source Haskell bindings for libsndfile http://bit.ly/gHaBWG Mac Os","id":30119083059978240,"from_user_id":69988683,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"81492","profile_image_url":"http://a1.twimg.com/profile_images/423894208/Picture_7_normal.jpg","created_at":"Wed, 26 Jan 2011 04:24:28 +0000","from_user":"satzz","id_str":"30118851488251904","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Emacs\u306e\u30e2\u30fc\u30c9\u8868\u793a\u304c\u4eca(Ruby Controller Outputz RoR Flymake REl hs)\u3068\u306a\u3063\u3066\u3066\u3088\u304f\u308f\u304b\u3089\u306a\u3044\u3093\u3060\u3051\u3069\u6700\u5f8c\u306eREl\u3068\u304bhs\u3063\u3066\u4f55\u3060\u308d\u3046\u2026haskell\u3068\u304b2\u5e74\u4ee5\u4e0a\u66f8\u3044\u3066\u306a\u3044\u3051\u3069\u2026","id":30118851488251904,"from_user_id":81492,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"9518356","profile_image_url":"http://a2.twimg.com/profile_images/119165723/ocaml-icon_normal.png","created_at":"Wed, 26 Jan 2011 04:19:19 +0000","from_user":"planet_ocaml","id_str":"30117557788741632","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I so miss #haskell type classes in #ocaml - i want to do something like refinement. Also why does ocaml not have... http://bit.ly/geYRwt","id":30117557788741632,"from_user_id":9518356,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"218059","profile_image_url":"http://a1.twimg.com/profile_images/1053837723/twitter-icon9_normal.jpg","created_at":"Wed, 26 Jan 2011 04:16:32 +0000","from_user":"aprikip","id_str":"30116854940835840","metadata":{"result_type":"recent"},"to_user_id":null,"text":"yatex-mode\u3084haskell-mode\u306e\u3053\u3068\u3067\u3059\u306d\u3001\u308f\u304b\u308a\u307e\u3059\u3002","id":30116854940835840,"from_user_id":218059,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sites.google.com/site/yorufukurou/" rel="nofollow">YoruFukurou</a>"},{"from_user_id_str":"216363","profile_image_url":"http://a1.twimg.com/profile_images/72454310/Tim-Avatar_normal.png","created_at":"Wed, 26 Jan 2011 04:15:30 +0000","from_user":"dysinger","id_str":"30116594684264448","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell in Hawaii tonight for me... #fun","id":30116594684264448,"from_user_id":216363,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.nambu.com/" rel="nofollow">Nambu</a>"},{"from_user_id_str":"1774820","profile_image_url":"http://a2.twimg.com/profile_images/61169291/dan_desert_thumb_normal.jpg","created_at":"Wed, 26 Jan 2011 04:13:36 +0000","from_user":"DanMil","id_str":"30116117682851840","metadata":{"result_type":"recent"},"to_user_id":1594784,"text":"@ojrac @chewedwire @tomheon Haskell isn't a language, it's a belief system. A seductive one...","id":30116117682851840,"from_user_id":1774820,"to_user":"ojrac","geo":null,"iso_language_code":"en","to_user_id_str":"1594784","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"659256","profile_image_url":"http://a0.twimg.com/profile_images/746976711/angular-final_normal.jpg","created_at":"Wed, 26 Jan 2011 04:11:06 +0000","from_user":"djspiewak","id_str":"30115488931520512","metadata":{"result_type":"recent"},"to_user_id":null,"text":"One of the very nice things about Haskell as opposed to SML is the reduced proliferation of identifiers (e.g. andb, orb, etc). #typeclasses","id":30115488931520512,"from_user_id":659256,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://itunes.apple.com/us/app/twitter/id409789998?mt=12" rel="nofollow">Twitter for Mac</a>"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Wed, 26 Jan 2011 04:06:12 +0000","from_user":"listwarenet","id_str":"30114255890026496","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-cafe/84752-re-haskell-cafe-gpl-license-of-h-matrix-and-prelude-numeric.html Re: Haskell-c","id":30114255890026496,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://1e10.org/cloud/" rel="nofollow">1e10</a>"},{"from_user_id_str":"1594784","profile_image_url":"http://a2.twimg.com/profile_images/378515773/square-profile_normal.jpg","created_at":"Wed, 26 Jan 2011 04:01:29 +0000","from_user":"ojrac","id_str":"30113067333324800","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @tomheon: @ojrac @chewedwire Don't worry, learning Haskell will not give you any clear idea what monad means.","id":30113067333324800,"from_user_id":1594784,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"207589736","profile_image_url":"http://a3.twimg.com/profile_images/1225527428/headshot_1_normal.jpg","created_at":"Wed, 26 Jan 2011 04:00:13 +0000","from_user":"ashleevelazq101","id_str":"30112747555397632","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Federal investigation finds safety violations at The Acadia Hospital: By Meg Haskell, BDN Staff The investigatio... http://bit.ly/dONnpn","id":30112747555397632,"from_user_id":207589736,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"17671137","profile_image_url":"http://a2.twimg.com/profile_images/290264834/Haskell-logo-outer-glow_normal.png","created_at":"Wed, 26 Jan 2011 03:58:00 +0000","from_user":"Hackage","id_str":"30112192346984448","metadata":{"result_type":"recent"},"to_user_id":null,"text":"streams 0.4, added by EdwardKmett: Various Haskell 2010 stream comonads http://bit.ly/idBkPe","id":30112192346984448,"from_user_id":17671137,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"17489366","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Wed, 26 Jan 2011 03:58:00 +0000","from_user":"aapnoot","id_str":"30112191881420800","metadata":{"result_type":"recent"},"to_user_id":null,"text":"streams 0.4, added by EdwardKmett: Various Haskell 2010 stream comonads http://bit.ly/idBkPe","id":30112191881420800,"from_user_id":17489366,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"8530482","profile_image_url":"http://a2.twimg.com/profile_images/137867266/n608671563_7396_normal.jpg","created_at":"Wed, 26 Jan 2011 03:50:12 +0000","from_user":"jeffmclamb","id_str":"30110229207187456","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Angel - daemon to run and monitor processes like daemontools or god, written in Haskell http://ff.im/-wNyLk","id":30110229207187456,"from_user_id":8530482,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://friendfeed.com" rel="nofollow">FriendFeed</a>"},{"from_user_id_str":"177539201","profile_image_url":"http://a0.twimg.com/profile_images/1178368800/img_normal.jpeg","created_at":"Wed, 26 Jan 2011 03:46:01 +0000","from_user":"tomheon","id_str":"30109174645919744","metadata":{"result_type":"recent"},"to_user_id":1594784,"text":"@ojrac @chewedwire Don't worry, learning Haskell will not give you any clear idea what monad means.","id":30109174645919744,"from_user_id":177539201,"to_user":"ojrac","geo":null,"iso_language_code":"en","to_user_id_str":"1594784","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"1594784","profile_image_url":"http://a2.twimg.com/profile_images/378515773/square-profile_normal.jpg","created_at":"Wed, 26 Jan 2011 03:44:34 +0000","from_user":"ojrac","id_str":"30108808684503040","metadata":{"result_type":"recent"},"to_user_id":128028225,"text":"@chewedwire @tomheon Why are you making me curious about Haskell? I LIKE not knowing what monad means!!","id":30108808684503040,"from_user_id":1594784,"to_user":"chewedwire","geo":null,"iso_language_code":"en","to_user_id_str":"128028225","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"23750094","profile_image_url":"http://a0.twimg.com/profile_images/951373780/Moeinthecar_normal.jpg","created_at":"Wed, 26 Jan 2011 03:41:54 +0000","from_user":"shokalshab","id_str":"30108140443795456","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I'm at Magnitude Cheer @ Gymnastics Olympica USA (7735 Haskell Ave., btw Saticoy & Strathern, Van Nuys) http://4sq.com/gmXfaL","id":30108140443795456,"from_user_id":23750094,"geo":null,"iso_language_code":"en","place":{"id":"4e4a2a2f86cb2946","type":"poi","full_name":"Gymnastics Olympica USA, Van Nuys"},"to_user_id_str":null,"source":"<a href="http://foursquare.com" rel="nofollow">foursquare</a>"},{"from_user_id_str":"8135112","profile_image_url":"http://a0.twimg.com/profile_images/1165240350/LIMITED_normal.jpg","created_at":"Wed, 26 Jan 2011 03:41:35 +0000","from_user":"Claricei","id_str":"30108059208515584","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @kristenmchugh22: @KeithOlbermann Ryan looks like Jughead w/o the hat. And sounds as mealy-mouthed as Eddie Haskell.","id":30108059208515584,"from_user_id":8135112,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"128028225","profile_image_url":"http://a1.twimg.com/profile_images/1224994593/Coding_Drunk_normal.jpg","created_at":"Wed, 26 Jan 2011 03:40:02 +0000","from_user":"chewedwire","id_str":"30107670367182848","metadata":{"result_type":"recent"},"to_user_id":177539201,"text":"@tomheon Cool, I'll take a look. I feel like I should mention this: http://bit.ly/hVstDM","id":30107670367182848,"from_user_id":128028225,"to_user":"tomheon","geo":null,"iso_language_code":"en","to_user_id_str":"177539201","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"8679778","profile_image_url":"http://a3.twimg.com/profile_images/1195318056/me_nyc_12_18_10_icon_normal.jpg","created_at":"Wed, 26 Jan 2011 03:38:42 +0000","from_user":"kristenmchugh22","id_str":"30107332381777920","metadata":{"result_type":"recent"},"to_user_id":756269,"text":"@KeithOlbermann Ryan looks like Jughead w/o the hat. And sounds as mealy-mouthed as Eddie Haskell.","id":30107332381777920,"from_user_id":8679778,"to_user":"KeithOlbermann","geo":null,"iso_language_code":"en","to_user_id_str":"756269","source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"103316559","profile_image_url":"http://a1.twimg.com/profile_images/1179458751/bc3beab4-d59d-4e78-b13b-50747986cfa2_normal.png","created_at":"Wed, 26 Jan 2011 03:36:15 +0000","from_user":"cityslikr","id_str":"30106719153557504","metadata":{"result_type":"recent"},"to_user_id":null,"text":""Social safety net into a hammock." So says Eddie Haskell with the GOP response. #SOTU","id":30106719153557504,"from_user_id":103316559,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://blackberry.com/twitter" rel="nofollow">Twitter for BlackBerry\u00ae</a>"},{"from_user_id_str":"169063143","profile_image_url":"http://a0.twimg.com/profile_images/1160506212/9697_1_normal.gif","created_at":"Wed, 26 Jan 2011 03:31:52 +0000","from_user":"wrkforce_safety","id_str":"30105614919143424","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Federal investigation finds safety violations at The Acadia Hospital: By Meg Haskell, BDN Staff The investigatio... http://bit.ly/gA60C1","id":30105614919143424,"from_user_id":169063143,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"177539201","profile_image_url":"http://a0.twimg.com/profile_images/1178368800/img_normal.jpeg","created_at":"Wed, 26 Jan 2011 03:29:40 +0000","from_user":"tomheon","id_str":"30105060960632832","metadata":{"result_type":"recent"},"to_user_id":128028225,"text":"@chewedwire Great book on Haskell: http://oreilly.com/catalog/9780596514983","id":30105060960632832,"from_user_id":177539201,"to_user":"chewedwire","geo":null,"iso_language_code":"en","to_user_id_str":"128028225","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"782692","profile_image_url":"http://a0.twimg.com/profile_images/1031304589/Profile.2007.1_normal.jpg","created_at":"Wed, 26 Jan 2011 03:29:19 +0000","from_user":"turnageb","id_str":"30104974591533057","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @ovillalon: Paul Ryan solves the mystery of whatever happened to Eddie Haskell. #sotu","id":30104974591533057,"from_user_id":782692,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"128028225","profile_image_url":"http://a1.twimg.com/profile_images/1224994593/Coding_Drunk_normal.jpg","created_at":"Wed, 26 Jan 2011 03:28:04 +0000","from_user":"chewedwire","id_str":"30104657267265536","metadata":{"result_type":"recent"},"to_user_id":177539201,"text":"@tomheon I always loved the pattern matching in SML and it looks like Haskell is MUCH better at it. I'm messing around now at tryhaskell.org","id":30104657267265536,"from_user_id":128028225,"to_user":"tomheon","geo":null,"iso_language_code":"en","to_user_id_str":"177539201","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"12834082","profile_image_url":"http://a3.twimg.com/profile_images/1083036140/mugshot_normal.png","created_at":"Wed, 26 Jan 2011 03:28:01 +0000","from_user":"ovillalon","id_str":"30104647213518848","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Paul Ryan solves the mystery of whatever happened to Eddie Haskell. #sotu","id":30104647213518848,"from_user_id":12834082,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"13540930","profile_image_url":"http://a1.twimg.com/profile_images/1205312219/23467_350321383101_821143101_5114147_3010041_n_normal.jpg","created_at":"Wed, 26 Jan 2011 03:26:02 +0000","from_user":"goodfox","id_str":"30104146455560192","metadata":{"result_type":"recent"},"to_user_id":10226179,"text":"@billykeene22 Bordeaux is one of my heroes. I was so excited when he accepted the invitation to campus. He's been a great friend to Haskell.","id":30104146455560192,"from_user_id":13540930,"to_user":"billykeene22","geo":null,"iso_language_code":"en","to_user_id_str":"10226179","source":"<a href="http://www.ubertwitter.com/bb/download.php" rel="nofollow">\u00dcberTwitter</a>"},{"from_user_id_str":"18616016","profile_image_url":"http://a2.twimg.com/profile_images/1173522726/214397343_normal.jpg","created_at":"Wed, 26 Jan 2011 03:25:18 +0000","from_user":"josej30","id_str":"30103962313031681","metadata":{"result_type":"recent"},"to_user_id":14870909,"text":"@cris7ian Ahh bueno multiparadigma ya es respetable :) Empezar\u00e9 a explotar la parte funcional de los lenguajes ahora #Haskell","id":30103962313031681,"from_user_id":18616016,"to_user":"Cris7ian","geo":null,"iso_language_code":"es","to_user_id_str":"14870909","source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"14870909","profile_image_url":"http://a2.twimg.com/profile_images/1176930429/oso_yo_normal.png","created_at":"Wed, 26 Jan 2011 03:23:43 +0000","from_user":"Cris7ian","id_str":"30103562360983553","metadata":{"result_type":"recent"},"to_user_id":18616016,"text":"@josej30 hahaha no, es multiparadigma y es bastante lazy. Nothing like haskell, pero s\u00ed, el de Flash","id":30103562360983553,"from_user_id":14870909,"to_user":"josej30","geo":null,"iso_language_code":"es","to_user_id_str":"18616016","source":"<a href="http://www.echofon.com/" rel="nofollow">Echofon</a>"},{"from_user_id_str":"2421643","profile_image_url":"http://a0.twimg.com/profile_images/1190361665/ernestgrumbles-17_normal.jpg","created_at":"Wed, 26 Jan 2011 03:20:24 +0000","from_user":"ernestgrumbles","id_str":"30102730756333568","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Wow... WolframAlpha did not know who Eddie Haskell is. Guess I'll never use that "knowledge engine" again.","id":30102730756333568,"from_user_id":2421643,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"128028225","profile_image_url":"http://a1.twimg.com/profile_images/1224994593/Coding_Drunk_normal.jpg","created_at":"Wed, 26 Jan 2011 03:14:21 +0000","from_user":"chewedwire","id_str":"30101204428132352","metadata":{"result_type":"recent"},"to_user_id":177539201,"text":"@tomheon How is Haskell better/different from CL or Scheme? I honestly don't know, although I'm becoming more curious.","id":30101204428132352,"from_user_id":128028225,"to_user":"tomheon","geo":null,"iso_language_code":"en","to_user_id_str":"177539201","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"13540930","profile_image_url":"http://a1.twimg.com/profile_images/1205312219/23467_350321383101_821143101_5114147_3010041_n_normal.jpg","created_at":"Wed, 26 Jan 2011 03:06:54 +0000","from_user":"goodfox","id_str":"30099329809129473","metadata":{"result_type":"recent"},"to_user_id":null,"text":"A day of vision & speeches. #SOTU now. And a wonderful Haskell Convocation address earlier today by Sinte Gleske President Lionel Bordeaux.","id":30099329809129473,"from_user_id":13540930,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.ubertwitter.com/bb/download.php" rel="nofollow">\u00dcberTwitter</a>"},{"from_user_id_str":"119185220","profile_image_url":"http://a0.twimg.com/profile_images/1089027228/dfg_normal.jpg","created_at":"Wed, 26 Jan 2011 03:03:38 +0000","from_user":"LaLiciouz_03","id_str":"30098510623805440","metadata":{"result_type":"recent"},"to_user_id":null,"text":"The Game with the girl room 330 Haskell follow us...","id":30098510623805440,"from_user_id":119185220,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"18616016","profile_image_url":"http://a2.twimg.com/profile_images/1173522726/214397343_normal.jpg","created_at":"Wed, 26 Jan 2011 02:57:25 +0000","from_user":"josej30","id_str":"30096946144215040","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Voy a extra\u00f1ar Haskell cuando regrese al mundo imperativo. Hay alg\u00fan lenguaje imperativo que tenga este poder funcional? #ci3661","id":30096946144215040,"from_user_id":18616016,"geo":null,"iso_language_code":"es","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"17671137","profile_image_url":"http://a2.twimg.com/profile_images/290264834/Haskell-logo-outer-glow_normal.png","created_at":"Wed, 26 Jan 2011 02:55:32 +0000","from_user":"Hackage","id_str":"30096471814574080","metadata":{"result_type":"recent"},"to_user_id":null,"text":"comonad-transformers 0.9.0, added by EdwardKmett: Haskell 98 comonad transformers http://bit.ly/h6xIsf","id":30096471814574080,"from_user_id":17671137,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"177539201","profile_image_url":"http://a0.twimg.com/profile_images/1178368800/img_normal.jpeg","created_at":"Wed, 26 Jan 2011 02:48:12 +0000","from_user":"tomheon","id_str":"30094626920603649","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Every time I look at Haskell I love it more.","id":30094626920603649,"from_user_id":177539201,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"60792568","profile_image_url":"http://a0.twimg.com/profile_images/1203647517/glenda-flash_normal.jpg","created_at":"Wed, 26 Jan 2011 02:40:42 +0000","from_user":"r_takaishi","id_str":"30092735935422464","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell\u3088\u308aD\u8a00\u8a9e\u304c\u4e0a\u3068\u306f\u601d\u308f\u306a\u304b\u3063\u305f\uff0e http://www.tiobe.com/index.php/content/paperinfo/tpci/index.html","id":30092735935422464,"from_user_id":60792568,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twmode.sf.net/" rel="nofollow">twmode</a>"},{"from_user_id_str":"160145510","profile_image_url":"http://a0.twimg.com/profile_images/1218108166/going_galt_normal.jpg","created_at":"Wed, 26 Jan 2011 02:39:31 +0000","from_user":"wtp1787","id_str":"30092439653974018","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @KLSouth: Eddie Haskell Goes to Washington... "You look really nice tonight, Ms Cleaver"","id":30092439653974018,"from_user_id":160145510,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"96616016","profile_image_url":"http://a1.twimg.com/profile_images/1196978169/Picture0002_normal.jpg","created_at":"Wed, 26 Jan 2011 02:39:20 +0000","from_user":"MelissaRNMBA","id_str":"30092392203816960","metadata":{"result_type":"recent"},"to_user_id":14862975,"text":"@KLSouth At least Eddie Haskell was entertaining.","id":30092392203816960,"from_user_id":96616016,"to_user":"KLSouth","geo":null,"iso_language_code":"en","to_user_id_str":"14862975","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"14862975","profile_image_url":"http://a0.twimg.com/profile_images/421596393/kls_4_normal.JPG","created_at":"Wed, 26 Jan 2011 02:38:29 +0000","from_user":"KLSouth","id_str":"30092178327871489","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Eddie Haskell Goes to Washington... "You look really nice tonight, Ms Cleaver"","id":30092178327871489,"from_user_id":14862975,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Wed, 26 Jan 2011 02:36:17 +0000","from_user":"listwarenet","id_str":"30091626869161984","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-beginners/84641-haskell-beginners-wildcards-in-expressions.html Haskell-beginners - Wild","id":30091626869161984,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://1e10.org/cloud/" rel="nofollow">1e10</a>"},{"from_user_id_str":"24538048","profile_image_url":"http://a2.twimg.com/profile_images/1117267605/rope_normal.jpg","created_at":"Wed, 26 Jan 2011 02:23:14 +0000","from_user":"dbph","id_str":"30088341030440960","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @dnene: Skilled Calisthenics. Haskell code that outputs python which spits ruby which emits the haskell source. http://j.mp/YlQUL via @mfeathers","id":30088341030440960,"from_user_id":24538048,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"158951567","profile_image_url":"http://a3.twimg.com/profile_images/962721419/Logo_3_normal.jpg","created_at":"Wed, 26 Jan 2011 01:58:31 +0000","from_user":"YubaVetTech","id_str":"30082124207886336","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Dr. Haskell has just been awarded the prestigious Hayward Award for \u2018Excellence in Education\u2019. This award honors... http://fb.me/QgQCxd74","id":30082124207886336,"from_user_id":158951567,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.facebook.com/twitter" rel="nofollow">Facebook</a>"},{"from_user_id_str":"158951567","profile_image_url":"http://a3.twimg.com/profile_images/962721419/Logo_3_normal.jpg","created_at":"Wed, 26 Jan 2011 01:56:04 +0000","from_user":"YubaVetTech","id_str":"30081505476743168","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Dr. Haskell has just been awarded the prestigous Haward Award for Excellence in Education. This award honors... http://fb.me/PC9mYmCR","id":30081505476743168,"from_user_id":158951567,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.facebook.com/twitter" rel="nofollow">Facebook</a>"},{"from_user_id_str":"2331498","profile_image_url":"http://a3.twimg.com/profile_images/494632120/me_normal.jpg","created_at":"Wed, 26 Jan 2011 01:43:50 +0000","from_user":"Verus","id_str":"30078427155406848","metadata":{"result_type":"recent"},"to_user_id":79273052,"text":"@kami_joe \u3044\u3084\uff0c\u8ab2\u984c\u306f\u89e3\u6c7a\u5bfe\u8c61(\u30d1\u30ba\u30eb\u3068\u304b)\u3092\u4e0e\u3048\u3089\u308c\u3066\uff0c\u554f\u984c\u5b9a\u7fa9\u3068\u30d7\u30ed\u30b0\u30e9\u30df\u30f3\u30b0(\u6307\u5b9a\u8a00\u8a9e\u306fC++\u3082\u3057\u304f\u306fJava)\u3068\u3044\u3046\u3044\u308f\u3070\u666e\u901a\u306a\u8ab2\u984c\u3067\u306f\u3042\u308b\u3093\u3060\u3051\u3069\uff0e\u95a2\u6570\u578b\u8a00\u8a9e\u306fHaskell\u306e\u6388\u696d\u304c\u307e\u305f\u5225\u306b\u3042\u308b\u306e\uff0e","id":30078427155406848,"from_user_id":2331498,"to_user":"kami_joe","geo":null,"iso_language_code":"ja","to_user_id_str":"79273052","source":"<a href="http://itunes.apple.com/us/app/twitter/id409789998?mt=12" rel="nofollow">Twitter for Mac</a>"},{"from_user_id_str":"79151233","profile_image_url":"http://a2.twimg.com/a/1295051201/images/default_profile_2_normal.png","created_at":"Wed, 26 Jan 2011 01:40:37 +0000","from_user":"cz_newdrafts","id_str":"30077617361125376","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell programming language http://bit.ly/gpPAwB","id":30077617361125376,"from_user_id":79151233,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://tommorris.org/" rel="nofollow">tommorris' hacksample</a>"},{"from_user_id_str":"2331498","profile_image_url":"http://a3.twimg.com/profile_images/494632120/me_normal.jpg","created_at":"Wed, 26 Jan 2011 01:02:57 +0000","from_user":"Verus","id_str":"30068139416879104","metadata":{"result_type":"recent"},"to_user_id":9252720,"text":"@shukukei Java\u3068C\u306f\u3042\u308b\u7a0b\u5ea6\u66f8\u3051\u3066\u3042\u305f\u308a\u307e\u3048\u306a\u3068\u3053\u308d\u304c\u3042\u308b\u304b\u3089\u306a\u30fc\uff0ePython\u306f\u500b\u4eba\u7684\u306b\u611f\u899a\u304c\u5408\u308f\u306a\u3044\uff0e\u611f\u899a\u306a\u306e\u3067\uff0c\u3082\u3046\u3069\u3046\u3057\u3088\u3046\u3082\u306a\u3044\uff57 \u3044\u307e\u306fScala\u3068Haskell\u3092\u3082\u3063\u3068\u6975\u3081\u305f\u3044\u3068\u3053\u308d\uff0e","id":30068139416879104,"from_user_id":2331498,"to_user":"shukukei","geo":null,"iso_language_code":"ja","to_user_id_str":"9252720","source":"<a href="http://itunes.apple.com/us/app/twitter/id409789998?mt=12" rel="nofollow">Twitter for Mac</a>"},{"from_user_id_str":"2781460","profile_image_url":"http://a0.twimg.com/profile_images/82526625/.joeyicon_normal.jpg","created_at":"Wed, 26 Jan 2011 01:02:35 +0000","from_user":"joeyhess","id_str":"30068046538219520","metadata":{"result_type":"recent"},"to_user_id":null,"text":"just figured out that I can use parameterized types to remove a dependency loop in git-annex's type definitions. whee #haskell","id":30068046538219520,"from_user_id":2781460,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://identi.ca" rel="nofollow">identica</a>"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Wed, 26 Jan 2011 00:54:22 +0000","from_user":"listwarenet","id_str":"30065977920061440","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-beginners/84466-haskell-beginners-bytestring-question.html Haskell-beginners - Bytestrin","id":30065977920061440,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://1e10.org/cloud/" rel="nofollow">1e10</a>"},{"from_user_id_str":"1291845","profile_image_url":"http://a0.twimg.com/profile_images/1225743404/ThinOxygen-small-opaque-solidarity_normal.png","created_at":"Wed, 26 Jan 2011 00:52:07 +0000","from_user":"_aaron_","id_str":"30065412242669568","metadata":{"result_type":"recent"},"to_user_id":null,"text":"wanted: librly licensed high level native compiled lang with min runtime (otherwise cobra/mono would be perfect) for win. lua? haskell? ooc?","id":30065412242669568,"from_user_id":1291845,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"}],"max_id":30120402839666689,"since_id":0,"refresh_url":"?since_id=30120402839666689&q=haskell","next_page":"?page=2&max_id=30120402839666689&rpp=50&q=haskell","results_per_page":50,"page":1,"completed_in":0.291696,"since_id_str":"0","max_id_str":"30120402839666689","query":"haskell"}

benchmarks/warp-3.0.1.1/LICENSEdeleted−20

@@ -1,20 +0,0 @@

2−

3−Permission is hereby granted, free of charge, to any person obtaining

4−a copy of this software and associated documentation files (the

5−"Software"), to deal in the Software without restriction, including

6−without limitation the rights to use, copy, modify, merge, publish,

7−distribute, sublicense, and/or sell copies of the Software, and to

8−permit persons to whom the Software is furnished to do so, subject to

9−the following conditions:

10−

11−The above copyright notice and this permission notice shall be

12−included in all copies or substantial portions of the Software.

13−

14−THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,

15−EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF

16−MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND

17−NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE

18−LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION

19−OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION

20−WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.

benchmarks/warp-3.0.1.1/Network/Wai/Handler/Warp/ReadInt.hsdeleted−67

@@ -1,67 +0,0 @@

1−{-# LANGUAGE OverloadedStrings #-}

2−{-# LANGUAGE MagicHash #-}

3−{-# LANGUAGE BangPatterns #-}

4−

5−-- Copyright : Erik de Castro Lopo <erikd@mega-nerd.com>

6−-- License : BSD3

7−

8−module Network.Wai.Handler.Warp.ReadInt (

9− readInt

10− , readInt64

11− ) where

12−

13−-- This function lives in its own file because the MagicHash pragma interacts

14−-- poorly with the CPP pragma.

15−

16−import Data.ByteString (ByteString)

17−import qualified Data.ByteString as S

18−import Data.Int (Int64)

19−import GHC.Prim

20−import GHC.Types

21−import GHC.Word

22−

23−{-# INLINE readInt #-}

24−readInt :: Integral a => ByteString -> a

25−readInt bs = fromIntegral $ readInt64 bs

26−

27−-- This function is used to parse the Content-Length field of HTTP headers and

28−-- is a performance hot spot. It should only be replaced with something

29−-- significantly and provably faster.

30−--

31−-- It needs to be able work correctly on 32 bit CPUs for file sizes > 2G so we

32−-- use Int64 here and then make a generic 'readInt' that allows conversion to

33−-- Int and Integer.

34−

35−{-# NOINLINE readInt64 #-}

36−readInt64 :: ByteString -> Int64

37−readInt64 bs = S.foldl' (\ !i !c -> i * 10 + fromIntegral (mhDigitToInt c)) 0

38− $ S.takeWhile isDigit bs

39−

40−data Table = Table !Addr#

41−

42−{-# NOINLINE mhDigitToInt #-}

43−mhDigitToInt :: Word8 -> Int

44−mhDigitToInt (W8# i) = I# (word2Int# (indexWord8OffAddr# addr (word2Int# i)))

45− where

46− !(Table addr) = table

47− table :: Table

48− table = Table

49− "\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\

50− \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\

51− \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\

52− \\x00\x01\x02\x03\x04\x05\x06\x07\x08\x09\x00\x00\x00\x00\x00\x00\

53− \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\

54− \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\

55− \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\

56− \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\

57− \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\

58− \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\

59− \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\

60− \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\

61− \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\

62− \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\

63− \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\

64− \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00"#

65−

66−isDigit :: Word8 -> Bool

67−isDigit w = w >= 48 && w <= 57

benchmarks/warp-3.0.1.1/Network/Wai/Handler/Warp/RequestHeader.hsdeleted−172

@@ -1,172 +0,0 @@

1−{-# LANGUAGE DeriveDataTypeable #-}

2−{-# LANGUAGE OverloadedStrings #-}

3−{-# LANGUAGE BangPatterns #-}

4−

5−module Network.Wai.Handler.Warp.RequestHeader (

6− parseHeaderLines

7− , parseByteRanges

8− ) where

9−

10−import Control.Exception (Exception, throwIO)

11−import Control.Monad (when)

12−import Data.Typeable (Typeable)

13−import qualified Data.ByteString as S

14−import qualified Data.ByteString.Char8 as B (unpack, readInteger)

15−import Data.ByteString.Internal (ByteString(..), memchr)

16−import qualified Data.CaseInsensitive as CI

17−import Data.Word (Word8)

18−import Foreign.ForeignPtr (withForeignPtr)

19−import Foreign.Ptr (Ptr, plusPtr, minusPtr, nullPtr)

20−import Foreign.Storable (peek)

21−import qualified Network.HTTP.Types as H

22−-- import Network.Wai.Handler.Warp.Types

23−import qualified Network.HTTP.Types.Header as HH

24−-- $setup

25−-- >>> :set -XOverloadedStrings

26−

27−data InvalidRequest = NotEnoughLines [String]

28− | BadFirstLine String

29− | NonHttp

30− | IncompleteHeaders

31− | ConnectionClosedByPeer

32− | OverLargeHeader

33− deriving (Eq, Typeable, Show)

34−

35−instance Exception InvalidRequest

36−

37−----------------------------------------------------------------

38−

39−parseHeaderLines :: [ByteString]

40− -> IO (H.Method

41− ,ByteString -- Path

42− ,ByteString -- Path, parsed

43− ,ByteString -- Query

44− ,H.HttpVersion

45− ,H.RequestHeaders

46− )

47−parseHeaderLines [] = throwIO $ NotEnoughLines []

48−parseHeaderLines (firstLine:otherLines) = do

49− (method, path', query, httpversion) <- parseRequestLine firstLine

50− let path = H.extractPath path'

51− hdr = map parseHeader otherLines

52− return (method, path', path, query, httpversion, hdr)

53−

54−----------------------------------------------------------------

55−

56−-- |

57−--

58−-- >>> parseRequestLine "GET / HTTP/1.1"

59−-- ("GET","/","",HTTP/1.1)

60−-- >>> parseRequestLine "POST /cgi/search.cgi?key=foo HTTP/1.0"

61−-- ("POST","/cgi/search.cgi","?key=foo",HTTP/1.0)

62−-- >>> parseRequestLine "GET "

63−-- *** Exception: Warp: Invalid first line of request: "GET "

64−-- >>> parseRequestLine "GET /NotHTTP UNKNOWN/1.1"

65−-- *** Exception: Warp: Request line specified a non-HTTP request

66−parseRequestLine :: ByteString

67− -> IO (H.Method

68− ,ByteString -- Path

69− ,ByteString -- Query

70− ,H.HttpVersion)

71−parseRequestLine requestLine@(PS fptr off len) = withForeignPtr fptr $ \ptr -> do

72− when (len < 14) $ throwIO baderr

73− let methodptr = ptr `plusPtr` off

74− limptr = methodptr `plusPtr` len

75− lim0 = fromIntegral len

76−

77− pathptr0 <- memchr methodptr 32 lim0 -- ' '

78− when (pathptr0 == nullPtr || (limptr `minusPtr` pathptr0) < 11) $

79− throwIO baderr

80− let pathptr = pathptr0 `plusPtr` 1

81− lim1 = fromIntegral (limptr `minusPtr` pathptr0)

82−

83− httpptr0 <- memchr pathptr 32 lim1 -- ' '

84− when (httpptr0 == nullPtr || (limptr `minusPtr` httpptr0) < 9) $

85− throwIO baderr

86− let httpptr = httpptr0 `plusPtr` 1

87− lim2 = fromIntegral (httpptr0 `minusPtr` pathptr)

88−

89− checkHTTP httpptr

90− !hv <- httpVersion httpptr

91− queryptr <- memchr pathptr 63 lim2 -- '?'

92−

93− let !method = bs ptr methodptr pathptr0

94− !path

95− | queryptr == nullPtr = bs ptr pathptr httpptr0

96− | otherwise = bs ptr pathptr queryptr

97− !query

98− | queryptr == nullPtr = S.empty

99− | otherwise = bs ptr queryptr httpptr0

100−

101− return (method,path,query,hv)

102− where

103− baderr = BadFirstLine $ B.unpack requestLine

104− check :: Ptr Word8 -> Int -> Word8 -> IO ()

105− check p n w = do

106− w0 <- peek $ p `plusPtr` n

107− when (w0 /= w) $ throwIO NonHttp

108− checkHTTP httpptr = do

109− check httpptr 0 72 -- 'H'

110− check httpptr 1 84 -- 'T'

111− check httpptr 2 84 -- 'T'

112− check httpptr 3 80 -- 'P'

113− check httpptr 4 47 -- '/'

114− check httpptr 6 46 -- '.'

115− httpVersion httpptr = do

116− major <- peek $ httpptr `plusPtr` 5

117− minor <- peek $ httpptr `plusPtr` 7

118− return $ if major == (49 :: Word8) && minor == (49 :: Word8) then

119− H.http11

120− else

121− H.http10

122− bs ptr p0 p1 = PS fptr o l

123− where

124− o = p0 `minusPtr` ptr

125− l = p1 `minusPtr` p0

126−

127−----------------------------------------------------------------

128−

129−-- |

130−--

131−-- >>> parseHeader "Content-Length:47"

132−-- ("Content-Length","47")

133−-- >>> parseHeader "Accept-Ranges: bytes"

134−-- ("Accept-Ranges","bytes")

135−-- >>> parseHeader "Host: example.com:8080"

136−-- ("Host","example.com:8080")

137−-- >>> parseHeader "NoSemiColon"

138−-- ("NoSemiColon","")

139−

140−parseHeader :: ByteString -> H.Header

141−parseHeader s =

142− let (k, rest) = S.break (== 58) s -- ':'

143− rest' = S.dropWhile (\c -> c == 32 || c == 9) $ S.drop 1 rest

144− in (CI.mk k, rest')

145−

146−parseByteRanges :: S.ByteString -> Maybe HH.ByteRanges

147−parseByteRanges bs1 = do

148− bs2 <- stripPrefix "bytes=" bs1

149− (r, bs3) <- range bs2

150− ranges (r:) bs3

151− where

152− range bs2 =

153− case stripPrefix "-" bs2 of

154− Just bs3 -> do

155− (i, bs4) <- B.readInteger bs3

156− Just (HH.ByteRangeSuffix i, bs4)

157− Nothing -> do

158− (i, bs3) <- B.readInteger bs2

159− bs4 <- stripPrefix "-" bs3

160− case B.readInteger bs4 of

161− Nothing -> Just (HH.ByteRangeFrom i, bs4)

162− Just (j, bs5) -> Just (HH.ByteRangeFromTo i j, bs5)

163− ranges front bs3 =

164− case stripPrefix "," bs3 of

165− Nothing -> Just (front [])

166− Just bs4 -> do

167− (r, bs5) <- range bs4

168− ranges (front . (r:)) bs5

169−

170− stripPrefix x y

171− | x `S.isPrefixOf` y = Just (S.drop (S.length x) y)

172− | otherwise = Nothing

changelog.mddeleted−114

@@ -1,114 +0,0 @@

1−0.13.2.1

2−

3−* Improved performance of `Data.Attoparsec.Text.asciiCI`

4−

5−0.13.2.0

6−

7−* `pure` is now strict in `Position`

8−

9−0.13.1.0

10−

11−* `runScanner` now correctly returns the final state

12− (https://github.com/bos/attoparsec/issues/105).

13−* `Parser`, `ZeptoT`, `Buffer`, and `More` now expose `Semigroup` instances.

14−* `Parser`, and `ZeptoT` now expose `MonadFail` instances.

15−

16−0.13.0.2

17−

18−* Restore the fast specialised character set implementation for Text

19−* Move testsuite from test-framework to tasty

20−* Performance optimization of takeWhile and takeWhile1

21−

22−0.13.0.1

23−

24−* Fixed a bug in the implementations of inClass and notInClass for

25− Text (https://github.com/bos/attoparsec/issues/103)

26−

27−0.13.0.0

28−

29−* Made the parser type in the Zepto module a monad transformer

30− (needed by aeson's string unescaping parser).

31−

32−0.12.1.6

33−

34−* Fixed a case folding bug in the ByteString version of stringCI.

35−

36−0.12.1.5

37−

38−* Fixed an indexing bug in the new Text implementation of string,

39− reported by Michel Boucey.

40−

41−0.12.1.4

42−

43−* Fixed a case where the string parser would consume an unnecessary

44− amount of input before failing a match, when it could bail much

45− earlier (https://github.com/bos/attoparsec/issues/97)

46−

47−* Added more context to error messages

48− (https://github.com/bos/attoparsec/pull/79)

49−

50−0.12.1.3

51−

52−* Fixed incorrect tracking of Text lengths

53− (https://github.com/bos/attoparsec/issues/80)

54−

55−0.12.1.2

56−

57−* Fixed the incorrect tracking of capacity if the initial buffer was

58− empty (https://github.com/bos/attoparsec/issues/75)

59−

60−0.12.1.1

61−

62−* Fixed a data corruption bug that occurred under some circumstances

63− if a buffer grew after prompting for more input

64− (https://github.com/bos/attoparsec/issues/74)

65−

66−0.12.1.0

67−

68−* Now compatible with GHC 7.9

69−

70−* Reintroduced the Chunk class, used by the parsers package

71−

72−0.12.0.0

73−

74−* A new internal representation makes almost all real-world parsers

75− faster, sometimes by big margins. For example, parsing JSON data

76− with aeson is now up to 70% faster. These performance improvements

77− also come with reduced memory consumption and some new capabilities.

78−

79−* The new match combinator gives both the result of a parse and the

80− input that it matched.

81−

82−* The test suite has doubled in size. This made it possible to switch

83− to the new internal representation with a decent degree of

84− confidence that everything was more or less working.

85−

86−* The benchmark suite now contains a small family of benchmarks taken

87− from real-world uses of attoparsec.

88−

89−* A few types that ought to have been private now are.

90−

91−* A few obsolete modules and functions have been marked as deprecated.

92− They will be removed from the next major release.

93−

94−0.11.3.0

95−

96−* New function scientific is compatible with rational, but parses

97− integers more efficiently (https://github.com/bos/aeson/issues/198)

98−

99−0.11.2.0

100−

101−* The new Chunk typeclass allows for some code sharing with Ed

102− Kmett's parsers package: http://hackage.haskell.org/package/parsers

103−

104−* New function runScanner generalises scan to return the final state

105− of the scanner as well as the input consumed.

106−

107−

108−0.11.1.0

109−

110−* New dependency: the scientific package. This allows us to parse

111− numbers much more efficiently.

112−

113−* peekWord8', peekChar': new primitive parsers that allow

114− single-character lookahead.

examples/Makefile+2−6

@@ -1,4 +1,4 @@

1−CC := cc

1+CC := gcc

2CFLAGS := -O3 -Wall

3# To make the code about 6% faster:

4# CFLAGS += -fwhole-program --combine

@@ -12,8 +12,4 @@ c-http: rfc2616.c http_parser.c

12clean:

13 rm -f *.hi *.o c-http

14

15−http_parser.c: http_parser.h

15+vpath %.c $(HOME)/hg/http-parser

16− curl -O https://raw.githubusercontent.com/joyent/http-parser/master/http_parser.c

17−

18−http_parser.h:

19− curl -O https://raw.githubusercontent.com/joyent/http-parser/master/http_parser.h

examples/Parsec_RFC2616.hs+6−9

@@ -23,16 +23,15 @@ token :: Stream s m Char => ParsecT s u m Char

23token = satisfy $ \c -> S.notMember (fromEnum c) set

24 where set = S.fromList . map fromEnum $ ['\0'..'\31'] ++ "()<>@,;:\\\"/[]?={} \t" ++ ['\128'..'\255']

25

26−isHorizontalSpace :: Char -> Bool

27isHorizontalSpace c = c == ' ' || c == '\t'

26isHorizontalSpace c = c == ' ' || c == '\t'

28

27

29skipHSpaces :: Stream s m Char => ParsecT s u m ()

28skipHSpaces :: Stream s m Char => ParsecT s u m ()

30skipHSpaces = skipMany1 (satisfy isHorizontalSpace)

29skipHSpaces = skipMany1 (satisfy isHorizontalSpace)

31

30

32data Request = Request {

31data Request = Request {

33− _requestMethod :: String

32+ requestMethod :: String

34− , _requestUri :: String

33+ , requestUri :: String

35− , _requestProtocol :: String

34+ , requestProtocol :: String

36 } deriving (Eq, Ord, Show)

35 } deriving (Eq, Ord, Show)

37

36

38requestLine :: Stream s m Char => ParsecT s u m Request

37requestLine :: Stream s m Char => ParsecT s u m Request

@@ -48,8 +47,8 @@ endOfLine :: Stream s m Char => ParsecT s u m ()

48endOfLine = (string "\r\n" *> pure ()) <|> (char '\n' *> pure ())

47endOfLine = (string "\r\n" *> pure ()) <|> (char '\n' *> pure ())

49

48

50data Header = Header {

49data Header = Header {

51− _headerName :: String

50+ headerName :: String

52− , _headerValue :: [String]

51+ , headerValue :: [String]

53 } deriving (Eq, Ord, Show)

52 } deriving (Eq, Ord, Show)

54

53

55messageHeader :: Stream s m Char => ParsecT s u m Header

54messageHeader :: Stream s m Char => ParsecT s u m Header

@@ -62,16 +61,14 @@ messageHeader = do

62request :: Stream s m Char => ParsecT s u m (Request, [Header])

61request :: Stream s m Char => ParsecT s u m (Request, [Header])

63request = (,) <$> requestLine <*> many messageHeader <* endOfLine

62request = (,) <$> requestLine <*> many messageHeader <* endOfLine

64

63

65−listy :: FilePath -> IO ()

66listy arg = do

64listy arg = do

67 r <- parseFromFile (many request) arg

65 r <- parseFromFile (many request) arg

68 case r of

66 case r of

69 Left err -> putStrLn $ arg ++ ": " ++ show err

67 Left err -> putStrLn $ arg ++ ": " ++ show err

70 Right rs -> print (length rs)

68 Right rs -> print (length rs)

71

69

72−chunky :: FilePath -> IO ()

73chunky arg = bracket (openFile arg ReadMode) hClose $ \h ->

70chunky arg = bracket (openFile arg ReadMode) hClose $ \h ->

74− loop (0::Int) =<< B.hGetContents h

71+ loop 0 =<< B.hGetContents h

75 where

72 where

76 loop !n bs

73 loop !n bs

77 | B.null bs = print n

74 | B.null bs = print n

examples/RFC2616.hs+51−26

@@ -5,61 +5,86 @@ module RFC2616

5 Header(..)

6 , Request(..)

7 , Response(..)

8+ , isToken

9+ , messageHeader

8 , request

10 , request

11+ , requestLine

9 , response

12 , response

13+ , responseLine

14+ , lowerHeader

15+ , lookupHeader

10 ) where

16 ) where

11

17

12−import Control.Applicative

18+import Control.Applicative hiding (many)

13−import Data.Attoparsec.ByteString as P

19+import Data.Attoparsec as P

20+import qualified Data.Attoparsec.Char8 as P8

14−import Data.Attoparsec.ByteString.Char8 (char8, endOfLine, isDigit_w8)

21+import Data.Attoparsec.Char8 (char8, endOfLine, isDigit_w8)

15−import Data.ByteString (ByteString)

16import Data.Word (Word8)

22import Data.Word (Word8)

17−import Data.Attoparsec.ByteString.Char8 (isEndOfLine, isHorizontalSpace)

23+import qualified Data.ByteString.Char8 as B hiding (map)

24+import qualified Data.ByteString as B (map)

18

25

19isToken :: Word8 -> Bool

26isToken :: Word8 -> Bool

20isToken w = w <= 127 && notInClass "\0-\31()<>@,;:\\\"/[]?={} \t" w

27isToken w = w <= 127 && notInClass "\0-\31()<>@,;:\\\"/[]?={} \t" w

21

28

22skipSpaces :: Parser ()

29skipSpaces :: Parser ()

23−skipSpaces = satisfy isHorizontalSpace *> skipWhile isHorizontalSpace

30+skipSpaces = satisfy P8.isHorizontalSpace *> skipWhile P8.isHorizontalSpace

24

31

25data Request = Request {

32data Request = Request {

26− requestMethod :: ByteString

33+ requestMethod :: !B.ByteString

27− , requestUri :: ByteString

34+ , requestUri :: !B.ByteString

28− , requestVersion :: ByteString

35+ , requestVersion :: !B.ByteString

29 } deriving (Eq, Ord, Show)

36 } deriving (Eq, Ord, Show)

30

37

31−httpVersion :: Parser ByteString

38+httpVersion :: Parser B.ByteString

32−httpVersion = "HTTP/" *> P.takeWhile (\c -> isDigit_w8 c || c == 46)

39+httpVersion = string "HTTP/" *> P.takeWhile (\c -> isDigit_w8 c || c == 46)

33

40

34requestLine :: Parser Request

41requestLine :: Parser Request

42+requestLine = do

35−requestLine = Request <$> (takeWhile1 isToken <* char8 ' ')

43+ method <- P.takeWhile1 isToken <* char8 ' '

36− <*> (takeWhile1 (/=32) <* char8 ' ')

44+ uri <- P.takeWhile1 (/=32) <* char8 ' '

37− <*> (httpVersion <* endOfLine)

45+ version <- httpVersion <* endOfLine

46+ return $! Request method uri version

38

47

39data Header = Header {

48data Header = Header {

40− headerName :: ByteString

49+ headerName :: !B.ByteString

41− , headerValue :: [ByteString]

50+ , headerValue :: [B.ByteString]

42 } deriving (Eq, Ord, Show)

51 } deriving (Eq, Ord, Show)

43

52

44messageHeader :: Parser Header

53messageHeader :: Parser Header

45−messageHeader = Header

54+messageHeader = do

46− <$> (P.takeWhile isToken <* char8 ':' <* skipWhile isHorizontalSpace)

55+ header <- P.takeWhile isToken <* char8 ':' <* skipWhile P8.isHorizontalSpace

47− <*> ((:) <$> (takeTill isEndOfLine <* endOfLine)

56+ body <- takeTill P8.isEndOfLine <* endOfLine

48− <*> (many $ skipSpaces *> takeTill isEndOfLine <* endOfLine))

57+ bodies <- many $ skipSpaces *> takeTill P8.isEndOfLine <* endOfLine

58+ return $! Header header (body:bodies)

49

59

50request :: Parser (Request, [Header])

60request :: Parser (Request, [Header])

51request = (,) <$> requestLine <*> many messageHeader <* endOfLine

61request = (,) <$> requestLine <*> many messageHeader <* endOfLine

52

62

53data Response = Response {

63data Response = Response {

54− responseVersion :: ByteString

64+ responseVersion :: !B.ByteString

55− , responseCode :: ByteString

65+ , responseCode :: !B.ByteString

56− , responseMsg :: ByteString

66+ , responseMsg :: !B.ByteString

57 } deriving (Eq, Ord, Show)

67 } deriving (Eq, Ord, Show)

58

68

59responseLine :: Parser Response

69responseLine :: Parser Response

70+responseLine = do

60−responseLine = Response <$> (httpVersion <* char8 ' ')

71+ version <- httpVersion <* char8 ' '

61− <*> (P.takeWhile isDigit_w8 <* char8 ' ')

72+ code <- P.takeWhile isDigit_w8 <* char8 ' '

62− <*> (takeTill isEndOfLine <* endOfLine)

73+ msg <- P.takeTill P8.isEndOfLine <* endOfLine

74+ return $! Response version code msg

63

75

64response :: Parser (Response, [Header])

76response :: Parser (Response, [Header])

65response = (,) <$> responseLine <*> many messageHeader <* endOfLine

77response = (,) <$> responseLine <*> many messageHeader <* endOfLine

78+

79+lowerHeader :: Header -> Header

80+lowerHeader (Header n v) = Header (B.map toLower n) (map (B.map toLower) v)

81+ where toLower w | w >= 65 && w <= 90 = w + 32

82+ | otherwise = w

83+

84+lookupHeader :: B.ByteString -> [Header] -> [B.ByteString]

85+lookupHeader k = go

86+ where

87+ go (Header n v:hs)

88+ | k == n = v

89+ | otherwise = go hs

90+ go _ = []

examples/Atto_RFC2616.hs → examples/TestRFC2616.hsrenamed+8−16

@@ -1,28 +1,21 @@

1{-# LANGUAGE BangPatterns #-}

2−

3−module Main (main) where

4−

5−import Control.Applicative

6−import Control.Exception (bracket)

7−import Control.Monad (forM_)

8−import Data.Attoparsec.ByteString

9import RFC2616

2import RFC2616

10−import System.Environment

3+import Control.Monad (forM_)

11import System.IO

4import System.IO

5+import Control.Exception (bracket)

6+import System.Environment

12import qualified Data.ByteString.Char8 as B

7import qualified Data.ByteString.Char8 as B

8+import Data.Attoparsec

13

9

14−refill :: Handle -> IO B.ByteString

15−refill h = B.hGet h (80*1024)

10+refill h = B.hGet h (4*1024)

16

11

17−listy :: FilePath -> Handle -> IO ()

18listy file h = do

12listy file h = do

19 r <- parseWith (refill h) (many request) =<< refill h

13 r <- parseWith (refill h) (many request) =<< refill h

20 case r of

14 case r of

21 Fail _ _ msg -> hPutStrLn stderr $ file ++ ": " ++ msg

15 Fail _ _ msg -> hPutStrLn stderr $ file ++ ": " ++ msg

22 Done _ reqs -> print (length reqs)

16 Done _ reqs -> print (length reqs)

23−

17+

24−incrementy :: FilePath -> Handle -> IO ()

25−incrementy file h = go (0::Int) =<< refill h

18+incrementy file h = go 0 =<< refill h

26 where

19 where

27 go !n is = do

20 go !n is = do

28 r <- parseWith (refill h) request is

21 r <- parseWith (refill h) request is

@@ -35,8 +28,7 @@ incrementy file h = go (0::Int) =<< refill h

35 then print (n+1)

28 then print (n+1)

36 else go (n+1) s

29 else go (n+1) s

37 | otherwise -> go (n+1) bs

30 | otherwise -> go (n+1) bs

38−

31+

39−main :: IO ()

40main = do

32main = do

41 args <- getArgs

33 args <- getArgs

42 forM_ args $ \arg ->

34 forM_ args $ \arg ->

examples/attoparsec-examples.cabaldeleted−31

@@ -1,31 +0,0 @@

1−-- These examples are not intended to be installed.

2−-- So don't install 'em.

3−

4−name: attoparsec-examples

5−version: 0

6−cabal-version: >=1.6

7−build-type: Simple

8−

9−executable atto-rfc2616

10− main-is: Atto_RFC2616.hs

11− hs-source-dirs: .. .

12− ghc-options: -O2 -Wall -rtsopts

13− build-depends:

14− array,

15− base == 4.*,

16− bytestring >= 0.10.4.0,

17− deepseq >= 1.1,

18− scientific >= 0.3.1,

19− text >= 1.1.1.0

20−

21−executable parsec-rfc2616

22− main-is: Parsec_RFC2616.hs

23− hs-source-dirs: .

24− ghc-options: -O2 -Wall -rtsopts

25− build-depends:

26− array,

27− base == 4.*,

28− containers,

29− bytestring >= 0.10.4.0,

30− parsec,

31− text >= 1.1.1.0

examples/http-requests.txtdeleted−494

@@ -1,494 +0,0 @@

1−GET / HTTP/1.1

2−Host: www.reddit.com

3−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

4−Accept: text/html,application/xhtml+xml,application/xml;q=0.9,*/*;q=0.8

5−Accept-Language: en-us,en;q=0.5

6−Accept-Encoding: gzip, deflate

7−Connection: keep-alive

8−

9−GET /reddit.v_EZwRzV-Ns.css HTTP/1.1

10−Host: www.redditstatic.com

11−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

12−Accept: text/css,*/*;q=0.1

13−Accept-Language: en-us,en;q=0.5

14−Accept-Encoding: gzip, deflate

15−Connection: keep-alive

16−Referer: http://www.reddit.com/

17−

18−GET /reddit-init.en-us.O1zuMqOOQvY.js HTTP/1.1

19−Host: www.redditstatic.com

20−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

21−Accept: */*

22−Accept-Language: en-us,en;q=0.5

23−Accept-Encoding: gzip, deflate

24−Connection: keep-alive

25−Referer: http://www.reddit.com/

26−

27−GET /reddit.en-us.31yAfSoTsfo.js HTTP/1.1

28−Host: www.redditstatic.com

29−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

30−Accept: */*

31−Accept-Language: en-us,en;q=0.5

32−Accept-Encoding: gzip, deflate

33−Connection: keep-alive

34−Referer: http://www.reddit.com/

35−

36−GET /kill.png HTTP/1.1

37−Host: www.redditstatic.com

38−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

39−Accept: image/png,image/*;q=0.8,*/*;q=0.5

40−Accept-Language: en-us,en;q=0.5

41−Accept-Encoding: gzip, deflate

42−Connection: keep-alive

43−Referer: http://www.reddit.com/

44−

45−GET /icon.png HTTP/1.1

46−Host: www.redditstatic.com

47−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

48−Accept: text/html,application/xhtml+xml,application/xml;q=0.9,*/*;q=0.8

49−Accept-Language: en-us,en;q=0.5

50−Accept-Encoding: gzip, deflate

51−Connection: keep-alive

52−

53−GET /favicon.ico HTTP/1.1

54−Host: www.redditstatic.com

55−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

56−Accept: text/html,application/xhtml+xml,application/xml;q=0.9,*/*;q=0.8

57−Accept-Language: en-us,en;q=0.5

58−Accept-Encoding: gzip, deflate

59−Connection: keep-alive

60−

61−GET /AMZM4CWd6zstSC8y.jpg HTTP/1.1

62−Host: b.thumbs.redditmedia.com

63−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

64−Accept: image/png,image/*;q=0.8,*/*;q=0.5

65−Accept-Language: en-us,en;q=0.5

66−Accept-Encoding: gzip, deflate

67−Connection: keep-alive

68−Referer: http://www.reddit.com/

69−

70−GET /jz1d5Nm0w97-YyNm.jpg HTTP/1.1

71−Host: b.thumbs.redditmedia.com

72−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

73−Accept: image/png,image/*;q=0.8,*/*;q=0.5

74−Accept-Language: en-us,en;q=0.5

75−Accept-Encoding: gzip, deflate

76−Connection: keep-alive

77−Referer: http://www.reddit.com/

78−

79−GET /aWGO99I6yOcNUKXB.jpg HTTP/1.1

80−Host: a.thumbs.redditmedia.com

81−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

82−Accept: image/png,image/*;q=0.8,*/*;q=0.5

83−Accept-Language: en-us,en;q=0.5

84−Accept-Encoding: gzip, deflate

85−Connection: keep-alive

86−Referer: http://www.reddit.com/

87−

88−GET /rZ_rD5TjrJM0E9Aj.css HTTP/1.1

89−Host: e.thumbs.redditmedia.com

90−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

91−Accept: text/css,*/*;q=0.1

92−Accept-Language: en-us,en;q=0.5

93−Accept-Encoding: gzip, deflate

94−Connection: keep-alive

95−Referer: http://www.reddit.com/

96−

97−GET /tmsPwagFzyTvrGRx.jpg HTTP/1.1

98−Host: a.thumbs.redditmedia.com

99−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

100−Accept: image/png,image/*;q=0.8,*/*;q=0.5

101−Accept-Language: en-us,en;q=0.5

102−Accept-Encoding: gzip, deflate

103−Connection: keep-alive

104−Referer: http://www.reddit.com/

105−

106−GET /KYgUaLvXCK3TCEJx.jpg HTTP/1.1

107−Host: a.thumbs.redditmedia.com

108−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

109−Accept: image/png,image/*;q=0.8,*/*;q=0.5

110−Accept-Language: en-us,en;q=0.5

111−Accept-Encoding: gzip, deflate

112−Connection: keep-alive

113−Referer: http://www.reddit.com/

114−

115−GET /81pzxT5x2ozuEaxX.jpg HTTP/1.1

116−Host: e.thumbs.redditmedia.com

117−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

118−Accept: image/png,image/*;q=0.8,*/*;q=0.5

119−Accept-Language: en-us,en;q=0.5

120−Accept-Encoding: gzip, deflate

121−Connection: keep-alive

122−Referer: http://www.reddit.com/

123−

124−GET /MFqCUiUVPO5V8t6x.jpg HTTP/1.1

125−Host: a.thumbs.redditmedia.com

126−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

127−Accept: image/png,image/*;q=0.8,*/*;q=0.5

128−Accept-Language: en-us,en;q=0.5

129−Accept-Encoding: gzip, deflate

130−Connection: keep-alive

131−Referer: http://www.reddit.com/

132−

133−GET /TFpYTiAO5aEowokv.jpg HTTP/1.1

134−Host: e.thumbs.redditmedia.com

135−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

136−Accept: image/png,image/*;q=0.8,*/*;q=0.5

137−Accept-Language: en-us,en;q=0.5

138−Accept-Encoding: gzip, deflate

139−Connection: keep-alive

140−Referer: http://www.reddit.com/

141−

142−GET /eMWMpmm9APNeNqcF.jpg HTTP/1.1

143−Host: e.thumbs.redditmedia.com

144−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

145−Accept: image/png,image/*;q=0.8,*/*;q=0.5

146−Accept-Language: en-us,en;q=0.5

147−Accept-Encoding: gzip, deflate

148−Connection: keep-alive

149−Referer: http://www.reddit.com/

150−

151−GET /S-IpsJrOKuaK9GZ8.jpg HTTP/1.1

152−Host: c.thumbs.redditmedia.com

153−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

154−Accept: image/png,image/*;q=0.8,*/*;q=0.5

155−Accept-Language: en-us,en;q=0.5

156−Accept-Encoding: gzip, deflate

157−Connection: keep-alive

158−Referer: http://www.reddit.com/

159−

160−GET /3V6dj9PDsNnheDXn.jpg HTTP/1.1

161−Host: c.thumbs.redditmedia.com

162−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

163−Accept: image/png,image/*;q=0.8,*/*;q=0.5

164−Accept-Language: en-us,en;q=0.5

165−Accept-Encoding: gzip, deflate

166−Connection: keep-alive

167−Referer: http://www.reddit.com/

168−

169−GET /wQ3-VmNXhv8sg4SJ.jpg HTTP/1.1

170−Host: c.thumbs.redditmedia.com

171−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

172−Accept: image/png,image/*;q=0.8,*/*;q=0.5

173−Accept-Language: en-us,en;q=0.5

174−Accept-Encoding: gzip, deflate

175−Connection: keep-alive

176−Referer: http://www.reddit.com/

177−

178−GET /ixd1C1njpczEWC22.jpg HTTP/1.1

179−Host: c.thumbs.redditmedia.com

180−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

181−Accept: image/png,image/*;q=0.8,*/*;q=0.5

182−Accept-Language: en-us,en;q=0.5

183−Accept-Encoding: gzip, deflate

184−Connection: keep-alive

185−Referer: http://www.reddit.com/

186−

187−GET /nGsQj15VyOHMwmq8.jpg HTTP/1.1

188−Host: c.thumbs.redditmedia.com

189−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

190−Accept: image/png,image/*;q=0.8,*/*;q=0.5

191−Accept-Language: en-us,en;q=0.5

192−Accept-Encoding: gzip, deflate

193−Connection: keep-alive

194−Referer: http://www.reddit.com/

195−

196−GET /zT4yQmDxQLbIxK1b.jpg HTTP/1.1

197−Host: c.thumbs.redditmedia.com

198−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

199−Accept: image/png,image/*;q=0.8,*/*;q=0.5

200−Accept-Language: en-us,en;q=0.5

201−Accept-Encoding: gzip, deflate

202−Connection: keep-alive

203−Referer: http://www.reddit.com/

204−

205−GET /L5e1HcZLv1iu4nrG.jpg HTTP/1.1

206−Host: f.thumbs.redditmedia.com

207−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

208−Accept: image/png,image/*;q=0.8,*/*;q=0.5

209−Accept-Language: en-us,en;q=0.5

210−Accept-Encoding: gzip, deflate

211−Connection: keep-alive

212−Referer: http://www.reddit.com/

213−

214−GET /WJFFPxD8X4JO_lIG.jpg HTTP/1.1

215−Host: f.thumbs.redditmedia.com

216−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

217−Accept: image/png,image/*;q=0.8,*/*;q=0.5

218−Accept-Language: en-us,en;q=0.5

219−Accept-Encoding: gzip, deflate

220−Connection: keep-alive

221−Referer: http://www.reddit.com/

222−

223−GET /hVMVTDdjuY3bQox5.jpg HTTP/1.1

224−Host: f.thumbs.redditmedia.com

225−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

226−Accept: image/png,image/*;q=0.8,*/*;q=0.5

227−Accept-Language: en-us,en;q=0.5

228−Accept-Encoding: gzip, deflate

229−Connection: keep-alive

230−Referer: http://www.reddit.com/

231−

232−GET /rnWf8CjBcyPQs5y_.jpg HTTP/1.1

233−Host: f.thumbs.redditmedia.com

234−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

235−Accept: image/png,image/*;q=0.8,*/*;q=0.5

236−Accept-Language: en-us,en;q=0.5

237−Accept-Encoding: gzip, deflate

238−Connection: keep-alive

239−Referer: http://www.reddit.com/

240−

241−GET /gZJL1jNylKbGV4d-.jpg HTTP/1.1

242−Host: d.thumbs.redditmedia.com

243−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

244−Accept: image/png,image/*;q=0.8,*/*;q=0.5

245−Accept-Language: en-us,en;q=0.5

246−Accept-Encoding: gzip, deflate

247−Connection: keep-alive

248−Referer: http://www.reddit.com/

249−

250−GET /aNd2zNRLXiMnKUFh.jpg HTTP/1.1

251−Host: c.thumbs.redditmedia.com

252−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

253−Accept: image/png,image/*;q=0.8,*/*;q=0.5

254−Accept-Language: en-us,en;q=0.5

255−Accept-Encoding: gzip, deflate

256−Connection: keep-alive

257−Referer: http://www.reddit.com/

258−

259−GET /droparrowgray.gif HTTP/1.1

260−Host: www.redditstatic.com

261−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

262−Accept: image/png,image/*;q=0.8,*/*;q=0.5

263−Accept-Language: en-us,en;q=0.5

264−Accept-Encoding: gzip, deflate

265−Connection: keep-alive

266−Referer: http://www.redditstatic.com/reddit.v_EZwRzV-Ns.css

267−

268−GET /sprite-reddit.an0Lnf61Ap4.png HTTP/1.1

269−Host: www.redditstatic.com

270−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

271−Accept: image/png,image/*;q=0.8,*/*;q=0.5

272−Accept-Language: en-us,en;q=0.5

273−Accept-Encoding: gzip, deflate

274−Connection: keep-alive

275−Referer: http://www.redditstatic.com/reddit.v_EZwRzV-Ns.css

276−

277−GET /ga.js HTTP/1.1

278−Host: www.google-analytics.com

279−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

280−Accept: */*

281−Accept-Language: en-us,en;q=0.5

282−Accept-Encoding: gzip, deflate

283−Connection: keep-alive

284−Referer: http://www.reddit.com/

285−If-Modified-Since: Tue, 29 Oct 2013 19:33:51 GMT

286−

287−GET /reddit/ads.html?sr=-reddit.com&bust2 HTTP/1.1

288−Host: static.adzerk.net

289−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

290−Accept: text/html,application/xhtml+xml,application/xml;q=0.9,*/*;q=0.8

291−Accept-Language: en-us,en;q=0.5

292−Accept-Encoding: gzip, deflate

293−Connection: keep-alive

294−Referer: http://www.reddit.com/

295−

296−GET /pixel/of_destiny.png?v=hOlmDALJCWWdjzfBV4ZxJPmrdCLWB%2Ftq7Z%2Ffp4Q%2FxXbVPPREuMJMVGzKraTuhhNWxCCwi6yFEZg%3D&r=783333388 HTTP/1.1

297−Host: pixel.redditmedia.com

298−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

299−Accept: image/png,image/*;q=0.8,*/*;q=0.5

300−Accept-Language: en-us,en;q=0.5

301−Accept-Encoding: gzip, deflate

302−Connection: keep-alive

303−Referer: http://www.reddit.com/

304−

305−GET /UNcO-h_QcS9PD-Gn.jpg HTTP/1.1

306−Host: c.thumbs.redditmedia.com

307−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

308−Accept: image/png,image/*;q=0.8,*/*;q=0.5

309−Accept-Language: en-us,en;q=0.5

310−Accept-Encoding: gzip, deflate

311−Connection: keep-alive

312−Referer: http://e.thumbs.redditmedia.com/rZ_rD5TjrJM0E9Aj.css

313−

314−GET /welcome-lines.png HTTP/1.1

315−Host: www.redditstatic.com

316−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

317−Accept: image/png,image/*;q=0.8,*/*;q=0.5

318−Accept-Language: en-us,en;q=0.5

319−Accept-Encoding: gzip, deflate

320−Connection: keep-alive

321−Referer: http://www.redditstatic.com/reddit.v_EZwRzV-Ns.css

322−

323−GET /welcome-upvote.png HTTP/1.1

324−Host: www.redditstatic.com

325−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

326−Accept: image/png,image/*;q=0.8,*/*;q=0.5

327−Accept-Language: en-us,en;q=0.5

328−Accept-Encoding: gzip, deflate

329−Connection: keep-alive

330−Referer: http://www.redditstatic.com/reddit.v_EZwRzV-Ns.css

331−

332−GET /__utm.gif?utmwv=5.5.1&utms=1&utmn=720496082&utmhn=www.reddit.com&utme=8(site*srpath*usertype*uitype)9(%20reddit.com*%20reddit.com-GET_listing*guest*web)11(3!2)&utmcs=UTF-8&utmsr=2560x1600&utmvp=1288x792&utmsc=24-bit&utmul=en-us&utmje=1&utmfl=13.0%20r0&utmdt=reddit%3A%20the%20front%20page%20of%20the%20internet&utmhid=2129416330&utmr=-&utmp=%2F&utmht=1400862512705&utmac=UA-12131688-1&utmcc=__utma%3D55650728.585571751.1400862513.1400862513.1400862513.1%3B%2B__utmz%3D55650728.1400862513.1.1.utmcsr%3D(direct)%7Cutmccn%3D(direct)%7Cutmcmd%3D(none)%3B&utmu=qR~ HTTP/1.1

333−Host: www.google-analytics.com

334−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

335−Accept: image/png,image/*;q=0.8,*/*;q=0.5

336−Accept-Language: en-us,en;q=0.5

337−Accept-Encoding: gzip, deflate

338−Connection: keep-alive

339−Referer: http://www.reddit.com/

340−

341−GET /ImnpOQhbXUPkwceN.png HTTP/1.1

342−Host: a.thumbs.redditmedia.com

343−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

344−Accept: image/png,image/*;q=0.8,*/*;q=0.5

345−Accept-Language: en-us,en;q=0.5

346−Accept-Encoding: gzip, deflate

347−Connection: keep-alive

348−Referer: http://www.reddit.com/

349−

350−GET /ajax/libs/jquery/1.7.1/jquery.min.js HTTP/1.1

351−Host: ajax.googleapis.com

352−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

353−Accept: */*

354−Accept-Language: en-us,en;q=0.5

355−Accept-Encoding: gzip, deflate

356−Connection: keep-alive

357−Referer: http://static.adzerk.net/reddit/ads.html?sr=-reddit.com&bust2

358−

359−GET /__utm.gif?utmwv=5.5.1&utms=2&utmn=1493472678&utmhn=www.reddit.com&utmt=event&utme=5(AdBlock*enabled*false)(0)8(site*srpath*usertype*uitype)9(%20reddit.com*%20reddit.com-GET_listing*guest*web)11(3!2)&utmcs=UTF-8&utmsr=2560x1600&utmvp=1288x792&utmsc=24-bit&utmul=en-us&utmje=1&utmfl=13.0%20r0&utmdt=reddit%3A%20the%20front%20page%20of%20the%20internet&utmhid=2129416330&utmr=-&utmp=%2F&utmht=1400862512708&utmac=UA-12131688-1&utmni=1&utmcc=__utma%3D55650728.585571751.1400862513.1400862513.1400862513.1%3B%2B__utmz%3D55650728.1400862513.1.1.utmcsr%3D(direct)%7Cutmccn%3D(direct)%7Cutmcmd%3D(none)%3B&utmu=6R~ HTTP/1.1

360−Host: www.google-analytics.com

361−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

362−Accept: image/png,image/*;q=0.8,*/*;q=0.5

363−Accept-Language: en-us,en;q=0.5

364−Accept-Encoding: gzip, deflate

365−Connection: keep-alive

366−Referer: http://www.reddit.com/

367−

368−GET /ados.js?q=43 HTTP/1.1

369−Host: secure.adzerk.net

370−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

371−Accept: */*

372−Accept-Language: en-us,en;q=0.5

373−Accept-Encoding: gzip, deflate

374−Connection: keep-alive

375−Referer: http://static.adzerk.net/reddit/ads.html?sr=-reddit.com&bust2

376−

377−GET /fetch-trackers?callback=jQuery111005268222517967478_1400862512407&ids%5B%5D=t3_25jzeq-t8_k2ii&_=1400862512408 HTTP/1.1

378−Host: tracker.redditmedia.com

379−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

380−Accept: */*

381−Accept-Language: en-us,en;q=0.5

382−Accept-Encoding: gzip, deflate

383−Connection: keep-alive

384−Referer: http://www.reddit.com/

385−

386−GET /ados?t=1400862512892&request={%22Placements%22:[{%22A%22:5146,%22S%22:24950,%22D%22:%22main%22,%22AT%22:5},{%22A%22:5146,%22S%22:24950,%22D%22:%22sponsorship%22,%22AT%22:8}],%22Keywords%22:%22-reddit.com%22,%22Referrer%22:%22http%3A%2F%2Fwww.reddit.com%2F%22,%22IsAsync%22:true,%22WriteResults%22:true} HTTP/1.1

387−Host: engine.adzerk.net

388−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

389−Accept: */*

390−Accept-Language: en-us,en;q=0.5

391−Accept-Encoding: gzip, deflate

392−Connection: keep-alive

393−Referer: http://static.adzerk.net/reddit/ads.html?sr=-reddit.com&bust2

394−

395−GET /pixel/of_doom.png?id=t3_25jzeq-t8_k2ii&hash=da31d967485cdbd459ce1e9a5dde279fef7fc381&r=1738649500 HTTP/1.1

396−Host: pixel.redditmedia.com

397−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

398−Accept: image/png,image/*;q=0.8,*/*;q=0.5

399−Accept-Language: en-us,en;q=0.5

400−Accept-Encoding: gzip, deflate

401−Connection: keep-alive

402−Referer: http://www.reddit.com/

403−

404−GET /Extensions/adFeedback.js HTTP/1.1

405−Host: static.adzrk.net

406−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

407−Accept: */*

408−Accept-Language: en-us,en;q=0.5

409−Accept-Encoding: gzip, deflate

410−Connection: keep-alive

411−Referer: http://static.adzerk.net/reddit/ads.html?sr=-reddit.com&bust2

412−

413−GET /Extensions/adFeedback.css HTTP/1.1

414−Host: static.adzrk.net

415−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

416−Accept: text/css,*/*;q=0.1

417−Accept-Language: en-us,en;q=0.5

418−Accept-Encoding: gzip, deflate

419−Connection: keep-alive

420−Referer: http://static.adzerk.net/reddit/ads.html?sr=-reddit.com&bust2

421−

422−GET /reddit/ads-load.html?bust2 HTTP/1.1

423−Host: static.adzerk.net

424−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

425−Accept: text/html,application/xhtml+xml,application/xml;q=0.9,*/*;q=0.8

426−Accept-Language: en-us,en;q=0.5

427−Accept-Encoding: gzip, deflate

428−Connection: keep-alive

429−Referer: http://www.reddit.com/

430−

431−GET /Advertisers/a774d7d6148046efa89403a8db635a81.jpg HTTP/1.1

432−Host: static.adzerk.net

433−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

434−Accept: image/png,image/*;q=0.8,*/*;q=0.5

435−Accept-Language: en-us,en;q=0.5

436−Accept-Encoding: gzip, deflate

437−Connection: keep-alive

438−Referer: http://static.adzerk.net/reddit/ads.html?sr=-reddit.com&bust2

439−

440−GET /i.gif?e=eyJhdiI6NjIzNTcsImF0Ijo1LCJjbSI6MTE2MzUxLCJjaCI6Nzk4NCwiY3IiOjMzNzAxNSwiZGkiOiI4NmI2Y2UzYWM5NDM0MjhkOTk2ZTg4MjYwZDE5ZTE1YyIsImRtIjoxLCJmYyI6NDE2MTI4LCJmbCI6MjEwNDY0LCJrdyI6Ii1yZWRkaXQuY29tIiwibWsiOiItcmVkZGl0LmNvbSIsIm53Ijo1MTQ2LCJwYyI6MCwicHIiOjIwMzYyLCJydCI6MSwicmYiOiJodHRwOi8vd3d3LnJlZGRpdC5jb20vIiwic3QiOjI0OTUwLCJ1ayI6InVlMS01ZWIwOGFlZWQ5YTc0MDFjOTE5NWNiOTMzZWI3Yzk2NiIsInRzIjoxNDAwODYyNTkzNjQ1fQ&s=lwlbFf2Uywt7zVBFRj_qXXu7msY HTTP/1.1

441−Host: engine.adzerk.net

442−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

443−Accept: image/png,image/*;q=0.8,*/*;q=0.5

444−Accept-Language: en-us,en;q=0.5

445−Accept-Encoding: gzip, deflate

446−Connection: keep-alive

447−Referer: http://static.adzerk.net/reddit/ads.html?sr=-reddit.com&bust2

448−Cookie: azk=ue1-5eb08aeed9a7401c9195cb933eb7c966

449−

450−GET /BurstingPipe/adServer.bs?cn=tf&c=19&mc=imp&pli=9994987&PluID=0&ord=1400862593644&rtu=-1 HTTP/1.1

451−Host: bs.serving-sys.com

452−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

453−Accept: image/png,image/*;q=0.8,*/*;q=0.5

454−Accept-Language: en-us,en;q=0.5

455−Accept-Encoding: gzip, deflate

456−Connection: keep-alive

457−Referer: http://static.adzerk.net/reddit/ads.html?sr=-reddit.com&bust2

458−

459−GET /Advertisers/63cfd0044ffd49c0a71a6626f7a1d8f0.jpg HTTP/1.1

460−Host: static.adzerk.net

461−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

462−Accept: image/png,image/*;q=0.8,*/*;q=0.5

463−Accept-Language: en-us,en;q=0.5

464−Accept-Encoding: gzip, deflate

465−Connection: keep-alive

466−Referer: http://static.adzerk.net/reddit/ads-load.html?bust2

467−

468−GET /BurstingPipe/adServer.bs?cn=tf&c=19&mc=imp&pli=9962555&PluID=0&ord=1400862593645&rtu=-1 HTTP/1.1

469−Host: bs.serving-sys.com

470−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

471−Accept: image/png,image/*;q=0.8,*/*;q=0.5

472−Accept-Language: en-us,en;q=0.5

473−Accept-Encoding: gzip, deflate

474−Connection: keep-alive

475−Referer: http://static.adzerk.net/reddit/ads-load.html?bust2

476−Cookie: S_9994987=6754579095859875029; A4=01fmFvgRnI09SF00000; u2=d1263d39-874b-4a89-86cd-a2ab0860ed4e3Zl040

477−

478−GET /i.gif?e=eyJhdiI6NjIzNTcsImF0Ijo4LCJjbSI6MTE2MzUxLCJjaCI6Nzk4NCwiY3IiOjMzNzAxOCwiZGkiOiI3OTdlZjU3OWQ5NjE0ODdiODYyMGMyMGJkOTE4YzNiMSIsImRtIjoxLCJmYyI6NDE2MTMxLCJmbCI6MjEwNDY0LCJrdyI6Ii1yZWRkaXQuY29tIiwibWsiOiItcmVkZGl0LmNvbSIsIm53Ijo1MTQ2LCJwYyI6MCwicHIiOjIwMzYyLCJydCI6MSwicmYiOiJodHRwOi8vd3d3LnJlZGRpdC5jb20vIiwic3QiOjI0OTUwLCJ1ayI6InVlMS01ZWIwOGFlZWQ5YTc0MDFjOTE5NWNiOTMzZWI3Yzk2NiIsInRzIjoxNDAwODYyNTkzNjQ2fQ&s=OjzxzXAgQksbdQOHNm-bjZcnZPA HTTP/1.1

479−Host: engine.adzerk.net

480−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1

481−Accept: image/png,image/*;q=0.8,*/*;q=0.5

482−Accept-Language: en-us,en;q=0.5

483−Accept-Encoding: gzip, deflate

484−Connection: keep-alive

485−Referer: http://static.adzerk.net/reddit/ads-load.html?bust2

486−Cookie: azk=ue1-5eb08aeed9a7401c9195cb933eb7c966

487−

488−GET /subscribe?host_int=1042356184&ns_map=571794054_374233948806,464381511_13349283399&user_id=245722467&nid=1399334269710011966&ts=1400862514 HTTP/1.1

489−Host: notify8.dropbox.com

490−Accept-Encoding: identity

491−Connection: keep-alive

492−X-Dropbox-Locale: en_US

493−User-Agent: DropboxDesktopClient/2.7.54 (Macintosh; 10.8; ('i32',); en_US)

494−

examples/rfc2616.c+21−27

@@ -1,22 +1,21 @@

1/*

2− * This is a simple driver for the http-parser package. It is

2+ * This is a simple driver for Ryan Dahl's hand-bummed C http-parser

3− * intended to read one HTTP request after another from a file,

3+ * package. It is intended to read one HTTP request after another

4− * nothing more.

4+ * from a file, nothing more.

5 *

6 * For "feature parity" with the Haskell code in RFC2616.hs, we

7 * allocate and populate a simple structure describing each request,

8 * since that's the sort of thing that many real applications would

9 * themselves do and the library doesn't do this for us.

10 *

11− * For the http-parser source, see

11+ * For the http-parser source, see http://github.com/ry/http-parser/

12− * https://github.com/joyent/http-parser/blob/master/http_parser.c

13 */

12 */

14

13

15/*

14/*

16 * Turn off this preprocessor symbol to have the callbacks do nothing

15 * Turn off this preprocessor symbol to have the callbacks do nothing

17 * at all, which "improves performance" by about 50%.

16 * at all, which "improves performance" by about 50%.

18 */

17 */

19−/*#define LOOK_BUSY*/

18+#define LOOK_BUSY

20

19

21#include <assert.h>

20#include <assert.h>

22#include <fcntl.h>

21#include <fcntl.h>

@@ -28,18 +27,18 @@

28#include <unistd.h>

27#include <unistd.h>

29

28

30#include "http_parser.h"

29#include "http_parser.h"

31−

30+

32struct http_string {

31struct http_string {

33 size_t len;

32 size_t len;

34 char value[0];

33 char value[0];

35};

34};

36−

35+

37struct http_header {

36struct http_header {

38 struct http_string *name;

37 struct http_string *name;

39 struct http_string *value;

38 struct http_string *value;

40 struct http_header *next;

39 struct http_header *next;

41};

40};

42−

41+

43struct http_request {

42struct http_request {

44 struct http_string *method;

43 struct http_string *method;

45 struct http_string *uri;

44 struct http_string *uri;

@@ -50,7 +49,7 @@ struct data {

50 size_t count;

49 size_t count;

51 struct http_request req;

50 struct http_request req;

52};

51};

53−

52+

54static void *xmalloc(size_t size)

53static void *xmalloc(size_t size)

55{

54{

56 void *ptr;

55 void *ptr;

@@ -79,7 +78,7 @@ static void xstrcat(struct http_string **dst, const char *src, size_t len)

79 *dst = xstrdup(src, len, 0);

78 *dst = xstrdup(src, len, 0);

80 return;

79 return;

81 }

80 }

82−

81+

83 p = xstrdup((*dst)->value, (*dst)->len, len);

82 p = xstrdup((*dst)->value, (*dst)->len, len);

84 memcpy(p->value + (*dst)->len, src, len);

83 memcpy(p->value + (*dst)->len, src, len);

85 p->len += len;

84 p->len += len;

@@ -99,7 +98,7 @@ static int begin(http_parser *p)

99static int url(http_parser *p, const char *at, size_t len)

98static int url(http_parser *p, const char *at, size_t len)

100{

99{

101#ifdef LOOK_BUSY

100#ifdef LOOK_BUSY

102− struct data *data = p->data;

101+ struct data *data = p->data;

103

102

104 xstrcat(&data->req.uri, at, len);

103 xstrcat(&data->req.uri, at, len);

105#endif

104#endif

@@ -120,7 +119,7 @@ static int header_field(http_parser *p, const char *at, size_t len)

120 hdr->name = xstrdup(at, len, 0);

119 hdr->name = xstrdup(at, len, 0);

121 hdr->value = NULL;

120 hdr->value = NULL;

122 hdr->next = NULL;

121 hdr->next = NULL;

123−

122+

124 if (data->req.last != NULL)

123 if (data->req.last != NULL)

125 data->req.last->next = hdr;

124 data->req.last->next = hdr;

126 data->req.last = hdr;

125 data->req.last = hdr;

@@ -151,7 +150,7 @@ static int complete(http_parser *p)

151

150

152 free(data->req.method);

151 free(data->req.method);

153 free(data->req.uri);

152 free(data->req.uri);

154−

153+

155 for (hdr = data->req.headers; hdr != NULL; hdr = next) {

154 for (hdr = data->req.headers; hdr != NULL; hdr = next) {

156 next = hdr->next;

155 next = hdr->next;

157 free(hdr->name);

156 free(hdr->name);

@@ -165,7 +164,7 @@ static int complete(http_parser *p)

165 data->req.headers = NULL;

164 data->req.headers = NULL;

166 data->req.last = NULL;

165 data->req.last = NULL;

167#endif

166#endif

168−

167+

169 /* Bludgeon http_parser into understanding that we really want to

168 /* Bludgeon http_parser into understanding that we really want to

170 * keep parsing after a request that in principle ought to close

169 * keep parsing after a request that in principle ought to close

171 * the "connection". */

170 * the "connection". */

@@ -181,21 +180,16 @@ static int complete(http_parser *p)

181static void parse(const char *path, int fd)

180static void parse(const char *path, int fd)

182{

181{

183 struct data data;

182 struct data data;

184− http_parser_settings s;

185 http_parser p;

183 http_parser p;

186 ssize_t nread;

184 ssize_t nread;

187

185

188− memset(&s, 0, sizeof(s));

189− s.on_message_begin = begin;

190− s.on_url = url;

191− s.on_header_field = header_field;

192− s.on_header_value = header_value;

193− s.on_message_complete = complete;

194−

195− p.data = &data;

196−

197 http_parser_init(&p, HTTP_REQUEST);

186 http_parser_init(&p, HTTP_REQUEST);

198−

187+ p.on_message_begin = begin;

188+ p.on_url = url;

189+ p.on_header_field = header_field;

190+ p.on_header_value = header_value;

191+ p.on_message_complete = complete;

192+ p.data = &data;

199 data.count = 0;

193 data.count = 0;

200 data.req.method = NULL;

194 data.req.method = NULL;

201 data.req.uri = NULL;

195 data.req.uri = NULL;

@@ -208,7 +202,7 @@ static void parse(const char *path, int fd)

208

202

209 nread = read(fd, buf, sizeof(buf));

203 nread = read(fd, buf, sizeof(buf));

210

204

211− np = http_parser_execute(&p, &s, buf, nread);

205+ np = http_parser_execute(&p, buf, nread);

212 if (np != nread) {

206 if (np != nread) {

213 fprintf(stderr, "%s: parse failed\n", path);

207 fprintf(stderr, "%s: parse failed\n", path);

214 break;

208 break;

tests/Makefilenew file+14

@@ -0,0 +1,14 @@

1+all: TestFastSet.out qc.out

2+

3+%.out: %.exe

4+ ./$< | tee $<.tmp

5+ mv $<.tmp $@

6+

7+qc.exe: QC.hs

8+ ghc -O -fno-warn-orphans --make -o $@ $<

9+

10+%.exe: %.hs

11+ ghc -O -fno-warn-orphans --make -o $@ $<

12+

13+clean:

14+ -rm -f *.hi *.o *.exe *.out

tests/QC.hs+102−13

@@ -1,19 +1,108 @@

1+{-# LANGUAGE OverloadedStrings #-}

1−{-# OPTIONS_GHC -fno-warn-missing-signatures #-}

2+{-# OPTIONS_GHC -fno-warn-orphans #-}

2module Main (main) where

3module Main (main) where

3

4

4−import qualified QC.Buffer as Buffer

5+import Control.Applicative ((<$>))

5−import qualified QC.ByteString as ByteString

6+import Prelude hiding (takeWhile)

6−import qualified QC.Combinator as Combinator

7−import qualified QC.Simple as Simple

8−import qualified QC.Text as Text

9−import Test.Tasty (defaultMain, testGroup)

7+import Test.Framework (defaultMain, testGroup)

8+import Test.Framework.Providers.QuickCheck2 (testProperty)

9+import Test.QuickCheck

10+import qualified Data.Attoparsec as P

11+import qualified Data.ByteString as B

12+import qualified Data.ByteString as S

13+import qualified Data.ByteString.Lazy as L

14+

15+instance Arbitrary S.ByteString where

16+ arbitrary = S.pack <$> arbitrary

17+

18+instance Arbitrary L.ByteString where

19+ arbitrary = sized $ \n -> resize (round (sqrt (toEnum n :: Double)))

20+ ((L.fromChunks . map (S.pack . nonEmpty)) <$> arbitrary)

21+ where nonEmpty (NonEmpty a) = a

22+

23+-- Naming.

24+

25+{-

26+label (NonEmpty s) = case parse (anyWord8 <?> s) B.empty of

27+ (_, Left err) -> s `isInfixOf` err

28+ _ -> False

29+-}

30+

31+-- Basic byte-level combinators.

32+

33+maybeP p s = case P.parse p s `P.feed` B.empty of

34+ P.Done _ i -> Just i

35+ _ -> Nothing

36+

37+defP p s = P.parse p s `P.feed` B.empty

38+

39+satisfy w s = maybeP (P.satisfy (<=w)) (B.cons w s) == Just w

40+

41+word8 w s = maybeP (P.word8 w) (B.cons w s) == Just w

42+

43+anyWord8 s = maybeP P.anyWord8 s == if B.null s

44+ then Nothing

45+ else Just (B.head s)

46+

47+notWord8 w (NonEmpty s) = maybeP (P.notWord8 w) bs == if v == w

48+ then Nothing

49+ else Just v

50+ where v = B.head bs

51+ bs = B.pack s

52+

53+string s = maybeP (P.string s) s == Just s

54+

55+skipWhile w s =

56+ let t = B.dropWhile (<=w) s

57+ in case defP (P.skipWhile (<=w)) s of

58+ P.Done t' () -> t == t'

59+ _ -> False

60+

61+takeCount (Positive k) s =

62+ case maybeP (P.take k) s of

63+ Nothing -> k > B.length s

64+ Just s' -> k <= B.length s

65+

66+takeWhile w s =

67+ let (h,t) = B.span (==w) s

68+ in case defP (P.takeWhile (==w)) s of

69+ P.Done t' h' -> t == t' && h == h'

70+ _ -> False

71+

72+takeWhile1 w s =

73+ let s' = B.cons w s

74+ (h,t) = B.span (<=w) s'

75+ in case defP (P.takeWhile1 (<=w)) s' of

76+ P.Done t' h' -> t == t' && h == h'

77+ _ -> False

78+

79+takeTill w s =

80+ let (h,t) = B.break (==w) s

81+ in case defP (P.takeTill (==w)) s of

82+ P.Done t' h' -> t == t' && h == h'

83+ _ -> False

84+

85+takeWhile1_empty = maybeP (P.takeWhile1 undefined) B.empty == Nothing

86+

87+endOfInput s = maybeP P.endOfInput s == if B.null s

88+ then Just ()

89+ else Nothing

10

90

11main = defaultMain tests

91main = defaultMain tests

12

92

93+tests = [

13−tests = testGroup "tests" [

94+ testGroup "fnord" [

14− testGroup "bs" ByteString.tests

95+ testProperty "satisfy" satisfy,

15− , testGroup "buf" Buffer.tests

96+ testProperty "word8" word8,

16− , testGroup "combinator" Combinator.tests

97+ testProperty "notWord8" notWord8,

17− , testGroup "simple" Simple.tests

98+ testProperty "anyWord8" anyWord8,

18− , testGroup "text" Text.tests

99+ testProperty "string" string,

100+ testProperty "skipWhile" skipWhile,

101+ testProperty "takeCount" takeCount,

102+ testProperty "takeWhile" takeWhile,

103+ testProperty "takeWhile1" takeWhile1,

104+ testProperty "takeWhile1_empty" takeWhile1_empty,

105+ testProperty "takeTill" takeTill,

106+ testProperty "endOfInput" endOfInput

107+ ]

19 ]

108 ]

tests/QC/Buffer.hsdeleted−96

@@ -1,96 +0,0 @@

1−{-# LANGUAGE BangPatterns, CPP, FlexibleInstances, OverloadedStrings,

2− TypeSynonymInstances #-}

3−

4−module QC.Buffer (tests) where

5−

6−#if !MIN_VERSION_base(4,8,0)

7−import Control.Applicative ((<$>))

8−import Data.Monoid (Monoid(mconcat))

9−#endif

10−import QC.Common ()

11−import Test.Tasty (TestTree)

12−import Test.Tasty.QuickCheck (testProperty)

13−import Test.QuickCheck

14−import qualified Data.Attoparsec.ByteString.Buffer as BB

15−import qualified Data.Attoparsec.Text.Buffer as BT

16−import qualified Data.ByteString as B

17−import qualified Data.ByteString.Unsafe as B

18−import qualified Data.Text as T

19−import qualified Data.Text.Unsafe as T

20−

21−data BP t b = BP [t] !t !b

22− deriving (Eq, Show)

23−

24−type BPB = BP B.ByteString BB.Buffer

25−type BPT = BP T.Text BT.Buffer

26−

27−instance Arbitrary BPB where

28− arbitrary = do

29− bss <- arbitrary

30− return $! toBP BB.buffer bss

31−

32− shrink (BP bss _ _) = toBP BB.buffer <$> shrink bss

33−

34−instance Arbitrary BPT where

35− arbitrary = do

36− bss <- arbitrary

37− return $! toBP BT.buffer bss

38−

39− shrink (BP bss _ _) = toBP BT.buffer <$> shrink bss

40−

41−toBP :: (Monoid a, Monoid b) => (a -> b) -> [a] -> BP a b

42−toBP buf bss = BP bss (mconcat bss) (mconcat (map buf bss))

43−

44−b_unbuffer :: BPB -> Property

45−b_unbuffer (BP _ts t buf) = t === BB.unbuffer buf

46−

47−t_unbuffer :: BPT -> Property

48−t_unbuffer (BP _ts t buf) = t === BT.unbuffer buf

49−

50−b_length :: BPB -> Property

51−b_length (BP _ts t buf) = B.length t === BB.length buf

52−

53−t_length :: BPT -> Property

54−t_length (BP _ts t buf) = T.lengthWord16 t === BT.length buf

55−

56−b_unsafeIndex :: BPB -> Gen Property

57−b_unsafeIndex (BP _ts t buf) = do

58− let l = B.length t

59− i <- choose (0,l-1)

60− return $ l === 0 .||. B.unsafeIndex t i === BB.unsafeIndex buf i

61−

62−t_iter :: BPT -> Gen Property

63−t_iter (BP _ts t buf) = do

64− let l = T.lengthWord16 t

65− i <- choose (0,l-1)

66− let it (T.Iter c q) = (c,q)

67− return $ l === 0 .||. it (T.iter t i) === it (BT.iter buf i)

68−

69−t_iter_ :: BPT -> Gen Property

70−t_iter_ (BP _ts t buf) = do

71− let l = T.lengthWord16 t

72− i <- choose (0,l-1)

73− return $ l === 0 .||. T.iter_ t i === BT.iter_ buf i

74−

75−b_unsafeDrop :: BPB -> Gen Property

76−b_unsafeDrop (BP _ts t buf) = do

77− i <- choose (0, B.length t)

78− return $ B.unsafeDrop i t === BB.unsafeDrop i buf

79−

80−t_dropWord16 :: BPT -> Gen Property

81−t_dropWord16 (BP _ts t buf) = do

82− i <- choose (0, T.lengthWord16 t)

83− return $ T.dropWord16 i t === BT.dropWord16 i buf

84−

85−tests :: [TestTree]

86−tests = [

87− testProperty "b_unbuffer" b_unbuffer

88− , testProperty "t_unbuffer" t_unbuffer

89− , testProperty "b_length" b_length

90− , testProperty "t_length" t_length

91− , testProperty "b_unsafeIndex" b_unsafeIndex

92− , testProperty "t_iter" t_iter

93− , testProperty "t_iter_" t_iter_

94− , testProperty "b_unsafeDrop" b_unsafeDrop

95− , testProperty "t_dropWord16" t_dropWord16

96− ]

tests/QC/ByteString.hsdeleted−187

@@ -1,187 +0,0 @@

1−{-# LANGUAGE BangPatterns, CPP, OverloadedStrings #-}

2−module QC.ByteString (tests) where

3−

4−#if !MIN_VERSION_base(4,8,0)

5−import Control.Applicative ((<*>), (<$>))

6−#endif

7−import Data.Char (chr, ord, toUpper)

8−import Data.Int (Int64)

9−import Data.Word (Word8)

10−import Prelude hiding (take, takeWhile)

11−import QC.Common (ASCII(..), liftOp, parseBS, toStrictBS)

12−import Test.Tasty (TestTree)

13−import Test.Tasty.QuickCheck (testProperty)

14−import Test.QuickCheck

15−import qualified Data.Attoparsec.ByteString as P

16−import qualified Data.Attoparsec.ByteString.Char8 as P8

17−import qualified Data.Attoparsec.ByteString.FastSet as S

18−import qualified Data.Attoparsec.ByteString.Lazy as PL

19−import qualified Data.ByteString as B

20−import qualified Data.ByteString.Char8 as B8

21−import qualified Data.ByteString.Lazy as L

22−import qualified Data.ByteString.Lazy.Char8 as L8

23−

24−-- Basic byte-level combinators.

25−

26−satisfy :: Word8 -> L.ByteString -> Property

27−satisfy w s = parseBS (P.satisfy (<=w)) (L.cons w s) === Just w

28−

29−satisfyWith :: Word8 -> L.ByteString -> Property

30−satisfyWith w s = parseBS (P.satisfyWith (chr . fromIntegral) (<=c))

31− (L.cons (fromIntegral (ord c)) s) === Just c

32− where

33− c = chr (fromIntegral w)

34−

35−word8 :: Word8 -> L.ByteString -> Property

36−word8 w s = parseBS (P.word8 w) (L.cons w s) === Just w

37−

38−skip :: Word8 -> L.ByteString -> Property

39−skip w s =

40− case (parseBS (P.skip (<w)) s, L.uncons s) of

41− (Nothing, mcs) -> maybe (property True) (expectFailure . it) mcs

42− (Just _, mcs) -> maybe (property False) it mcs

43− where it cs = liftOp "<" (<) (fst cs) w

44−

45−anyWord8 :: L.ByteString -> Property

46−anyWord8 s

47− | L.null s = p === Nothing

48− | otherwise = p === Just (L.head s)

49− where p = parseBS P.anyWord8 s

50−

51−notWord8 :: Word8 -> NonEmptyList Word8 -> Property

52−notWord8 w (NonEmpty s) = parseBS (P.notWord8 w) bs === if v == w

53− then Nothing

54− else Just v

55− where v = L.head bs

56− bs = L.pack s

57−

58−peekWord8 :: L.ByteString -> Property

59−peekWord8 s

60− | L.null s = p === Just (Nothing, s)

61− | otherwise = p === Just (Just (L.head s), s)

62− where p = parseBS ((,) <$> P.peekWord8 <*> P.takeLazyByteString) s

63−

64−peekWord8' :: L.ByteString -> Property

65−peekWord8' s = parseBS P.peekWord8' s === (fst <$> L.uncons s)

66−

67−string :: L.ByteString -> L.ByteString -> Property

68−string s t = parseBS (P.string s') (s `L.append` t) === Just s'

69− where s' = toStrictBS s

70−

71−stringCI :: ASCII L.ByteString -> ASCII L.ByteString -> Property

72−stringCI (ASCII s) (ASCII t) =

73− parseBS (P8.stringCI up) (s `L.append` t) === Just s'

74− where s' = toStrictBS s

75− up = B8.map toUpper s'

76−

77−strings :: L.ByteString -> L.ByteString -> L.ByteString -> Property

78−strings s t u =

79− parseBS (P.string (toStrictBS s) >> P.string t') (L.concat [s,t,u])

80− === Just t'

81− where t' = toStrictBS t

82−

83−skipWhile :: Word8 -> L.ByteString -> Property

84−skipWhile w s =

85− let t = L.dropWhile (<=w) s

86− in case PL.parse (P.skipWhile (<=w)) s of

87− PL.Done t' () -> t === t'

88− _ -> property False

89−

90−takeCount :: Positive Int -> L.ByteString -> Property

91−takeCount (Positive k) s =

92− case parseBS (P.take k) s of

93− Nothing -> liftOp ">" (>) (fromIntegral k) (L.length s)

94− Just _s -> liftOp "<=" (<=) (fromIntegral k) (L.length s)

95−

96−takeWhile :: Word8 -> L.ByteString -> Property

97−takeWhile w s =

98− let (h,t) = L.span (==w) s

99− in case PL.parse (P.takeWhile (==w)) s of

100− PL.Done t' h' -> t === t' .&&. toStrictBS h === h'

101− _ -> property False

102−

103−take :: Int -> L.ByteString -> Property

104−take n s = maybe (property $ L.length s < fromIntegral n)

105− (=== B.take n (toStrictBS s)) $

106− parseBS (P.take n) s

107−

108−takeByteString :: L.ByteString -> Property

109−takeByteString s = maybe (property False) (=== toStrictBS s) .

110− parseBS P.takeByteString $ s

111−

112−takeLazyByteString :: L.ByteString -> Property

113−takeLazyByteString s = maybe (property False) (=== s) .

114− parseBS P.takeLazyByteString $ s

115−

116−takeWhile1 :: Word8 -> L.ByteString -> Property

117−takeWhile1 w s =

118− let s' = L.cons w s

119− (h,t) = L.span (<=w) s'

120− in case PL.parse (P.takeWhile1 (<=w)) s' of

121− PL.Done t' h' -> t === t' .&&. toStrictBS h === h'

122− _ -> property False

123−

124−takeTill :: Word8 -> L.ByteString -> Property

125−takeTill w s =

126− let (h,t) = L.break (==w) s

127− in case PL.parse (P.takeTill (==w)) s of

128− PL.Done t' h' -> t === t' .&&. toStrictBS h === h'

129− _ -> property False

130−

131−takeWhile1_empty :: Property

132−takeWhile1_empty = parseBS (P.takeWhile1 undefined) L.empty === Nothing

133−

134−endOfInput :: L.ByteString -> Property

135−endOfInput s = parseBS P.endOfInput s === if L.null s

136− then Just ()

137− else Nothing

138−

139−endOfLine :: L.ByteString -> Property

140−endOfLine s =

141− case (parseBS P8.endOfLine s, L8.uncons s) of

142− (Nothing, mcs) -> maybe (property True) (expectFailure . eol) mcs

143− (Just _, mcs) -> maybe (property False) eol mcs

144− where eol (c,s') = c === '\n' .||.

145− (c, fst <$> L8.uncons s') === ('\r', Just '\n')

146−

147−scan :: L.ByteString -> Positive Int64 -> Property

148−scan s (Positive k) = parseBS p s === Just (toStrictBS $ L.take k s)

149− where p = P.scan k $ \ n _ ->

150− if n > 0 then let !n' = n - 1 in Just n' else Nothing

151−

152−members :: [Word8] -> Property

153−members s = property $ all (`S.memberWord8` set) s

154− where set = S.fromList s

155−

156−nonmembers :: [Word8] -> [Word8] -> Property

157−nonmembers s s' = property . not . any (`S.memberWord8` set) $ filter (not . (`elem` s)) s'

158− where set = S.fromList s

159−

160−tests :: [TestTree]

161−tests = [

162− testProperty "anyWord8" anyWord8

163− , testProperty "endOfInput" endOfInput

164− , testProperty "endOfLine" endOfLine

165− , testProperty "notWord8" notWord8

166− , testProperty "peekWord8" peekWord8

167− , testProperty "peekWord8'" peekWord8'

168− , testProperty "satisfy" satisfy

169− , testProperty "satisfyWith" satisfyWith

170− , testProperty "scan" scan

171− , testProperty "skip" skip

172− , testProperty "skipWhile" skipWhile

173− , testProperty "string" string

174− , testProperty "stringCI" stringCI

175− , testProperty "strings" strings

176− , testProperty "take" take

177− , testProperty "takeByteString" takeByteString

178− , testProperty "takeCount" takeCount

179− , testProperty "takeLazyByteString" takeLazyByteString

180− , testProperty "takeTill" takeTill

181− , testProperty "takeWhile" takeWhile

182− , testProperty "takeWhile1" takeWhile1

183− , testProperty "takeWhile1_empty" takeWhile1_empty

184− , testProperty "word8" word8

185− , testProperty "members" members

186− , testProperty "nonmembers" nonmembers

187− ]

tests/QC/Combinator.hsdeleted−52

@@ -1,52 +0,0 @@

1−{-# LANGUAGE CPP, OverloadedStrings #-}

2−

3−module QC.Combinator where

4−

5−#if !MIN_VERSION_base(4,8,0)

6−import Control.Applicative ((<*>), (<$>), (<*), (*>))

7−#endif

8−import Data.Maybe (fromJust, isJust)

9−import Data.Word (Word8)

10−import QC.Common (Repack, parseBS, repackBS, toLazyBS)

11−import Test.Tasty (TestTree)

12−import Test.Tasty.QuickCheck (testProperty)

13−import Test.QuickCheck

14−import qualified Data.Attoparsec.ByteString.Char8 as P

15−import qualified Data.Attoparsec.Combinator as C

16−import qualified Data.ByteString as B

17−import qualified Data.ByteString.Char8 as B8

18−

19−choice :: NonEmptyList (NonEmptyList Word8) -> Gen Property

20−choice (NonEmpty xs) = do

21− let ys = map (B.pack . getNonEmpty) xs

22− return . forAll (repackBS <$> arbitrary <*> elements ys) $

23− maybe False (`elem` ys) . parseBS (C.choice (map P.string ys))

24−

25−count :: Positive (Small Int) -> Repack -> B.ByteString -> Bool

26−count (Positive (Small n)) rs s =

27− (length <$> parseBS (C.count n (P.string s)) input) == Just n

28− where input = repackBS rs (B.concat (replicate (n+1) s))

29−

30−lookAhead :: NonEmptyList Word8 -> Bool

31−lookAhead (NonEmpty xs) =

32− let ys = B.pack xs

33− withLookAheadThenConsume = (\x y -> (x, y)) <$> C.lookAhead (P.string ys) <*> P.string ys

34− mr = parseBS withLookAheadThenConsume $ toLazyBS ys

35− in isJust mr && fst (fromJust mr) == snd (fromJust mr)

36−

37−match :: Int -> NonNegative Int -> NonNegative Int -> Repack -> Bool

38−match n (NonNegative x) (NonNegative y) rs =

39− parseBS (P.match parser) (repackBS rs input) == Just (input, n)

40− where parser = P.skipWhile (=='x') *> P.signed P.decimal <*

41− P.skipWhile (=='y')

42− input = B.concat [

43− B8.replicate x 'x', B8.pack (show n), B8.replicate y 'y'

44− ]

45−

46−tests :: [TestTree]

47−tests = [

48− testProperty "choice" choice

49− , testProperty "count" count

50− , testProperty "lookAhead" lookAhead

51− , testProperty "match" match

52− ]

tests/QC/Common.hsdeleted−113

@@ -1,113 +0,0 @@

1−{-# LANGUAGE CPP, FlexibleInstances #-}

2−{-# OPTIONS_GHC -fno-warn-orphans #-}

3−module QC.Common

4− (

5− ASCII(..)

6− , parseBS

7− , parseT

8− , toLazyBS

9− , toStrictBS

10− , Repack

11− , repackBS

12− , repackBS_

13− , repackT

14− , repackT_

15− , liftOp

16− ) where

17−

18−#if !MIN_VERSION_base(4,8,0)

19−import Control.Applicative ((<*>), (<$>))

20−#endif

21−import Data.Char (isAlpha)

22−import Test.QuickCheck

23−import Test.QuickCheck.Unicode (shrinkChar, string)

24−import qualified Data.ByteString as B

25−import qualified Data.ByteString.Lazy as BL

26−import qualified Data.Text as T

27−import qualified Data.Text.Lazy as TL

28−import qualified Data.Attoparsec.ByteString.Lazy as BL

29−import qualified Data.Attoparsec.Text.Lazy as TL

30−

31−#if !MIN_VERSION_base(4,4,0)

32−-- This should really be a dependency on the random package :-(

33−instance Random Word8 where

34− randomR = integralRandomR

35− random = randomR (minBound,maxBound)

36−

37−instance Arbitrary Word8 where

38− arbitrary = choose (minBound, maxBound)

39−#endif

40−

41−parseBS :: BL.Parser r -> BL.ByteString -> Maybe r

42−parseBS p = BL.maybeResult . BL.parse p

43−

44−parseT :: TL.Parser r -> TL.Text -> Maybe r

45−parseT p = TL.maybeResult . TL.parse p

46−

47−toStrictBS :: BL.ByteString -> B.ByteString

48−toStrictBS = B.concat . BL.toChunks

49−

50−toLazyBS :: B.ByteString -> BL.ByteString

51−toLazyBS = BL.fromChunks . (:[])

52−

53−instance Arbitrary B.ByteString where

54− arbitrary = B.pack <$> arbitrary

55− shrink = map B.pack . shrink . B.unpack

56−

57−instance Arbitrary BL.ByteString where

58− arbitrary = repackBS <$> arbitrary <*> arbitrary

59− shrink = map BL.pack . shrink . BL.unpack

60−

61−newtype ASCII a = ASCII { fromASCII :: a }

62− deriving (Eq, Ord, Show)

63−

64−instance Arbitrary (ASCII B.ByteString) where

65− arbitrary = (ASCII . B.pack) <$> listOf (choose (0,127))

66− shrink = map (ASCII . B.pack) . shrink . B.unpack . fromASCII

67−

68−instance Arbitrary (ASCII BL.ByteString) where

69− arbitrary = ASCII <$> (repackBS <$> arbitrary <*> (fromASCII <$> arbitrary))

70− shrink = map (ASCII . BL.pack) . shrink . BL.unpack . fromASCII

71−

72−type Repack = NonEmptyList (Positive (Small Int))

73−

74−repackBS :: Repack -> B.ByteString -> BL.ByteString

75−repackBS (NonEmpty bs) =

76− BL.fromChunks . repackBS_ (map (getSmall . getPositive) bs)

77−

78−repackBS_ :: [Int] -> B.ByteString -> [B.ByteString]

79−repackBS_ = go . cycle

80− where go (b:bs) s

81− | B.null s = []

82− | otherwise = let (h,t) = B.splitAt b s

83− in h : go bs t

84− go _ _ = error "unpossible"

85−

86−instance Arbitrary T.Text where

87− arbitrary = T.pack <$> string

88− shrink = map T.pack . shrinkList shrinkChar . T.unpack

89−

90−instance Arbitrary TL.Text where

91− arbitrary = TL.pack <$> string

92− shrink = map TL.pack . shrinkList shrinkChar . TL.unpack

93−

94−repackT :: Repack -> T.Text -> TL.Text

95−repackT (NonEmpty bs) =

96− TL.fromChunks . repackT_ (map (getSmall . getPositive) bs)

97−

98−repackT_ :: [Int] -> T.Text -> [T.Text]

99−repackT_ = go . cycle

100− where go (b:bs) s

101− | T.null s = []

102− | otherwise = let (h,t) = T.splitAt b s

103− in h : go bs t

104− go _ _ = error "unpossible"

105−

106−liftOp :: (Show a, Testable prop) =>

107− String -> (a -> a -> prop) -> a -> a -> Property

108−liftOp name f x y = counterexample desc (f x y)

109− where op = case name of

110− (c:_) | isAlpha c -> " `" ++ name ++ "` "

111− | otherwise -> " " ++ name ++ " "

112− _ -> " ??? "

113− desc = "not (" ++ show x ++ op ++ show y ++ ")"

tests/QC/IPv6/Internal.hsdeleted−316

@@ -1,316 +0,0 @@

1−-- -----------------------------------------------------------------------------

2−

3−-- |

4−-- Module : Text.IPv6Addr

6−-- License : BSD-Style

7−-- Maintainer : michel.boucey@gmail.com

8−--

9−-- Dealing with IPv6 address text representations, canonization and manipulations.

10−--

11−

12−-- -----------------------------------------------------------------------------

13−

14−{-# LANGUAGE OverloadedStrings #-}

15−

16−module QC.IPv6.Internal where {-

17− ( expandTokens

18− , macAddr

19− , maybeIPv6AddrTokens

20− , ipv4AddrToIPv6AddrTokens

21− , ipv6TokensToText

22− , ipv6TokensToIPv6Addr

23− , isIPv6Addr

24− , maybeTokIPv6Addr

25− , maybeTokPureIPv6Addr

26− , fromDoubleColon

27− , fromIPv6Addr

28− , toDoubleColon

29− ) where -}

30−

31−import Debug.Trace

32−import Control.Monad (replicateM)

33−import Data.Attoparsec.Text

34−import Data.Char (isDigit,isHexDigit,toLower)

35−import Data.Monoid ((<>))

36−import Control.Applicative ((<|>),(<*))

37−import Data.List (group,isSuffixOf,elemIndex,elemIndices,intersperse)

38−import Data.Word (Word32)

39−import Numeric (showHex)

40−import qualified Data.Text as T

41−import qualified Data.Text.Read as R (decimal)

42−import Data.Maybe (fromJust)

43−

44−import QC.IPv6.Types

45−

46−tok0 = "0"

47−

48−-- | Returns the 'T.Text' of an IPv6 address.

49−fromIPv6Addr :: IPv6Addr -> T.Text

50−fromIPv6Addr (IPv6Addr t) = t

51−

52−-- | Given an arbitrary list of 'IPv6AddrToken', returns the corresponding 'T.Text'.

53−ipv6TokensToText :: [IPv6AddrToken] -> T.Text

54−ipv6TokensToText l = T.concat $ map ipv6TokenToText l

55−

56−-- | Returns the corresponding 'T.Text' of an IPv6 address token.

57−ipv6TokenToText :: IPv6AddrToken -> T.Text

58−ipv6TokenToText (SixteenBit s) = s

59−ipv6TokenToText Colon = ":"

60−ipv6TokenToText DoubleColon = "::"

61−ipv6TokenToText AllZeros = tok0 -- "A single 16-bit 0000 field MUST be represented as 0" (RFC 5952, 4.1)

62−ipv6TokenToText (IPv4Addr a) = a

63−

64−-- | Returns 'True' if a list of 'IPv6AddrToken' constitutes a valid IPv6 Address.

65−isIPv6Addr :: [IPv6AddrToken] -> Bool

66−isIPv6Addr [] = False

67−isIPv6Addr [DoubleColon] = True

68−isIPv6Addr [DoubleColon,SixteenBit tok1] = True

69−isIPv6Addr tks =

70− diffNext tks && (do

71− let cdctks = countDoubleColon tks

72− let lentks = length tks

73− let lasttk = last tks

74− let lenconst = (lentks == 15 && cdctks == 0) || (lentks < 15 && cdctks == 1)

75− firstValidToken tks &&

76− (case countIPv4Addr tks of

77− 0 -> case lasttk of

78− SixteenBit _ -> lenconst

79− DoubleColon -> lenconst

80− AllZeros -> lenconst

81− _ -> False

82− 1 -> case lasttk of

83− IPv4Addr _ -> (lentks == 13 && cdctks == 0) || (lentks < 12 && cdctks == 1)

84− _ -> False

85− otherwise -> False))

86− where diffNext [] = False

87− diffNext [_] = True

88− diffNext (t:ts) = do

89− let h = head ts

90− case t of

91− SixteenBit _ -> case h of

92− SixteenBit _ -> False

93− AllZeros -> False

94− _ -> diffNext ts

95− AllZeros -> case h of

96− SixteenBit _ -> False

97− AllZeros -> False

98− _ -> diffNext ts

99− _ -> diffNext ts

100− firstValidToken l =

101− case head l of

102− SixteenBit _ -> True

103− DoubleColon -> True

104− AllZeros -> True

105− _ -> False

106− countDoubleColon l = length $ elemIndices DoubleColon l

107− tok1 = "1"

108−

109−countIPv4Addr = foldr oneMoreIPv4Addr 0

110− where

111− oneMoreIPv4Addr t c = case t of

112− IPv4Addr _ -> c + 1

113− otherwise -> c

114−

115−-- | This is the main function which returns 'Just' the list of a tokenized IPv6

116−-- address text representation validated against RFC 4291 and canonized

117−-- in conformation with RFC 5952, or 'Nothing'.

118−maybeTokIPv6Addr :: T.Text -> Maybe [IPv6AddrToken]

119−maybeTokIPv6Addr t =

120− case maybeIPv6AddrTokens t of

121− Just ltks -> if isIPv6Addr ltks

122− then Just $ (ipv4AddrReplacement . toDoubleColon . fromDoubleColon) ltks

123− else Nothing

124− Nothing -> Nothing

125− where

126− ipv4AddrReplacement ltks =

127− if ipv4AddrRewrite ltks

128− then init ltks ++ ipv4AddrToIPv6AddrTokens (last ltks)

129− else ltks

130−

131−-- | Returns 'Just' the list of tokenized pure IPv6 address, always rewriting an

132−-- embedded IPv4 address if present.

133−maybeTokPureIPv6Addr :: T.Text -> Maybe [IPv6AddrToken]

134−maybeTokPureIPv6Addr t = do

135− ltks <- maybeIPv6AddrTokens t

136− if isIPv6Addr ltks

137− then Just $ (toDoubleColon . ipv4AddrReplacement . fromDoubleColon) ltks

138− else Nothing

139− where

140− ipv4AddrReplacement ltks' = init ltks' ++ ipv4AddrToIPv6AddrTokens (last ltks')

141−

142−-- | Tokenize a 'T.Text' into 'Just' a list of 'IPv6AddrToken', or 'Nothing'.

143−maybeIPv6AddrTokens :: T.Text -> Maybe [IPv6AddrToken]

144−maybeIPv6AddrTokens s =

145− case readText s of

146− Done r l -> traceShow (r,l) $ if r==T.empty then Just l else Nothing

147− Fail {} -> Nothing

148− where

149− readText s = feed (parse (many1 $ ipv4Addr <|> sixteenBit <|> doubleColon <|> colon) s) T.empty

150−

151−-- | An embedded IPv4 address have to be rewritten to output a pure IPv6 Address

152−-- text representation in hexadecimal digits. But some well-known prefixed IPv6

153−-- addresses have to keep visible in their text representation the fact that

154−-- they deals with IPv4 to IPv6 transition process (RFC 5952 Section 5):

155−--

156−-- IPv4-compatible IPv6 address like "::1.2.3.4"

157−--

158−-- IPv4-mapped IPv6 address like "::ffff:1.2.3.4"

159−--

160−-- IPv4-translated address like "::ffff:0:1.2.3.4"

161−--

162−-- IPv4-translatable address like "64:ff9b::1.2.3.4"

163−--

164−-- ISATAP address like "fe80::5efe:1.2.3.4"

165−--

166−ipv4AddrRewrite :: [IPv6AddrToken] -> Bool

167−ipv4AddrRewrite tks =

168− case last tks of

169− IPv4Addr _ -> do

170− let itks = init tks

171− not (itks == [DoubleColon]

172− || itks == [DoubleColon,SixteenBit tokffff,Colon]

173− || itks == [DoubleColon,SixteenBit tokffff,Colon,AllZeros,Colon]

174− || itks == [SixteenBit "64",Colon,SixteenBit "ff9b",DoubleColon]

175− || [SixteenBit "200",Colon,SixteenBit tok5efe,Colon] `isSuffixOf` itks

176− || [AllZeros,Colon,SixteenBit tok5efe,Colon] `isSuffixOf` itks

177− || [DoubleColon,SixteenBit tok5efe,Colon] `isSuffixOf` itks)

178− _ -> False

179− where

180− tokffff = "ffff"

181− tok5efe = "5efe"

182−

183−-- | Rewrites an embedded 'IPv4Addr' into the corresponding list of pure 'IPv6Addr' tokens.

184−--

185−-- > ipv4AddrToIPv6AddrTokens (IPv4Addr "127.0.0.1") == [SixteenBits "7f0",Colon,SixteenBits "1"]

186−--

187−ipv4AddrToIPv6AddrTokens :: IPv6AddrToken -> [IPv6AddrToken]

188−ipv4AddrToIPv6AddrTokens t =

189− case t of

190− IPv4Addr a -> do

191− let m = toHex a

192− [ SixteenBit ((!!) m 0 <> addZero ((!!) m 1))

193− , Colon

194− , SixteenBit ((!!) m 2 <> addZero ((!!) m 3)) ]

195− _ -> [t]

196− where

197− toHex a = map (\x -> T.pack $ showHex (read (T.unpack x)::Int) "") $ T.split (=='.') a

198− addZero d = if T.length d == 1 then tok0 <> d else d

199−

200−expandTokens :: [IPv6AddrToken] -> [IPv6AddrToken]

201−expandTokens = map expandToken

202− where expandToken (SixteenBit s) = SixteenBit $ T.justifyRight 4 '0' s

203− expandToken AllZeros = SixteenBit "0000"

204− expandToken t = t

205−

206−fromDoubleColon :: [IPv6AddrToken] -> [IPv6AddrToken]

207−fromDoubleColon tks =

208− if DoubleColon `notElem` tks

209− then tks

210− else do let s = splitAt (fromJust $ elemIndex DoubleColon tks) tks

211− let fsts = fst s

212− let snds = if not (null (snd s)) then tail(snd s) else []

213− let fste = if null fsts then [] else fsts ++ [Colon]

214− let snde = if null snds then [] else Colon : snds

215− fste ++ allZerosTokensReplacement(quantityOfAllZerosTokenToReplace tks) ++ snde

216− where

217− allZerosTokensReplacement x = intersperse Colon (replicate x AllZeros)

218− quantityOfAllZerosTokenToReplace x =

219− ntks tks - foldl (\c x -> if (x /= DoubleColon) && (x /= Colon) then c+1 else c) 0 x

220− where

221− ntks tks = if countIPv4Addr tks == 1 then 7 else 8

222−

223−toDoubleColon :: [IPv6AddrToken] -> [IPv6AddrToken]

224−toDoubleColon tks =

225− zerosToDoubleColon tks (zerosRunToReplace $ zerosRunsList tks)

226− where

227− zerosToDoubleColon :: [IPv6AddrToken] -> (Int,Int) -> [IPv6AddrToken]

228− -- No all zeros token, so no double colon replacement...

229− zerosToDoubleColon ls (_,0) = ls

230− -- "The symbol '::' MUST NOT be used to shorten just one 16-bit 0 field" (RFC 5952 4.2.2)

231− zerosToDoubleColon ls (_,1) = ls

232− zerosToDoubleColon ls (i,l) =

233− let ls' = filter (/= Colon) ls

234− in intersperse Colon (Prelude.take i ls') ++ [DoubleColon] ++ intersperse Colon (drop (i+l) ls')

235− zerosRunToReplace t =

236− let l = longestLengthZerosRun t

237− in (firstLongestZerosRunIndex t l,l)

238− where

239− firstLongestZerosRunIndex x y = sum . snd . unzip $ Prelude.takeWhile (/=(True,y)) x

240− longestLengthZerosRun x =

241− maximum $ map longest x

242− where longest t = case t of

243− (True,i) -> i

244− _ -> 0

245− zerosRunsList x = map helper $ groupZerosRuns x

246− where

247− helper h = (head h == AllZeros, lh) where lh = length h

248− groupZerosRuns = group . filter (/= Colon)

249−

250−ipv6TokensToIPv6Addr :: [IPv6AddrToken] -> Maybe IPv6Addr

251−ipv6TokensToIPv6Addr l = Just $ IPv6Addr $ ipv6TokensToText l

252−

253−fullSixteenBit :: T.Text -> Maybe IPv6AddrToken

254−fullSixteenBit t =

255− case parse ipv6AddrFullChunk t of

256− Done a b -> if a==T.empty then Just $ SixteenBit $ T.pack b else Nothing

257− _ -> Nothing

258−

259−macAddr :: Parser (Maybe [IPv6AddrToken])

260−macAddr = do

261− n1 <- count 2 hexaChar <* ":"

262− n2 <- count 2 hexaChar <* ":"

263− n3 <- count 2 hexaChar <* ":"

264− n4 <- count 2 hexaChar <* ":"

265− n5 <- count 2 hexaChar <* ":"

266− n6 <- count 2 hexaChar

267− return $ maybeIPv6AddrTokens $ T.pack $ concat [n1,n2,n3,n4,n5,n6]

268−

269−sixteenBit :: Parser IPv6AddrToken

270−sixteenBit = do

271− r <- ipv6AddrFullChunk <|> count 3 hexaChar <|> count 2 hexaChar <|> count 1 hexaChar

272− -- "Leading zeros MUST be suppressed" (RFC 5952, 4.1)

273− let r' = T.dropWhile (=='0') $ T.pack r

274− return $ if T.null r'

275− then AllZeros

276− -- Hexadecimal digits MUST be in lowercase (RFC 5952 4.3)

277− else SixteenBit $ T.toLower r'

278−

279−ipv4Addr :: Parser IPv6AddrToken

280−ipv4Addr = do

281− n1 <- manyDigits <* "."

282− if n1 /= T.empty

283− then do n2 <- manyDigits <* "."

284− if n2 /= T.empty

285− then do n3 <- manyDigits <* "."

286− if n3 /= T.empty

287− then do n4 <- manyDigits

288− if n4 /= T.empty

289− then return $ IPv4Addr $ T.intercalate "." [n1,n2,n3,n4]

290− else parserFailure

291− else parserFailure

292− else parserFailure

293− else parserFailure

294− where

295− parserFailure = fail "ipv4Addr parsing failure"

296− manyDigits = do

297− ds <- takeWhile1 isDigit

298− case R.decimal ds of

299− Right (n,_) -> return (if n < 256 then T.pack $ show n else T.empty)

300− Left _ -> return T.empty

301−

302−doubleColon :: Parser IPv6AddrToken

303−doubleColon = do

304− string "::"

305− return DoubleColon

306−

307−colon :: Parser IPv6AddrToken

308−colon = do

309− string ":"

310− return Colon

311−

312−ipv6AddrFullChunk :: Parser String

313−ipv6AddrFullChunk = count 4 hexaChar

314−

315−hexaChar :: Parser Char

316−hexaChar = satisfy (inClass "0-9a-fA-F")

tests/QC/IPv6/Types.hsdeleted−29

@@ -1,29 +0,0 @@

1−-- -----------------------------------------------------------------------------

2−

3−-- |

4−-- Module : Text.IPv6Addr

6−-- License : BSD-Style

7−-- Maintainer : michel.boucey@gmail.com

8−--

9−-- Dealing with IPv6 address text representations, canonization and manipulations.

10−--

11−

12−-- -----------------------------------------------------------------------------

13−

14−module QC.IPv6.Types where

15−

16−import qualified Data.Text as T

17−

18−data IPv6Addr = IPv6Addr T.Text

19−

20−instance Show IPv6Addr where

21− show (IPv6Addr addr) = T.unpack addr

22−

23−data IPv6AddrToken

24− = SixteenBit T.Text -- ^ A four hexadecimal digits group representing a 16-Bit chunk

25− | AllZeros -- ^ An all zeros 16-Bit chunk

26− | Colon -- ^ A separator between 16-Bit chunks

27− | DoubleColon -- ^ A double-colon stands for a unique compression of many consecutive 16-Bit chunks

28− | IPv4Addr T.Text -- ^ An embedded IPv4 address as representation of the last 32-Bit

29− deriving (Eq,Show)

tests/QC/Rechunked.hsdeleted−56

@@ -1,56 +0,0 @@

1−{-# LANGUAGE BangPatterns #-}

2−

3−module QC.Rechunked (

4− rechunkBS

5− , rechunkT

6− ) where

7−

8−import Control.Monad (forM, forM_)

9−import Control.Monad.ST (ST, runST)

10−import Data.List (unfoldr)

11−import Test.QuickCheck (Gen, choose)

12−import qualified Data.ByteString as B

13−import qualified Data.Text as T

14−import qualified Data.Vector as V

15−import qualified Data.Vector.Generic as G

16−import qualified Data.Vector.Generic.Mutable as M

17−

18−rechunkBS :: B.ByteString -> Gen [B.ByteString]

19−rechunkBS = fmap (map B.copy) . rechunk_ B.splitAt B.length

20−

21−rechunkT :: T.Text -> Gen [T.Text]

22−rechunkT = fmap (map T.copy) . rechunk_ T.splitAt T.length

23−

24−rechunk_ :: (Int -> a -> (a,a)) -> (a -> Int) -> a -> Gen [a]

25−rechunk_ split len xs = (unfoldr go . (,) xs) `fmap` rechunkSizes (len xs)

26− where go (b,r:rs) = Just (h, (t,rs))

27− where (h,t) = split r b

28− go (_,_) = Nothing

29−

30−rechunkSizes :: Int -> Gen [Int]

31−rechunkSizes n0 = shuffle =<< loop [] (0:repeat 1) n0

32− where loop _ [] _ = error "it's 2015, where's my Stream type?"

33− loop acc (lb:lbs) n

34− | n <= 0 = shuffle (reverse acc)

35− | otherwise = do

36− !i <- choose (lb,n)

37− loop (i:acc) lbs (n-i)

38−

39−shuffle :: [Int] -> Gen [Int]

40−shuffle (0:xs) = (0:) `fmap` shuffle xs

41−shuffle xs = fisherYates xs

42−

43−fisherYates :: [a] -> Gen [a]

44−fisherYates xs = (V.toList . V.backpermute v) `fmap` swapIndices (G.length v)

45− where

46− v = V.fromList xs

47− swapIndices n0 = do

48− swaps <- forM [0..n] $ \i -> ((,) i) `fmap` choose (i,n)

49− return (runST (swapAll swaps))

50− where

51− n = n0 - 1

52− swapAll :: [(Int,Int)] -> ST s (V.Vector Int)

53− swapAll ijs = do

54− mv <- G.unsafeThaw (G.enumFromTo 0 n :: V.Vector Int)

55− forM_ ijs $ uncurry (M.swap mv)

56− G.unsafeFreeze mv

tests/QC/Simple.hsdeleted−37

@@ -1,37 +0,0 @@

1−{-# LANGUAGE OverloadedStrings #-}

2−{-# OPTIONS_GHC -fno-warn-missing-signatures #-}

3−

4−module QC.Simple (

5− tests

6− ) where

7−

8−import Control.Applicative ((<|>))

9−import Data.ByteString (ByteString)

10−import Data.List (foldl')

11−import Data.Maybe (fromMaybe)

12−import QC.Rechunked (rechunkBS)

13−import Test.Tasty (TestTree)

14−import Test.Tasty.QuickCheck (testProperty)

15−import Test.QuickCheck (Property, counterexample, forAll)

16−import qualified Data.Attoparsec.ByteString.Char8 as A

17−

18−t_issue75 = expect issue75 "ab" (A.Done "" "b")

19−

20−issue75 :: A.Parser ByteString

21−issue75 = "a" >> ("b" <|> "")

22−

23−expect :: (Show r, Eq r) => A.Parser r -> ByteString -> A.Result r -> Property

24−expect p input wanted =

25− forAll (rechunkBS input) $ \in' ->

26− let result = parse p in'

27− in counterexample (show result ++ " /= " ++ show wanted) $

28− fromMaybe False (A.compareResults result wanted)

29−

30−parse :: A.Parser r -> [ByteString] -> A.Result r

31−parse p (x:xs) = foldl' A.feed (A.parse p x) xs

32−parse p [] = A.parse p ""

33−

34−tests :: [TestTree]

35−tests = [

36− testProperty "issue75" t_issue75

37− ]

tests/QC/Text.hsdeleted−203

@@ -1,203 +0,0 @@

1−{-# LANGUAGE BangPatterns, CPP, OverloadedStrings #-}

2−{-# OPTIONS_GHC -fno-warn-warnings-deprecations #-}

3−module QC.Text (tests) where

4−

5−#if !MIN_VERSION_base(4,8,0)

6−import Control.Applicative ((<*>), (<$>))

7−#endif

8−import Data.Int (Int64)

9−import Data.Word (Word8)

10−import Prelude hiding (take, takeWhile)

11−import QC.Common (liftOp, parseT)

12−import qualified QC.Text.FastSet as FastSet

13−import qualified QC.Text.Regressions as Regressions

14−import Test.Tasty (TestTree, testGroup)

15−import Test.Tasty.QuickCheck (testProperty)

16−import Test.QuickCheck

17−import qualified Data.Attoparsec.Text as P

18−import qualified Data.Attoparsec.Text.Lazy as PL

19−import qualified Data.Attoparsec.Text.FastSet as S

20−import qualified Data.ByteString as BS

21−import qualified Data.Char as Char

22−import qualified Data.Text as T

23−import qualified Data.Text.Encoding as TE

24−import qualified Data.Text.Lazy as L

25−

26−-- Basic byte-level combinators.

27−

28−satisfy :: Char -> L.Text -> Property

29−satisfy w s = parseT (P.satisfy (<=w)) (L.cons w s) === Just w

30−

31−satisfyWith :: Char -> L.Text -> Property

32−satisfyWith c s = parseT (P.satisfyWith id (<=c)) (L.cons c s) === Just c

33−

34−char :: Char -> L.Text -> Property

35−char w s = parseT (P.char w) (L.cons w s) === Just w

36−

37−skip :: Char -> L.Text -> Property

38−skip w s =

39− case (parseT (P.skip (<w)) s, L.uncons s) of

40− (Nothing, mcs) -> maybe (property True) (expectFailure . it) mcs

41− (Just _, mcs) -> maybe (property False) it mcs

42− where it cs = liftOp "<" (<) (fst cs) w

43−

44−anyChar :: L.Text -> Property

45−anyChar s

46− | L.null s = p === Nothing

47− | otherwise = p === Just (L.head s)

48− where p = parseT P.anyChar s

49−

50−notChar :: Char -> NonEmptyList Char -> Property

51−notChar w (NonEmpty s) = parseT (P.notChar w) bs === if v == w

52− then Nothing

53− else Just v

54− where v = L.head bs

55− bs = L.pack s

56−

57−peekChar :: L.Text -> Property

58−peekChar s

59− | L.null s = p === Just (Nothing, s)

60− | otherwise = p === Just (Just (L.head s), s)

61− where p = parseT ((,) <$> P.peekChar <*> P.takeLazyText) s

62−

63−peekChar' :: L.Text -> Property

64−peekChar' s = parseT P.peekChar' s === (fst <$> L.uncons s)

65−

66−string :: L.Text -> L.Text -> Property

67−string s t = parseT (P.string s') (s `L.append` t) === Just s'

68− where s' = toStrict s

69−

70−strings :: L.Text -> L.Text -> L.Text -> Property

71−strings s t u =

72− parseT (P.string (toStrict s) >> P.string t') (L.concat [s,t,u])

73− === Just t'

74− where t' = toStrict t

75−

76−-- | Note: "simple, and efficient" works for well formed input...

77−-- i.e. e.g. Latin1 texts

78−stringCI :: [Word8] -> Property

79−stringCI ws = P.parseOnly (P.stringCI fs) s === Right s

80− where fs = T.toCaseFold s

81− s = TE.decodeLatin1 (BS.pack ws)

82−

83−asciiCI :: T.Text -> Gen Bool

84−asciiCI x =

85− (\s i -> P.parseOnly (P.asciiCI s) i == Right i)

86− <$> maybeModifyCase x

87− <*> maybeModifyCase x

88− where

89− maybeModifyCase s = elements [s, toLower s, toUpper s]

90− toLower = T.map (\c -> if c < Char.chr 127 then Char.toLower c else c)

91− toUpper = T.map (\c -> if c < Char.chr 127 then Char.toUpper c else c)

92−

93−toStrict :: L.Text -> T.Text

94−toStrict = T.concat . L.toChunks

95−

96−skipWhile :: Char -> L.Text -> Property

97−skipWhile w s =

98− let t = L.dropWhile (<=w) s

99− in case PL.parse (P.skipWhile (<=w)) s of

100− PL.Done t' () -> t === t'

101− _ -> property False

102−

103−take :: Int -> L.Text -> Property

104−take n s = maybe (liftOp "<" (<) (L.length s) (fromIntegral n))

105− (=== T.take n (toStrict s)) $

106− parseT (P.take n) s

107−

108−takeText :: L.Text -> Property

109−takeText s = maybe (property False) (=== toStrict s) . parseT P.takeText $ s

110−

111−takeLazyText :: L.Text -> Property

112−takeLazyText s = maybe (property False) (=== s) . parseT P.takeLazyText $ s

113−

114−takeCount :: Positive Int -> L.Text -> Property

115−takeCount (Positive k) s =

116− case parseT (P.take k) s of

117− Nothing -> liftOp ">" (>) (fromIntegral k) (L.length s)

118− Just _s -> liftOp "<=" (<=) (fromIntegral k) (L.length s)

119−

120−takeWhile :: Char -> L.Text -> Property

121−takeWhile w s =

122− let (h,t) = L.span (==w) s

123− in case PL.parse (P.takeWhile (==w)) s of

124− PL.Done t' h' -> t === t' .&&. toStrict h === h'

125− _ -> property False

126−

127−takeWhile1 :: Char -> L.Text -> Property

128−takeWhile1 w s =

129− let s' = L.cons w s

130− (h,t) = L.span (<=w) s'

131− in case PL.parse (P.takeWhile1 (<=w)) s' of

132− PL.Done t' h' -> t === t' .&&. toStrict h === h'

133− _ -> property False

134−

135−takeTill :: Char -> L.Text -> Property

136−takeTill w s =

137− let (h,t) = L.break (==w) s

138− in case PL.parse (P.takeTill (==w)) s of

139− PL.Done t' h' -> t === t' .&&. toStrict h === h'

140− _ -> property False

141−

142−takeWhile1_empty :: Property

143−takeWhile1_empty = parseT (P.takeWhile1 undefined) L.empty === Nothing

144−

145−endOfInput :: L.Text -> Property

146−endOfInput s = parseT P.endOfInput s === if L.null s

147− then Just ()

148− else Nothing

149−

150−endOfLine :: L.Text -> Property

151−endOfLine s =

152− case (parseT P.endOfLine s, L.uncons s) of

153− (Nothing, mcs) -> maybe (property True) (expectFailure . eol) mcs

154− (Just _, mcs) -> maybe (property False) eol mcs

155− where eol (c,s') = c === '\n' .||.

156− (c, fst <$> L.uncons s') === ('\r', Just '\n')

157−

158−scan :: L.Text -> Positive Int64 -> Property

159−-- for some reason, if counterexample is removed, this test fails?

160−scan s (Positive k) = counterexample (show s)

161− $ parseT p s === Just (toStrict $ L.take k s)

162− where p = P.scan k $ \ n _ ->

163− if n > 0 then let !n' = n - 1 in Just n' else Nothing

164−

165−members :: String -> Property

166−members s = property $ all (`S.member` set) s

167− where set = S.fromList s

168−

169−nonmembers :: String -> String -> Property

170−nonmembers s s' = property . not . any (`S.member` set) $ filter (not . (`elem` s)) s'

171− where set = S.fromList s

172−

173−tests :: [TestTree]

174−tests = [

175− testProperty "anyChar" anyChar

176− , testProperty "asciiCI" asciiCI

177− , testProperty "char" char

178− , testProperty "endOfInput" endOfInput

179− , testProperty "endOfLine" endOfLine

180− , testProperty "notChar" notChar

181− , testProperty "peekChar" peekChar

182− , testProperty "peekChar'" peekChar'

183− , testProperty "satisfy" satisfy

184− , testProperty "satisfyWith" satisfyWith

185− , testProperty "scan" scan

186− , testProperty "skip" skip

187− , testProperty "skipWhile" skipWhile

188− , testProperty "string" string

189− , testProperty "strings" strings

190− , testProperty "stringCI" stringCI

191− , testProperty "take" take

192− , testProperty "takeText" takeText

193− , testProperty "takeCount" takeCount

194− , testProperty "takeLazyText" takeLazyText

195− , testProperty "takeTill" takeTill

196− , testProperty "takeWhile" takeWhile

197− , testProperty "takeWhile1" takeWhile1

198− , testProperty "takeWhile1_empty" takeWhile1_empty

199− , testProperty "members" members

200− , testProperty "nonmembers" nonmembers

201− , testGroup "FastSet" FastSet.tests

202− , testGroup "Regressions" Regressions.tests

203− ]

tests/QC/Text/FastSet.hsdeleted−15

@@ -1,15 +0,0 @@

1−module QC.Text.FastSet where

2−

3−import Test.Tasty (TestTree)

4−import Test.Tasty.QuickCheck (testProperty)

5−import Test.QuickCheck

6−import qualified Data.Attoparsec.Text.FastSet as FastSet

7−

8−membershipCorrect :: String -> String -> Property

9−membershipCorrect members others =

10− let fs = FastSet.fromList members

11− correct c = (c `FastSet.member` fs) == (c `elem` members)

12− in property $ all correct (members ++ others)

13−

14−tests :: [TestTree]

15−tests = [ testProperty "membership is correct" membershipCorrect ]

tests/QC/Text/Regressions.hsdeleted−54

@@ -1,54 +0,0 @@

1−{-# LANGUAGE OverloadedStrings #-}

2−

3−module QC.Text.Regressions (

4− tests

5− ) where

6−

7−import Data.Text (Text)

8−import qualified Data.Text as T

9−import Data.List (foldl')

10−import Data.Maybe (fromMaybe)

11−import Data.Char (isLower)

12−import Data.Monoid ((<>))

13−import QC.Rechunked (rechunkT)

14−import Test.Tasty (TestTree)

15−import Test.Tasty.QuickCheck (testProperty)

16−import Test.QuickCheck (Property, counterexample, forAll)

17−import qualified Data.Attoparsec.Text as A

18−

19−

20−--------------------------------------------------------------------------------

21−-- 105 was about runScanner not always returning the final state. The result

22−-- did depend on how the data was fed to the parser.

23−

24−t_issue105 :: Property

25−t_issue105 = expect issue105 "lowER" (A.Done "ER" "low")

26−

27−issue105 :: A.Parser Text

28−issue105 = do

29− (_, firstFourLowercaseLetters) <- A.runScanner "" f

30− return $ firstFourLowercaseLetters

31−

32− where

33− f :: Text -> Char -> Maybe Text

34− f acc c = if T.length acc < 4 && isLower c

35− then Just $ acc <> T.singleton c

36− else Nothing

37−

38−

39−expect :: (Show r, Eq r) => A.Parser r -> Text -> A.Result r -> Property

40−expect p input wanted =

41− forAll (rechunkT input) $ \in' ->

42− let result = parse p in'

43− in counterexample (show result ++ " /= " ++ show wanted) $

44− fromMaybe False (A.compareResults result wanted)

45−

46−parse :: A.Parser r -> [Text] -> A.Result r

47−parse p (x:xs) = foldl' A.feed (A.parse p x) xs

48−parse p [] = A.parse p ""

49−

50−

51−tests :: [TestTree]

52−tests = [

53− testProperty "issue105" t_issue105

54− ]

tests/TestFastSet.hsnew file+25

@@ -0,0 +1,25 @@

1+module Main (main) where

2+

3+import Data.Word (Word8)

4+import qualified Data.Attoparsec.FastSet as F

5+import System.Random (Random(..), RandomGen)

6+import Test.QuickCheck

7+

8+integralRandomR :: (Integral a, RandomGen g) => (a, a) -> g -> (a, g)

9+integralRandomR (a,b) g = case randomR (fromIntegral a :: Int,

10+ fromIntegral b :: Int) g

11+ of (x,g') -> (fromIntegral x, g')

12+

13+instance Random Word8 where

14+ randomR = integralRandomR

15+ random = randomR (minBound,maxBound)

16+

17+instance Arbitrary Word8 where

18+ arbitrary = choose (minBound, maxBound)

19+

20+prop_AllMembers s =

21+ let set = F.fromList s

22+ in all (`F.memberWord8` set) s

23+

24+main = do

25+ quickCheck prop_AllMembers