git.iko.soy/typeable/attoparsec
on 7c412f8 help sign in
287a62d
swap
0 ahead, 780 behind
96 files changed+1745−8816
since splitsnapshots
unifiedsplit
.ghci−1 .gitignore−6 .hgignore−17 .hgtags−63 .travis.yml−161 Data/Attoparsec.hs−23 Data/Attoparsec/ByteString.hs−230 Data/Attoparsec/ByteString/Buffer.hs−156 Data/Attoparsec/ByteString/Char8.hs−572 Data/Attoparsec/ByteString/Internal.hs−536 Data/Attoparsec/ByteString/Lazy.hs−110 Data/Attoparsec/Char8.hs−23 Data/Attoparsec/Combinator.hs−255 Data/Attoparsec/Internal.hs−171 Data/Attoparsec/Internal/Fhthagn.hs−18 Data/Attoparsec/Internal/Types.hs−266 Data/Attoparsec/Lazy.hs−29 Data/Attoparsec/Number.hs−137 Data/Attoparsec/Text.hs−493 Data/Attoparsec/Text/Buffer.hs−172 Data/Attoparsec/Text/FastSet.hs−121 Data/Attoparsec/Text/Internal.hs−549 Data/Attoparsec/Text/Lazy.hs−101 Data/Attoparsec/Types.hs−20 Data/Attoparsec/Zepto.hs−192 README.markdown−23 Setup.hs+2 Setup.lhs−3 attoparsec.cabal−194 benchmarks/Aeson.hs−353 benchmarks/Alternative.hs−20 benchmarks/Benchmarks.hs−126 benchmarks/Common.hs−47 benchmarks/Genome.hs−75 benchmarks/HeadersByteString.hs−37 benchmarks/HeadersByteString/Atto.hs−57 benchmarks/HeadersText.hs−57 benchmarks/IsSpace.hs−123 benchmarks/Links.hs−63 benchmarks/Makefile−10 benchmarks/Numbers.hs−82 benchmarks/Sets.hs−21 benchmarks/TextFastSet.hs−121 benchmarks/Tiny.hs−31 benchmarks/Warp.hs−17 benchmarks/attoparsec-benchmarks.cabal−41 benchmarks/http-request.txt−9 benchmarks/http-response.txt−14 benchmarks/json-data/example.json−88 benchmarks/json-data/geometry.json−1 benchmarks/json-data/integers.json−1 benchmarks/json-data/jp10.json−1 benchmarks/json-data/jp100.json−1 benchmarks/json-data/jp50.json−1 benchmarks/json-data/numbers.json−1 benchmarks/json-data/twitter1.json−1 benchmarks/json-data/twitter10.json−1 benchmarks/json-data/twitter100.json−1 benchmarks/json-data/twitter20.json−1 benchmarks/json-data/twitter50.json−1 benchmarks/med.txt.bz2 benchmarks/warp-3.0.1.1/LICENSE−20 benchmarks/warp-3.0.1.1/Network/Wai/Handler/Warp/ReadInt.hs−67 benchmarks/warp-3.0.1.1/Network/Wai/Handler/Warp/RequestHeader.hs−172 bytestringparser.cabal+34 changelog.md−114 doc/attoparsec-rewired-2.md−93 doc/whats-in-a-parser-1.md−88 examples/Atto_RFC2616.hs−45 examples/Makefile−19 examples/Parsec_RFC2616.hs−88 examples/RFC2616.hs−65 examples/attoparsec-examples.cabal−31 examples/http-requests.txt−494 examples/rfc2616.c−244 src/Data/ParserCombinators/Attoparsec.hs+65 src/Data/ParserCombinators/Attoparsec/Char8.hs+156 Data/Attoparsec/ByteString/FastSet.hs → src/Data/ParserCombinators/Attoparsec/FastSet.hs+39−54 src/Data/ParserCombinators/Attoparsec/Internal.hs+355 src/Data/ParserCombinators/ByteStringParser/Char8.hs+156 src/Data/ParserCombinators/ByteStringParser/FastSet.hs+96 src/Data/ParserCombinators/ByteStringParser/Internal.hs+355 src/Text/ParserCombinators/ByteStringParser.hs+391 src/Text/ParserCombinators/ByteStringParser/FastSet.hs+96 tests/QC.hs−19 tests/QC/Buffer.hs−96 tests/QC/ByteString.hs−187 tests/QC/Combinator.hs−52 tests/QC/Common.hs−113 tests/QC/IPv6/Internal.hs−316 tests/QC/IPv6/Types.hs−29 tests/QC/Rechunked.hs−56 tests/QC/Simple.hs−37 tests/QC/Text.hs−203 tests/QC/Text/FastSet.hs−15 tests/QC/Text/Regressions.hs−54
.ghcideleted−1
@@ -1 +0,0 @@
1−:set -fobject-code -optP-include -optPdist/build/autogen/cabal_macros.h -itests
.gitignoredeleted−6
@@ -1,6 +0,0 @@
1−*.hi
2−*.o
3−/dist/
4−.cabal-sandbox
5−cabal.sandbox.config
6−*.sw[op]
.hgignoredeleted−17
@@ -1,17 +0,0 @@
1−\.(?:aux|eventlog|h[ip]|hs.html|log|[mt]ix|[oa]|orig|prof|ps|rej|swp)$
2−~$
3−^(?:.+/|)\.cabal-sandbox/
4−^(?:.+/|)dist/
5−benchmarks/Arse
6−benchmarks/dist
7−benchmarks/med.txt
8−benchmarks/tiny
9−benchmarks/warp-[0-9]*
10−cabal.sandbox.config
11−examples/c-http
12−examples/http_parser.[ch]
13−hpc.*\.html$
14−
15−syntax: glob
16−.\#*
17−\#*
.hgtagsdeleted−63
@@ -1,63 +0,0 @@
1−187e68710ea1903fdb2fcc78964574982830adc0 0.2
2−9c2929e868fdfe4cb267f1cc9d41bdab31d97640 0.2.1
3−1f5944a3920322fa8e2bb2fbc9382223968a77d7 0.2.2
4−d4934c7fdf544d4e5b2925cada4b91d92a8948c2 0.3
5−91a8667f027294bdf9df7bbe3fe1083a8d09f26c 0.4
6−7ad5cecf582ce41410159040c6a47002ad61613f 0.5
7−d5f93303fb5169d856291fa6cde834b89866a1ed 0.5.1
8−ace3afe105f50a5c90ee135dc72ad306fc3b296c 0.6
9−4e6ad4e2712c82714bb055c261adb376dae4c513 0.7
10−5504cf45797458399d3f840088bd31f84ef1d56d 0.7.1
11−69d4bdcb1e2b35d768ea291886b85cbadd7bf839 0.7.2
12−f20aef71b438d9ab2db399479ae1836e5d98c31c 0.8.0.0
13−31829cff7c795e219d23c582921039c7415cb035 0.8.0.1
14−87b4dc291f43a548bf0d5338c9a6a5f5545496f7 0.8.0.2
15−4948902625875849d6c9d3ac56ec6670d593b1ee 0.8.1.0
16−8b98d031ac4d2dfe322a0e58dcc85d6ca825938a 0.8.1.1
17−8b98d031ac4d2dfe322a0e58dcc85d6ca825938a 0.8.1.1
18−74092eb3c30ebc0d878d37877526ec73c08bce96 0.8.1.1
19−277c0528a1e2751df6e81c0c0747909ddbae1453 0.8.2.0
20−277c0528a1e2751df6e81c0c0747909ddbae1453 0.8.2.0
21−95181c9226105a695a4fb25f0a76540ec0cc7c58 0.8.2.0
22−76c08ffe493594369487fd26f85487f9cc0572f7 0.8.3.0
23−39351efe1d73462a717ce004a2d2f75729c67f3b 0.8.4.0
24−d04f4a8c7afdedddd4828c0844ab2b75bdb90789 0.8.5.0
25−034e03c9d2b74c8c52438896a0098a086809adc6 0.8.5.1
26−9712028a0311a3d12e213727603b5e84a2b8103c 0.8.5.2
27−f4a4d9c2ccb365a8408ee20d2514fac99d44ecb1 0.8.5.3
28−39eeec699da24257b65e7787aebebbb409771812 0.8.6.0
29−cbfbab5a33eb7522af4dd16b4306ef848b5b2350 0.8.6.1
30−7de1dedc888995de3188c757b872ac364cfd1c49 0.9.0.0
31−30d71153204a79666638fcb4765115cbfc8d2d93 0.9.1.0
32−61f6daa5cd357349143e57b8530bd9ba7f55fdf6 0.9.1.1
33−e539c7f6c6ceaa79318177cc3bc149d7b6e7c6c1 0.9.1.2
34−3033c0af33fa3b83d002eb9150acf8949e56f19f 0.10.0.0
35−3033c0af33fa3b83d002eb9150acf8949e56f19f 0.10.0.0
36−d39f15e57df591fb785272ba5d3acf0d70fcb0ff 0.10.0.0
37−33c33d8467265f9f2226a351a59b616a5ace9fbb 0.10.0.1
38−066fc7a19fc07c3b7c50e9b591af3dc5591742a1 0.10.0.2
39−80fa1e1f6e122d3de65ce3d6cd9f3aceaa108977 0.10.0.3
40−80fa1e1f6e122d3de65ce3d6cd9f3aceaa108977 0.10.0.3
41−940330f992c8130d8e17b99f93d570d454c0fa4d 0.10.0.3
42−5702ca99c6ac5cfdd8a864c0e4c61a4db1158d7a 0.10.1.0
43−e8bc38ea66812bf5f24599d3f33480411084affb 0.10.1.1
44−f0bc0f79b70b97a856042386aa8856ac1cad88f1 0.10.2.0
45−030191aa39c97afcad17d365ed114a2eedc04ad4 0.10.3.0
46−ec23283e88c00af34c3144a8775ca4358daea3f7 0.10.4.0
47−6f4b317a12acdd05d67fd9ec55d3defaf37a01eb 0.11.1.0
48−48809d7716468fe2bbc47b191b1d64358daaf6d1 0.11.2.1
49−856a772f83a6e382bbcfe53e221a5a92623b107c 0.11.3.0
50−a3c7a521fd58595d6a470ab890cc54a80dd45bd7 0.11.3.1
51−38326ce07aca6c8c3a014b0d454d2a5bfdbd6a52 0.11.3.2
52−694039f4fc157a8ca5dce37959391615b6c3f535 0.11.3.3
53−1fe92d1838fb1b1afcee1ca18d4970cf7e01956e 0.11.3.4
54−68203a4cb847da905fa44b5aa1942b99d5867ab4 0.12.0.0
55−c9c2b05707b2fffcd749d5817e3e0d04e6ad6d0d 0.12.1.0
56−9157c2b4c35aa5f683b4ac51e6ff52c696bc22e2 0.12.1.1
57−682ba515f7ba62500ad79371b37b90932e0c0e3d 0.12.1.2
58−2066a72b79b478f59a9c7f1839c522fc59ba9af7 0.12.1.3
59−ef875ad3bebef2b6fb1bd7063de6a46a06d0d4b4 0.12.1.4
60−dc1fcff28d13a508f677c7b06af6420877842493 0.12.1.5
61−013e04e4526bfd5e9e4a611b42e6f03c413bea91 0.12.1.6
62−0ddbce995b77b8db391b4d6519f13feddf4b5bf3 0.13.0.0
63−46c16463ec20ad46c9cd0bfb1050c4268f34b749 0.13.0.1
.travis.ymldeleted−161
@@ -1,161 +0,0 @@
1−# This Travis job script has been generated by a script via
2−#
3−# haskell-ci '--tests-jobs=>=7.4' '--no-benchmarks' 'attoparsec.cabal'
4−#
5−# For more information, see https://github.com/haskell-CI/haskell-ci
6−#
7−# version: 0.3.20190815
8−#
9−language: c
10−dist: xenial
11−git:
12− # whether to recursively clone submodules
13− submodules: false
14−cache:
15− directories:
16− - $HOME/.cabal/packages
17− - $HOME/.cabal/store
18−before_cache:
19− - rm -fv $CABALHOME/packages/hackage.haskell.org/build-reports.log
20− # remove files that are regenerated by 'cabal update'
21− - rm -fv $CABALHOME/packages/hackage.haskell.org/00-index.*
22− - rm -fv $CABALHOME/packages/hackage.haskell.org/*.json
23− - rm -fv $CABALHOME/packages/hackage.haskell.org/01-index.cache
24− - rm -fv $CABALHOME/packages/hackage.haskell.org/01-index.tar
25− - rm -fv $CABALHOME/packages/hackage.haskell.org/01-index.tar.idx
26− - rm -rfv $CABALHOME/packages/head.hackage
27−matrix:
28− include:
29− - compiler: ghc-8.8.1
30− addons: {"apt":{"sources":["hvr-ghc"],"packages":["ghc-8.8.1","cabal-install-3.0"]}}
31− - compiler: ghc-8.6.5
32− addons: {"apt":{"sources":["hvr-ghc"],"packages":["ghc-8.6.5","cabal-install-2.4"]}}
33− - compiler: ghc-8.4.4
34− addons: {"apt":{"sources":["hvr-ghc"],"packages":["ghc-8.4.4","cabal-install-2.4"]}}
35− - compiler: ghc-8.2.2
36− addons: {"apt":{"sources":["hvr-ghc"],"packages":["ghc-8.2.2","cabal-install-2.4"]}}
37− - compiler: ghc-8.0.2
38− addons: {"apt":{"sources":["hvr-ghc"],"packages":["ghc-8.0.2","cabal-install-2.4"]}}
39− - compiler: ghc-7.10.3
40− addons: {"apt":{"sources":["hvr-ghc"],"packages":["ghc-7.10.3","cabal-install-2.4"]}}
41− - compiler: ghc-7.8.4
42− addons: {"apt":{"sources":["hvr-ghc"],"packages":["ghc-7.8.4","cabal-install-2.4"]}}
43− - compiler: ghc-7.6.3
44− addons: {"apt":{"sources":["hvr-ghc"],"packages":["ghc-7.6.3","cabal-install-2.4"]}}
45− - compiler: ghc-7.4.2
46− addons: {"apt":{"sources":["hvr-ghc"],"packages":["ghc-7.4.2","cabal-install-2.4"]}}
47− - compiler: ghc-7.2.2
48− addons: {"apt":{"sources":["hvr-ghc"],"packages":["ghc-7.2.2","cabal-install-2.4"]}}
49− - compiler: ghc-7.0.4
50− addons: {"apt":{"sources":["hvr-ghc"],"packages":["ghc-7.0.4","cabal-install-2.4"]}}
51−before_install:
52− - HC=$(echo "/opt/$CC/bin/ghc" | sed 's/-/\//')
53− - WITHCOMPILER="-w $HC"
54− - HCPKG="$HC-pkg"
55− - unset CC
56− - CABAL=/opt/ghc/bin/cabal
57− - CABALHOME=$HOME/.cabal
58− - export PATH="$CABALHOME/bin:$PATH"
59− - TOP=$(pwd)
60− - "HCNUMVER=$(${HC} --numeric-version|perl -ne '/^(\\d+)\\.(\\d+)\\.(\\d+)(\\.(\\d+))?$/; print(10000 * $1 + 100 * $2 + ($3 == 0 ? $5 != 1 : $3))')"
61− - echo $HCNUMVER
62− - CABAL="$CABAL -vnormal+nowrap+markoutput"
63− - set -o pipefail
64− - |
65− echo 'function blue(s) { printf "\033[0;34m" s "\033[0m " }' >> .colorful.awk
66− echo 'BEGIN { state = "output"; }' >> .colorful.awk
67− echo '/^-----BEGIN CABAL OUTPUT-----$/ { state = "cabal" }' >> .colorful.awk
68− echo '/^-----END CABAL OUTPUT-----$/ { state = "output" }' >> .colorful.awk
69− echo '!/^(-----BEGIN CABAL OUTPUT-----|-----END CABAL OUTPUT-----)/ {' >> .colorful.awk
70− echo ' if (state == "cabal") {' >> .colorful.awk
71− echo ' print blue($0)' >> .colorful.awk
72− echo ' } else {' >> .colorful.awk
73− echo ' print $0' >> .colorful.awk
74− echo ' }' >> .colorful.awk
75− echo '}' >> .colorful.awk
76− - cat .colorful.awk
77− - |
78− color_cabal_output () {
79− awk -f $TOP/.colorful.awk
80− }
81− - echo text | color_cabal_output
82−install:
83− - ${CABAL} --version
84− - echo "$(${HC} --version) [$(${HC} --print-project-git-commit-id 2> /dev/null || echo '?')]"
85− - TEST=--enable-tests
86− - if [ $HCNUMVER -lt 70400 ] ; then TEST=--disable-tests ; fi
87− - BENCH=--enable-benchmarks
88− - BENCH=--disable-benchmarks
89− - HEADHACKAGE=false
90− - rm -f $CABALHOME/config
91− - |
92− echo "verbose: normal +nowrap +markoutput" >> $CABALHOME/config
93− echo "remote-build-reporting: anonymous" >> $CABALHOME/config
94− echo "write-ghc-environment-files: always" >> $CABALHOME/config
95− echo "remote-repo-cache: $CABALHOME/packages" >> $CABALHOME/config
96− echo "logs-dir: $CABALHOME/logs" >> $CABALHOME/config
97− echo "world-file: $CABALHOME/world" >> $CABALHOME/config
98− echo "extra-prog-path: $CABALHOME/bin" >> $CABALHOME/config
99− echo "symlink-bindir: $CABALHOME/bin" >> $CABALHOME/config
100− echo "installdir: $CABALHOME/bin" >> $CABALHOME/config
101− echo "build-summary: $CABALHOME/logs/build.log" >> $CABALHOME/config
102− echo "store-dir: $CABALHOME/store" >> $CABALHOME/config
103− echo "install-dirs user" >> $CABALHOME/config
104− echo " prefix: $CABALHOME" >> $CABALHOME/config
105− echo "repository hackage.haskell.org" >> $CABALHOME/config
106− echo " url: http://hackage.haskell.org/" >> $CABALHOME/config
107− - cat $CABALHOME/config
108− - rm -fv cabal.project cabal.project.local cabal.project.freeze
109− - travis_retry ${CABAL} v2-update -v
110− # Generate cabal.project
111− - rm -rf cabal.project cabal.project.local cabal.project.freeze
112− - touch cabal.project
113− - |
114− echo "packages: ." >> cabal.project
115− - |
116− - "for pkg in $($HCPKG list --simple-output); do echo $pkg | sed 's/-[^-]*$//' | (grep -vE -- '^(attoparsec)$' || true) | sed 's/^/constraints: /' | sed 's/$/ installed/' >> cabal.project.local; done"
117− - cat cabal.project || true
118− - cat cabal.project.local || true
119− - if [ -f "./configure.ac" ]; then (cd "." && autoreconf -i); fi
120− - ${CABAL} v2-freeze $WITHCOMPILER ${TEST} ${BENCH} | color_cabal_output
121− - "cat cabal.project.freeze | sed -E 's/^(constraints: *| *)//' | sed 's/any.//'"
122− - rm cabal.project.freeze
123− - ${CABAL} v2-build $WITHCOMPILER ${TEST} ${BENCH} --dep -j2 all | color_cabal_output
124− - ${CABAL} v2-build $WITHCOMPILER --disable-tests --disable-benchmarks --dep -j2 all | color_cabal_output
125−script:
126− - DISTDIR=$(mktemp -d /tmp/dist-test.XXXX)
127− # Packaging...
128− - ${CABAL} v2-sdist all | color_cabal_output
129− # Unpacking...
130− - mv dist-newstyle/sdist/*.tar.gz ${DISTDIR}/
131− - cd ${DISTDIR} || false
132− - find . -maxdepth 1 -type f -name '*.tar.gz' -exec tar -xvf '{}' \;
133− - find . -maxdepth 1 -type f -name '*.tar.gz' -exec rm '{}' \;
134− - PKGDIR_attoparsec="$(find . -maxdepth 1 -type d -regex '.*/attoparsec-[0-9.]*')"
135− # Generate cabal.project
136− - rm -rf cabal.project cabal.project.local cabal.project.freeze
137− - touch cabal.project
138− - |
139− echo "packages: ${PKGDIR_attoparsec}" >> cabal.project
140− - |
141− - "for pkg in $($HCPKG list --simple-output); do echo $pkg | sed 's/-[^-]*$//' | (grep -vE -- '^(attoparsec)$' || true) | sed 's/^/constraints: /' | sed 's/$/ installed/' >> cabal.project.local; done"
142− - cat cabal.project || true
143− - cat cabal.project.local || true
144− # Building...
145− # this builds all libraries and executables (without tests/benchmarks)
146− - ${CABAL} v2-build $WITHCOMPILER --disable-tests --disable-benchmarks all | color_cabal_output
147− # Building with tests and benchmarks...
148− # build & run tests, build benchmarks
149− - ${CABAL} v2-build $WITHCOMPILER ${TEST} ${BENCH} all | color_cabal_output
150− # Testing...
151− - if [ $HCNUMVER -ge 70400 ] ; then ${CABAL} v2-test $WITHCOMPILER ${TEST} ${BENCH} all | color_cabal_output ; fi
152− # cabal check...
153− - (cd ${PKGDIR_attoparsec} && ${CABAL} -vnormal check)
154− # haddock...
155− - ${CABAL} v2-haddock $WITHCOMPILER ${TEST} ${BENCH} all | color_cabal_output
156− # Building without installed constraints for packages in global-db...
157− - rm -f cabal.project.local
158− - ${CABAL} v2-build $WITHCOMPILER --disable-tests --disable-benchmarks all | color_cabal_output
159−
160−# REGENDATA ["--tests-jobs=>=7.4","--no-benchmarks","attoparsec.cabal"]
161−# EOF
Data/Attoparsec.hsdeleted−23
@@ -1,23 +0,0 @@
1−-- |
2−-- Module : Data.Attoparsec
3−-- Copyright : Bryan O'Sullivan 2007-2015
4−-- License : BSD3
5−--
6−-- Maintainer : bos@serpentine.com
7−-- Stability : experimental
8−-- Portability : unknown
9−--
10−-- Simple, efficient combinator parsing for
11−-- 'Data.ByteString.ByteString' strings, loosely based on the Parsec
12−-- library.
13−--
14−-- This module is deprecated. Use "Data.Attoparsec.ByteString"
15−-- instead.
16−
17−module Data.Attoparsec
18− {-# DEPRECATED "This module will be removed in the next major release." #-}
19− (
20− module Data.Attoparsec.ByteString
21− ) where
22−
23−import Data.Attoparsec.ByteString
Data/Attoparsec/ByteString.hsdeleted−230
@@ -1,230 +0,0 @@
1−{-# LANGUAGE CPP #-}
2−#if __GLASGOW_HASKELL__ >= 702
3−{-# LANGUAGE Trustworthy #-}
4−#endif
5−-- |
6−-- Module : Data.Attoparsec.ByteString
7−-- Copyright : Bryan O'Sullivan 2007-2015
8−-- License : BSD3
9−--
10−-- Maintainer : bos@serpentine.com
11−-- Stability : experimental
12−-- Portability : unknown
13−--
14−-- Simple, efficient combinator parsing for 'B.ByteString' strings,
15−-- loosely based on the Parsec library.
16−
17−module Data.Attoparsec.ByteString
18− (
19− -- * Differences from Parsec
20− -- $parsec
21−
22− -- * Incremental input
23− -- $incremental
24−
25− -- * Performance considerations
26− -- $performance
27−
28− -- * Parser types
29− I.Parser
30− , Result
31− , T.IResult(..)
32− , I.compareResults
33−
34− -- * Running parsers
35− , parse
36− , feed
37− , I.parseOnly
38− , parseWith
39− , parseTest
40−
41− -- ** Result conversion
42− , maybeResult
43− , eitherResult
44−
45− -- * Parsing individual bytes
46− , I.word8
47− , I.anyWord8
48− , I.notWord8
49− , I.satisfy
50− , I.satisfyWith
51− , I.skip
52−
53− -- ** Lookahead
54− , I.peekWord8
55− , I.peekWord8'
56−
57− -- ** Byte classes
58− , I.inClass
59− , I.notInClass
60−
61− -- * Efficient string handling
62− , I.string
63− , I.skipWhile
64− , I.take
65− , I.scan
66− , I.runScanner
67− , I.takeWhile
68− , I.takeWhile1
69− , I.takeTill
70−
71− -- ** Consume all remaining input
72− , I.takeByteString
73− , I.takeLazyByteString
74−
75− -- * Combinators
76− , try
77− , (<?>)
78− , choice
79− , count
80− , option
81− , many'
82− , many1
83− , many1'
84− , manyTill
85− , manyTill'
86− , sepBy
87− , sepBy'
88− , sepBy1
89− , sepBy1'
90− , skipMany
91− , skipMany1
92− , eitherP
93− , I.match
94− -- * State observation and manipulation functions
95− , I.endOfInput
96− , I.atEnd
97− ) where
98−
99−import Data.Attoparsec.Combinator
100−import Data.List (intercalate)
101−import qualified Data.Attoparsec.ByteString.Internal as I
102−import qualified Data.Attoparsec.Internal as I
103−import qualified Data.ByteString as B
104−import Data.Attoparsec.ByteString.Internal (Result, parse)
105−import qualified Data.Attoparsec.Internal.Types as T
106−
107−-- $parsec
108−--
109−-- Compared to Parsec 3, attoparsec makes several tradeoffs. It is
110−-- not intended for, or ideal for, all possible uses.
111−--
112−-- * While attoparsec can consume input incrementally, Parsec cannot.
113−-- Incremental input is a huge deal for efficient and secure network
114−-- and system programming, since it gives much more control to users
115−-- of the library over matters such as resource usage and the I/O
116−-- model to use.
117−--
118−-- * Much of the performance advantage of attoparsec is gained via
119−-- high-performance parsers such as 'I.takeWhile' and 'I.string'.
120−-- If you use complicated combinators that return lists of bytes or
121−-- characters, there is less performance difference between the two
122−-- libraries.
123−--
124−-- * Unlike Parsec 3, attoparsec does not support being used as a
125−-- monad transformer.
126−--
127−-- * attoparsec is specialised to deal only with strict 'B.ByteString'
128−-- input. Efficiency concerns rule out both lists and lazy
129−-- bytestrings. The usual use for lazy bytestrings would be to
130−-- allow consumption of very large input without a large footprint.
131−-- For this need, attoparsec's incremental input provides an
132−-- excellent substitute, with much more control over when input
133−-- takes place. If you must use lazy bytestrings, see the
134−-- "Data.Attoparsec.ByteString.Lazy" module, which feeds lazy chunks
135−-- to a regular parser.
136−--
137−-- * Parsec parsers can produce more helpful error messages than
138−-- attoparsec parsers. This is a matter of focus: attoparsec avoids
139−-- the extra book-keeping in favour of higher performance.
140−
141−-- $incremental
142−--
143−-- attoparsec supports incremental input, meaning that you can feed it
144−-- a bytestring that represents only part of the expected total amount
145−-- of data to parse. If your parser reaches the end of a fragment of
146−-- input and could consume more input, it will suspend parsing and
147−-- return a 'T.Partial' continuation.
148−--
149−-- Supplying the 'T.Partial' continuation with a bytestring will
150−-- resume parsing at the point where it was suspended, with the
151−-- bytestring you supplied used as new input at the end of the
152−-- existing input. You must be prepared for the result of the resumed
153−-- parse to be another 'T.Partial' continuation.
154−--
155−-- To indicate that you have no more input, supply the 'T.Partial'
156−-- continuation with an empty bytestring.
157−--
158−-- Remember that some parsing combinators will not return a result
159−-- until they reach the end of input. They may thus cause 'T.Partial'
160−-- results to be returned.
161−--
162−-- If you do not need support for incremental input, consider using
163−-- the 'I.parseOnly' function to run your parser. It will never
164−-- prompt for more input.
165−--
166−-- /Note/: incremental input does /not/ imply that attoparsec will
167−-- release portions of its internal state for garbage collection as it
168−-- proceeds. Its internal representation is equivalent to a single
169−-- 'ByteString': if you feed incremental input to a parser, it will
170−-- require memory proportional to the amount of input you supply.
171−-- (This is necessary to support arbitrary backtracking.)
172−
173−-- $performance
174−--
175−-- If you write an attoparsec-based parser carefully, it can be
176−-- realistic to expect it to perform similarly to a hand-rolled C
177−-- parser (measuring megabytes parsed per second).
178−--
179−-- To actually achieve high performance, there are a few guidelines
180−-- that it is useful to follow.
181−--
182−-- Use the 'B.ByteString'-oriented parsers whenever possible,
183−-- e.g. 'I.takeWhile1' instead of 'many1' 'I.anyWord8'. There is
184−-- about a factor of 100 difference in performance between the two
185−-- kinds of parser.
186−--
187−-- For very simple byte-testing predicates, write them by hand instead
188−-- of using 'I.inClass' or 'I.notInClass'. For instance, both of
189−-- these predicates test for an end-of-line byte, but the first is
190−-- much faster than the second:
191−--
192−-- >endOfLine_fast w = w == 13 || w == 10
193−-- >endOfLine_slow = inClass "\r\n"
194−--
195−-- Make active use of benchmarking and profiling tools to measure,
196−-- find the problems with, and improve the performance of your parser.
197−
198−-- | Run a parser and print its result to standard output.
199−parseTest :: (Show a) => I.Parser a -> B.ByteString -> IO ()
200−parseTest p s = print (parse p s)
201−
202−-- | Run a parser with an initial input string, and a monadic action
203−-- that can supply more input if needed.
204−parseWith :: Monad m =>
205− (m B.ByteString)
206− -- ^ An action that will be executed to provide the parser
207− -- with more input, if necessary. The action must return an
208− -- 'B.empty' string when there is no more input available.
209− -> I.Parser a
210− -> B.ByteString
211− -- ^ Initial input for the parser.
212− -> m (Result a)
213−parseWith refill p s = step $ parse p s
214− where step (T.Partial k) = (step . k) =<< refill
215− step r = return r
216−{-# INLINE parseWith #-}
217−
218−-- | Convert a 'Result' value to a 'Maybe' value. A 'T.Partial' result
219−-- is treated as failure.
220−maybeResult :: Result r -> Maybe r
221−maybeResult (T.Done _ r) = Just r
222−maybeResult _ = Nothing
223−
224−-- | Convert a 'Result' value to an 'Either' value. A 'T.Partial'
225−-- result is treated as failure.
226−eitherResult :: Result r -> Either String r
227−eitherResult (T.Done _ r) = Right r
228−eitherResult (T.Fail _ [] msg) = Left msg
229−eitherResult (T.Fail _ ctxs msg) = Left (intercalate " > " ctxs ++ ": " ++ msg)
230−eitherResult _ = Left "Result: incomplete input"
Data/Attoparsec/ByteString/Buffer.hsdeleted−156
@@ -1,156 +0,0 @@
1−{-# LANGUAGE BangPatterns #-}
2−-- |
3−-- Module : Data.Attoparsec.ByteString.Buffer
4−-- Copyright : Bryan O'Sullivan 2007-2015
5−-- License : BSD3
6−--
7−-- Maintainer : bos@serpentine.com
8−-- Stability : experimental
9−-- Portability : GHC
10−--
11−-- An "immutable" buffer that supports cheap appends.
12−--
13−-- A Buffer is divided into an immutable read-only zone, followed by a
14−-- mutable area that we've preallocated, but not yet written to.
15−--
16−-- We overallocate at the end of a Buffer so that we can cheaply
17−-- append. Since a user of an existing Buffer cannot see past the end
18−-- of its immutable zone into the data that will change during an
19−-- append, this is safe.
20−--
21−-- Once we run out of space at the end of a Buffer, we do the usual
22−-- doubling of the buffer size.
23−--
24−-- The fact of having a mutable buffer really helps with performance,
25−-- but it does have a consequence: if someone misuses the Partial API
26−-- that attoparsec uses by calling the same continuation repeatedly
27−-- (which never makes sense in practice), they could overwrite data.
28−--
29−-- Since the API *looks* pure, it should *act* pure, too, so we use
30−-- two generation counters (one mutable, one immutable) to track the
31−-- number of appends to a mutable buffer. If the counters ever get out
32−-- of sync, someone is appending twice to a mutable buffer, so we
33−-- duplicate the entire buffer in order to preserve the immutability
34−-- of its older self.
35−--
36−-- While we could go a step further and gain protection against API
37−-- abuse on a multicore system, by use of an atomic increment
38−-- instruction to bump the mutable generation counter, that would be
39−-- very expensive, and feels like it would also be in the realm of the
40−-- ridiculous. Clients should never call a continuation more than
41−-- once; we lack a linear type system that could enforce this; and
42−-- there's only so far we should go to accommodate broken uses.
43−
44−module Data.Attoparsec.ByteString.Buffer
45− (
46− Buffer
47− , buffer
48− , unbuffer
49− , pappend
50− , length
51− , unsafeIndex
52− , substring
53− , unsafeDrop
54− ) where
55−
56−import Control.Exception (assert)
57−import Data.ByteString.Internal (ByteString(..), memcpy, nullForeignPtr)
58−import Data.Attoparsec.Internal.Fhthagn (inlinePerformIO)
59−import Data.List (foldl1')
60−import Data.Monoid as Mon (Monoid(..))
61−import Data.Semigroup (Semigroup(..))
62−import Data.Word (Word8)
63−import Foreign.ForeignPtr (ForeignPtr, withForeignPtr)
64−import Foreign.Ptr (castPtr, plusPtr)
65−import Foreign.Storable (peek, peekByteOff, poke, sizeOf)
66−import GHC.ForeignPtr (mallocPlainForeignPtrBytes)
67−import Prelude hiding (length)
68−
69−-- If _cap is zero, this buffer is empty.
70−data Buffer = Buf {
71− _fp :: {-# UNPACK #-} !(ForeignPtr Word8)
72− , _off :: {-# UNPACK #-} !Int
73− , _len :: {-# UNPACK #-} !Int
74− , _cap :: {-# UNPACK #-} !Int
75− , _gen :: {-# UNPACK #-} !Int
76− }
77−
78−instance Show Buffer where
79− showsPrec p = showsPrec p . unbuffer
80−
81−-- | The initial 'Buffer' has no mutable zone, so we can avoid all
82−-- copies in the (hopefully) common case of no further input being fed
83−-- to us.
84−buffer :: ByteString -> Buffer
85−buffer (PS fp off len) = Buf fp off len len 0
86−
87−unbuffer :: Buffer -> ByteString
88−unbuffer (Buf fp off len _ _) = PS fp off len
89−
90−instance Semigroup Buffer where
91− (Buf _ _ _ 0 _) <> b = b
92− a <> (Buf _ _ _ 0 _) = a
93− buf <> (Buf fp off len _ _) = append buf fp off len
94−
95−instance Monoid Buffer where
96− mempty = Buf nullForeignPtr 0 0 0 0
97−
98− mappend = (<>)
99−
100− mconcat [] = Mon.mempty
101− mconcat xs = foldl1' mappend xs
102−
103−pappend :: Buffer -> ByteString -> Buffer
104−pappend (Buf _ _ _ 0 _) bs = buffer bs
105−pappend buf (PS fp off len) = append buf fp off len
106−
107−append :: Buffer -> ForeignPtr a -> Int -> Int -> Buffer
108−append (Buf fp0 off0 len0 cap0 gen0) !fp1 !off1 !len1 =
109− inlinePerformIO . withForeignPtr fp0 $ \ptr0 ->
110− withForeignPtr fp1 $ \ptr1 -> do
111− let genSize = sizeOf (0::Int)
112− newlen = len0 + len1
113− gen <- if gen0 == 0
114− then return 0
115− else peek (castPtr ptr0)
116− if gen == gen0 && newlen <= cap0
117− then do
118− let newgen = gen + 1
119− poke (castPtr ptr0) newgen
120− memcpy (ptr0 `plusPtr` (off0+len0))
121− (ptr1 `plusPtr` off1)
122− (fromIntegral len1)
123− return (Buf fp0 off0 newlen cap0 newgen)
124− else do
125− let newcap = newlen * 2
126− fp <- mallocPlainForeignPtrBytes (newcap + genSize)
127− withForeignPtr fp $ \ptr_ -> do
128− let ptr = ptr_ `plusPtr` genSize
129− newgen = 1
130− poke (castPtr ptr_) newgen
131− memcpy ptr (ptr0 `plusPtr` off0) (fromIntegral len0)
132− memcpy (ptr `plusPtr` len0) (ptr1 `plusPtr` off1)
133− (fromIntegral len1)
134− return (Buf fp genSize newlen newcap newgen)
135−
136−length :: Buffer -> Int
137−length (Buf _ _ len _ _) = len
138−{-# INLINE length #-}
139−
140−unsafeIndex :: Buffer -> Int -> Word8
141−unsafeIndex (Buf fp off len _ _) i = assert (i >= 0 && i < len) .
142− inlinePerformIO . withForeignPtr fp $ flip peekByteOff (off+i)
143−{-# INLINE unsafeIndex #-}
144−
145−substring :: Int -> Int -> Buffer -> ByteString
146−substring s l (Buf fp off len _ _) =
147− assert (s >= 0 && s <= len) .
148− assert (l >= 0 && l <= len-s) $
149− PS fp (off+s) l
150−{-# INLINE substring #-}
151−
152−unsafeDrop :: Int -> Buffer -> ByteString
153−unsafeDrop s (Buf fp off len _ _) =
154− assert (s >= 0 && s <= len) $
155− PS fp (off+s) (len-s)
156−{-# INLINE unsafeDrop #-}
Data/Attoparsec/ByteString/Char8.hsdeleted−572
@@ -1,572 +0,0 @@
1−{-# LANGUAGE BangPatterns, CPP, FlexibleInstances, TypeFamilies,
2− TypeSynonymInstances, GADTs #-}
3−#if __GLASGOW_HASKELL__ >= 702
4−{-# LANGUAGE Trustworthy #-} -- Imports internal modules
5−#endif
6−{-# OPTIONS_GHC -fno-warn-orphans -fno-warn-warnings-deprecations #-}
7−
8−-- |
9−-- Module : Data.Attoparsec.ByteString.Char8
10−-- Copyright : Bryan O'Sullivan 2007-2015
11−-- License : BSD3
12−--
13−-- Maintainer : bos@serpentine.com
14−-- Stability : experimental
15−-- Portability : unknown
16−--
17−-- Simple, efficient, character-oriented combinator parsing for
18−-- 'B.ByteString' strings, loosely based on the Parsec library.
19−
20−module Data.Attoparsec.ByteString.Char8
21− (
22− -- * Character encodings
23− -- $encodings
24−
25− -- * Parser types
26− Parser
27− , A.Result
28− , A.IResult(..)
29− , I.compareResults
30−
31− -- * Running parsers
32− , A.parse
33− , A.feed
34− , A.parseOnly
35− , A.parseWith
36− , A.parseTest
37−
38− -- ** Result conversion
39− , A.maybeResult
40− , A.eitherResult
41−
42− -- * Parsing individual characters
43− , char
44− , char8
45− , anyChar
46− , notChar
47− , satisfy
48−
49− -- ** Lookahead
50− , peekChar
51− , peekChar'
52−
53− -- ** Special character parsers
54− , digit
55− , letter_iso8859_15
56− , letter_ascii
57− , space
58−
59− -- ** Fast predicates
60− , isDigit
61− , isDigit_w8
62− , isAlpha_iso8859_15
63− , isAlpha_ascii
64− , isSpace
65− , isSpace_w8
66−
67− -- *** Character classes
68− , inClass
69− , notInClass
70−
71− -- * Efficient string handling
72− , I.string
73− , I.stringCI
74− , skipSpace
75− , skipWhile
76− , I.take
77− , scan
78− , takeWhile
79− , takeWhile1
80− , takeTill
81−
82− -- ** String combinators
83− -- $specalt
84− , (.*>)
85− , (<*.)
86−
87− -- ** Consume all remaining input
88− , I.takeByteString
89− , I.takeLazyByteString
90−
91− -- * Text parsing
92− , I.endOfLine
93− , isEndOfLine
94− , isHorizontalSpace
95−
96− -- * Numeric parsers
97− , decimal
98− , hexadecimal
99− , signed
100− , double
101− , Number(..)
102− , number
103− , rational
104− , scientific
105−
106− -- * Combinators
107− , try
108− , (<?>)
109− , choice
110− , count
111− , option
112− , many'
113− , many1
114− , many1'
115− , manyTill
116− , manyTill'
117− , sepBy
118− , sepBy'
119− , sepBy1
120− , sepBy1'
121− , skipMany
122− , skipMany1
123− , eitherP
124− , I.match
125− -- * State observation and manipulation functions
126− , I.endOfInput
127− , I.atEnd
128− ) where
129−
130−#if !MIN_VERSION_base(4,8,0)
131−import Control.Applicative (pure, (*>), (<*), (<$>))
132−import Data.Word (Word)
133−#endif
134−import Control.Applicative ((<|>))
135−import Control.Monad (void, when)
136−import Data.Attoparsec.ByteString.FastSet (charClass, memberChar)
137−import Data.Attoparsec.ByteString.Internal (Parser)
138−import Data.Attoparsec.Combinator
139−import Data.Attoparsec.Number (Number(..))
140−import Data.Bits (Bits, (.|.), shiftL)
141−import Data.ByteString.Internal (c2w, w2c)
142−import Data.Int (Int8, Int16, Int32, Int64)
143−import Data.String (IsString(..))
144−import Data.Scientific (Scientific)
145−import qualified Data.Scientific as Sci
146−import Data.Word (Word8, Word16, Word32, Word64)
147−import Prelude hiding (takeWhile)
148−import qualified Data.Attoparsec.ByteString as A
149−import qualified Data.Attoparsec.ByteString.Internal as I
150−import qualified Data.Attoparsec.Internal as I
151−import qualified Data.ByteString as B8
152−import qualified Data.ByteString.Char8 as B
153−
154−instance (a ~ B.ByteString) => IsString (Parser a) where
155− fromString = I.string . B.pack
156−
157−-- $encodings
158−--
159−-- This module is intended for parsing text that is
160−-- represented using an 8-bit character set, e.g. ASCII or
161−-- ISO-8859-15. It /does not/ make any attempt to deal with character
162−-- encodings, multibyte characters, or wide characters. In
163−-- particular, all attempts to use characters above code point U+00FF
164−-- will give wrong answers.
165−--
166−-- Code points below U+0100 are simply translated to and from their
167−-- numeric values, so e.g. the code point U+00A4 becomes the byte
168−-- @0xA4@ (which is the Euro symbol in ISO-8859-15, but the generic
169−-- currency sign in ISO-8859-1). Haskell 'Char' values above U+00FF
170−-- are truncated, so e.g. U+1D6B7 is truncated to the byte @0xB7@.
171−
172−-- | Consume input as long as the predicate returns 'True', and return
173−-- the consumed input.
174−--
175−-- This parser requires the predicate to succeed on at least one byte
176−-- of input: it will fail if the predicate never returns 'True' or if
177−-- there is no input left.
178−takeWhile1 :: (Char -> Bool) -> Parser B.ByteString
179−takeWhile1 p = I.takeWhile1 (p . w2c)
180−{-# INLINE takeWhile1 #-}
181−
182−-- | The parser @satisfy p@ succeeds for any byte for which the
183−-- predicate @p@ returns 'True'. Returns the byte that is actually
184−-- parsed.
185−--
186−-- >digit = satisfy isDigit
187−-- > where isDigit c = c >= '0' && c <= '9'
188−satisfy :: (Char -> Bool) -> Parser Char
189−satisfy = I.satisfyWith w2c
190−{-# INLINE satisfy #-}
191−
192−-- | Match a letter, in the ISO-8859-15 encoding.
193−letter_iso8859_15 :: Parser Char
194−letter_iso8859_15 = satisfy isAlpha_iso8859_15 <?> "letter_iso8859_15"
195−{-# INLINE letter_iso8859_15 #-}
196−
197−-- | Match a letter, in the ASCII encoding.
198−letter_ascii :: Parser Char
199−letter_ascii = satisfy isAlpha_ascii <?> "letter_ascii"
200−{-# INLINE letter_ascii #-}
201−
202−-- | A fast alphabetic predicate for the ISO-8859-15 encoding
203−--
204−-- /Note/: For all character encodings other than ISO-8859-15, and
205−-- almost all Unicode code points above U+00A3, this predicate gives
206−-- /wrong answers/.
207−isAlpha_iso8859_15 :: Char -> Bool
208−isAlpha_iso8859_15 c = (c >= 'a' && c <= 'z') || (c >= 'A' && c <= 'Z') ||
209− (c >= '\166' && moby c)
210− where moby = notInClass "\167\169\171-\179\182\183\185\187\191\215\247"
211− {-# NOINLINE moby #-}
212−{-# INLINE isAlpha_iso8859_15 #-}
213−
214−-- | A fast alphabetic predicate for the ASCII encoding
215−--
216−-- /Note/: For all character encodings other than ASCII, and
217−-- almost all Unicode code points above U+007F, this predicate gives
218−-- /wrong answers/.
219−isAlpha_ascii :: Char -> Bool
220−isAlpha_ascii c = (c >= 'a' && c <= 'z') || (c >= 'A' && c <= 'Z')
221−{-# INLINE isAlpha_ascii #-}
222−
223−-- | Parse a single digit.
224−digit :: Parser Char
225−digit = satisfy isDigit <?> "digit"
226−{-# INLINE digit #-}
227−
228−-- | A fast digit predicate.
229−isDigit :: Char -> Bool
230−isDigit c = c >= '0' && c <= '9'
231−{-# INLINE isDigit #-}
232−
233−-- | A fast digit predicate.
234−isDigit_w8 :: Word8 -> Bool
235−isDigit_w8 w = w - 48 <= 9
236−{-# INLINE isDigit_w8 #-}
237−
238−-- | Match any character.
239−anyChar :: Parser Char
240−anyChar = satisfy $ const True
241−{-# INLINE anyChar #-}
242−
243−-- | Match any character, to perform lookahead. Returns 'Nothing' if
244−-- end of input has been reached. Does not consume any input.
245−--
246−-- /Note/: Because this parser does not fail, do not use it with
247−-- combinators such as 'many', because such parsers loop until a
248−-- failure occurs. Careless use will thus result in an infinite loop.
249−peekChar :: Parser (Maybe Char)
250−peekChar = (fmap w2c) `fmap` I.peekWord8
251−{-# INLINE peekChar #-}
252−
253−-- | Match any character, to perform lookahead. Does not consume any
254−-- input, but will fail if end of input has been reached.
255−peekChar' :: Parser Char
256−peekChar' = w2c `fmap` I.peekWord8'
257−{-# INLINE peekChar' #-}
258−
259−-- | Fast predicate for matching ASCII space characters.
260−--
261−-- /Note/: This predicate only gives correct answers for the ASCII
262−-- encoding. For instance, it does not recognise U+00A0 (non-breaking
263−-- space) as a space character, even though it is a valid ISO-8859-15
264−-- byte. For a Unicode-aware and only slightly slower predicate,
265−-- use 'Data.Char.isSpace'
266−isSpace :: Char -> Bool
267−isSpace c = (c == ' ') || ('\t' <= c && c <= '\r')
268−{-# INLINE isSpace #-}
269−
270−-- | Fast 'Word8' predicate for matching ASCII space characters.
271−isSpace_w8 :: Word8 -> Bool
272−isSpace_w8 w = w == 32 || w - 9 <= 4
273−{-# INLINE isSpace_w8 #-}
274−
275−
276−-- | Parse a space character.
277−--
278−-- /Note/: This parser only gives correct answers for the ASCII
279−-- encoding. For instance, it does not recognise U+00A0 (non-breaking
280−-- space) as a space character, even though it is a valid ISO-8859-15
281−-- byte.
282−space :: Parser Char
283−space = satisfy isSpace <?> "space"
284−{-# INLINE space #-}
285−
286−-- | Match a specific character.
287−char :: Char -> Parser Char
288−char c = satisfy (== c) <?> [c]
289−{-# INLINE char #-}
290−
291−-- | Match a specific character, but return its 'Word8' value.
292−char8 :: Char -> Parser Word8
293−char8 c = I.satisfy (== c2w c) <?> [c]
294−{-# INLINE char8 #-}
295−
296−-- | Match any character except the given one.
297−notChar :: Char -> Parser Char
298−notChar c = satisfy (/= c) <?> "not " ++ [c]
299−{-# INLINE notChar #-}
300−
301−-- | Match any character in a set.
302−--
303−-- >vowel = inClass "aeiou"
304−--
305−-- Range notation is supported.
306−--
307−-- >halfAlphabet = inClass "a-nA-N"
308−--
309−-- To add a literal \'-\' to a set, place it at the beginning or end
310−-- of the string.
311−inClass :: String -> Char -> Bool
312−inClass s = (`memberChar` mySet)
313− where mySet = charClass s
314−{-# INLINE inClass #-}
315−
316−-- | Match any character not in a set.
317−notInClass :: String -> Char -> Bool
318−notInClass s = not . inClass s
319−{-# INLINE notInClass #-}
320−
321−-- | Consume input as long as the predicate returns 'True', and return
322−-- the consumed input.
323−--
324−-- This parser does not fail. It will return an empty string if the
325−-- predicate returns 'False' on the first byte of input.
326−--
327−-- /Note/: Because this parser does not fail, do not use it with
328−-- combinators such as 'many', because such parsers loop until a
329−-- failure occurs. Careless use will thus result in an infinite loop.
330−takeWhile :: (Char -> Bool) -> Parser B.ByteString
331−takeWhile p = I.takeWhile (p . w2c)
332−{-# INLINE takeWhile #-}
333−
334−-- | A stateful scanner. The predicate consumes and transforms a
335−-- state argument, and each transformed state is passed to successive
336−-- invocations of the predicate on each byte of the input until one
337−-- returns 'Nothing' or the input ends.
338−--
339−-- This parser does not fail. It will return an empty string if the
340−-- predicate returns 'Nothing' on the first byte of input.
341−--
342−-- /Note/: Because this parser does not fail, do not use it with
343−-- combinators such as 'many', because such parsers loop until a
344−-- failure occurs. Careless use will thus result in an infinite loop.
345−scan :: s -> (s -> Char -> Maybe s) -> Parser B.ByteString
346−scan s0 p = I.scan s0 (\s -> p s . w2c)
347−{-# INLINE scan #-}
348−
349−-- | Consume input as long as the predicate returns 'False'
350−-- (i.e. until it returns 'True'), and return the consumed input.
351−--
352−-- This parser does not fail. It will return an empty string if the
353−-- predicate returns 'True' on the first byte of input.
354−--
355−-- /Note/: Because this parser does not fail, do not use it with
356−-- combinators such as 'many', because such parsers loop until a
357−-- failure occurs. Careless use will thus result in an infinite loop.
358−takeTill :: (Char -> Bool) -> Parser B.ByteString
359−takeTill p = I.takeTill (p . w2c)
360−{-# INLINE takeTill #-}
361−
362−-- | Skip past input for as long as the predicate returns 'True'.
363−skipWhile :: (Char -> Bool) -> Parser ()
364−skipWhile p = I.skipWhile (p . w2c)
365−{-# INLINE skipWhile #-}
366−
367−-- | Skip over white space.
368−skipSpace :: Parser ()
369−skipSpace = I.skipWhile isSpace_w8
370−{-# INLINE skipSpace #-}
371−
372−-- $specalt
373−--
374−-- If you enable the @OverloadedStrings@ language extension, you can
375−-- use the '*>' and '<*' combinators to simplify the common task of
376−-- matching a statically known string, then immediately parsing
377−-- something else.
378−--
379−-- Instead of writing something like this:
380−--
381−-- @
382−--'I.string' \"foo\" '*>' wibble
383−-- @
384−--
385−-- Using @OverloadedStrings@, you can omit the explicit use of
386−-- 'I.string', and write a more compact version:
387−--
388−-- @
389−-- \"foo\" '*>' wibble
390−-- @
391−--
392−-- (Note: the '.*>' and '<*.' combinators that were originally
393−-- provided for this purpose are obsolete and unnecessary, and will be
394−-- removed in the next major version.)
395−
396−-- | /Obsolete/. A type-specialized version of '*>' for
397−-- 'B.ByteString'. Use '*>' instead.
398−(.*>) :: B.ByteString -> Parser a -> Parser a
399−s .*> f = I.string s *> f
400−{-# DEPRECATED (.*>) "This is no longer necessary, and will be removed. Use '*>' instead." #-}
401−
402−-- | /Obsolete/. A type-specialized version of '<*' for
403−-- 'B.ByteString'. Use '<*' instead.
404−(<*.) :: Parser a -> B.ByteString -> Parser a
405−f <*. s = f <* I.string s
406−{-# DEPRECATED (<*.) "This is no longer necessary, and will be removed. Use '<*' instead." #-}
407−
408−-- | A predicate that matches either a carriage return @\'\\r\'@ or
409−-- newline @\'\\n\'@ character.
410−isEndOfLine :: Word8 -> Bool
411−isEndOfLine w = w == 13 || w == 10
412−{-# INLINE isEndOfLine #-}
413−
414−-- | A predicate that matches either a space @\' \'@ or horizontal tab
415−-- @\'\\t\'@ character.
416−isHorizontalSpace :: Word8 -> Bool
417−isHorizontalSpace w = w == 32 || w == 9
418−{-# INLINE isHorizontalSpace #-}
419−
420−-- | Parse and decode an unsigned hexadecimal number. The hex digits
421−-- @\'a\'@ through @\'f\'@ may be upper or lower case.
422−--
423−-- This parser does not accept a leading @\"0x\"@ string.
424−hexadecimal :: (Integral a, Bits a) => Parser a
425−hexadecimal = B8.foldl' step 0 `fmap` I.takeWhile1 isHexDigit
426− where
427− isHexDigit w = (w >= 48 && w <= 57) ||
428− (w >= 97 && w <= 102) ||
429− (w >= 65 && w <= 70)
430− step a w | w >= 48 && w <= 57 = (a `shiftL` 4) .|. fromIntegral (w - 48)
431− | w >= 97 = (a `shiftL` 4) .|. fromIntegral (w - 87)
432− | otherwise = (a `shiftL` 4) .|. fromIntegral (w - 55)
433−{-# SPECIALISE hexadecimal :: Parser Int #-}
434−{-# SPECIALISE hexadecimal :: Parser Int8 #-}
435−{-# SPECIALISE hexadecimal :: Parser Int16 #-}
436−{-# SPECIALISE hexadecimal :: Parser Int32 #-}
437−{-# SPECIALISE hexadecimal :: Parser Int64 #-}
438−{-# SPECIALISE hexadecimal :: Parser Integer #-}
439−{-# SPECIALISE hexadecimal :: Parser Word #-}
440−{-# SPECIALISE hexadecimal :: Parser Word8 #-}
441−{-# SPECIALISE hexadecimal :: Parser Word16 #-}
442−{-# SPECIALISE hexadecimal :: Parser Word32 #-}
443−{-# SPECIALISE hexadecimal :: Parser Word64 #-}
444−
445−-- | Parse and decode an unsigned decimal number.
446−decimal :: Integral a => Parser a
447−decimal = B8.foldl' step 0 `fmap` I.takeWhile1 isDigit_w8
448− where step a w = a * 10 + fromIntegral (w - 48)
449−{-# SPECIALISE decimal :: Parser Int #-}
450−{-# SPECIALISE decimal :: Parser Int8 #-}
451−{-# SPECIALISE decimal :: Parser Int16 #-}
452−{-# SPECIALISE decimal :: Parser Int32 #-}
453−{-# SPECIALISE decimal :: Parser Int64 #-}
454−{-# SPECIALISE decimal :: Parser Integer #-}
455−{-# SPECIALISE decimal :: Parser Word #-}
456−{-# SPECIALISE decimal :: Parser Word8 #-}
457−{-# SPECIALISE decimal :: Parser Word16 #-}
458−{-# SPECIALISE decimal :: Parser Word32 #-}
459−{-# SPECIALISE decimal :: Parser Word64 #-}
460−
461−-- | Parse a number with an optional leading @\'+\'@ or @\'-\'@ sign
462−-- character.
463−signed :: Num a => Parser a -> Parser a
464−{-# SPECIALISE signed :: Parser Int -> Parser Int #-}
465−{-# SPECIALISE signed :: Parser Int8 -> Parser Int8 #-}
466−{-# SPECIALISE signed :: Parser Int16 -> Parser Int16 #-}
467−{-# SPECIALISE signed :: Parser Int32 -> Parser Int32 #-}
468−{-# SPECIALISE signed :: Parser Int64 -> Parser Int64 #-}
469−{-# SPECIALISE signed :: Parser Integer -> Parser Integer #-}
470−signed p = (negate <$> (char8 '-' *> p))
471− <|> (char8 '+' *> p)
472− <|> p
473−
474−-- | Parse a rational number.
475−--
476−-- The syntax accepted by this parser is the same as for 'double'.
477−--
478−-- /Note/: this parser is not safe for use with inputs from untrusted
479−-- sources. An input with a suitably large exponent such as
480−-- @"1e1000000000"@ will cause a huge 'Integer' to be allocated,
481−-- resulting in what is effectively a denial-of-service attack.
482−--
483−-- In most cases, it is better to use 'double' or 'scientific'
484−-- instead.
485−rational :: Fractional a => Parser a
486−{-# SPECIALIZE rational :: Parser Double #-}
487−{-# SPECIALIZE rational :: Parser Float #-}
488−{-# SPECIALIZE rational :: Parser Rational #-}
489−{-# SPECIALIZE rational :: Parser Scientific #-}
490−rational = scientifically realToFrac
491−
492−-- | Parse a rational number.
493−--
494−-- This parser accepts an optional leading sign character, followed by
495−-- at least one decimal digit. The syntax similar to that accepted by
496−-- the 'read' function, with the exception that a trailing @\'.\'@ or
497−-- @\'e\'@ /not/ followed by a number is not consumed.
498−--
499−-- Examples with behaviour identical to 'read', if you feed an empty
500−-- continuation to the first result:
501−--
502−-- >rational "3" == Done 3.0 ""
503−-- >rational "3.1" == Done 3.1 ""
504−-- >rational "3e4" == Done 30000.0 ""
505−-- >rational "3.1e4" == Done 31000.0, ""
506−--
507−-- Examples with behaviour identical to 'read':
508−--
509−-- >rational ".3" == Fail "input does not start with a digit"
510−-- >rational "e3" == Fail "input does not start with a digit"
511−--
512−-- Examples of differences from 'read':
513−--
514−-- >rational "3.foo" == Done 3.0 ".foo"
515−-- >rational "3e" == Done 3.0 "e"
516−--
517−-- This function does not accept string representations of \"NaN\" or
518−-- \"Infinity\".
519−double :: Parser Double
520−double = scientifically Sci.toRealFloat
521−
522−-- | Parse a number, attempting to preserve both speed and precision.
523−--
524−-- The syntax accepted by this parser is the same as for 'double'.
525−number :: Parser Number
526−number = scientifically $ \s ->
527− let e = Sci.base10Exponent s
528− c = Sci.coefficient s
529− in if e >= 0
530− then I (c * 10 ^ e)
531− else D (Sci.toRealFloat s)
532−{-# DEPRECATED number "Use 'scientific' instead." #-}
533−
534−-- | Parse a scientific number.
535−--
536−-- The syntax accepted by this parser is the same as for 'double'.
537−scientific :: Parser Scientific
538−scientific = scientifically id
539−
540−-- A strict pair
541−data SP = SP !Integer {-# UNPACK #-}!Int
542−
543−{-# INLINE scientifically #-}
544−scientifically :: (Scientific -> a) -> Parser a
545−scientifically h = do
546− let minus = 45
547− plus = 43
548− sign <- I.peekWord8'
549− let !positive = sign == plus || sign /= minus
550− when (sign == plus || sign == minus) $
551− void $ I.anyWord8
552−
553− n <- decimal
554−
555− let f fracDigits = SP (B8.foldl' step n fracDigits)
556− (negate $ B8.length fracDigits)
557− step a w = a * 10 + fromIntegral (w - 48)
558−
559− dotty <- I.peekWord8
560− -- '.' -> ascii 46
561− SP c e <- case dotty of
562− Just 46 -> I.anyWord8 *> (f <$> I.takeWhile isDigit_w8)
563− _ -> pure (SP n 0)
564−
565− let !signedCoeff | positive = c
566− | otherwise = -c
567−
568− let littleE = 101
569− bigE = 69
570− (I.satisfy (\ex -> ex == littleE || ex == bigE) *>
571− fmap (h . Sci.scientific signedCoeff . (e +)) (signed decimal)) <|>
572− return (h $ Sci.scientific signedCoeff e)
Data/Attoparsec/ByteString/Internal.hsdeleted−536
@@ -1,536 +0,0 @@
1−{-# LANGUAGE BangPatterns, CPP, GADTs, OverloadedStrings, RankNTypes,
2− RecordWildCards #-}
3−-- |
4−-- Module : Data.Attoparsec.ByteString.Internal
5−-- Copyright : Bryan O'Sullivan 2007-2015
6−-- License : BSD3
7−--
8−-- Maintainer : bos@serpentine.com
9−-- Stability : experimental
10−-- Portability : unknown
11−--
12−-- Simple, efficient parser combinators for 'ByteString' strings,
13−-- loosely based on the Parsec library.
14−
15−module Data.Attoparsec.ByteString.Internal
16− (
17− -- * Parser types
18− Parser
19− , Result
20−
21− -- * Running parsers
22− , parse
23− , parseOnly
24−
25− -- * Combinators
26− , module Data.Attoparsec.Combinator
27−
28− -- * Parsing individual bytes
29− , satisfy
30− , satisfyWith
31− , anyWord8
32− , skip
33− , word8
34− , notWord8
35−
36− -- ** Lookahead
37− , peekWord8
38− , peekWord8'
39−
40− -- ** Byte classes
41− , inClass
42− , notInClass
43−
44− -- * Parsing more complicated structures
45− , storable
46−
47− -- * Efficient string handling
48− , skipWhile
49− , string
50− , stringCI
51− , take
52− , scan
53− , runScanner
54− , takeWhile
55− , takeWhile1
56− , takeTill
57−
58− -- ** Consume all remaining input
59− , takeByteString
60− , takeLazyByteString
61−
62− -- * Utilities
63− , endOfLine
64− , endOfInput
65− , match
66− , atEnd
67− ) where
68−
69−#if !MIN_VERSION_base(4,8,0)
70−import Control.Applicative ((<$>))
71−#endif
72−import Control.Applicative ((<|>))
73−import Control.Monad (when)
74−import Data.Attoparsec.ByteString.Buffer (Buffer, buffer)
75−import Data.Attoparsec.ByteString.FastSet (charClass, memberWord8)
76−import Data.Attoparsec.Combinator ((<?>))
77−import Data.Attoparsec.Internal
78−import Data.Attoparsec.Internal.Fhthagn (inlinePerformIO)
79−import Data.Attoparsec.Internal.Types hiding (Parser, Failure, Success)
80−import Data.ByteString (ByteString)
81−import Data.List (intercalate)
82−import Data.Word (Word8)
83−import Foreign.ForeignPtr (withForeignPtr)
84−import Foreign.Ptr (castPtr, minusPtr, plusPtr)
85−import Foreign.Storable (Storable(peek, sizeOf))
86−import Prelude hiding (getChar, succ, take, takeWhile)
87−import qualified Data.Attoparsec.ByteString.Buffer as Buf
88−import qualified Data.Attoparsec.Internal.Types as T
89−import qualified Data.ByteString as B8
90−import qualified Data.ByteString.Char8 as B
91−import qualified Data.ByteString.Internal as B
92−import qualified Data.ByteString.Lazy as L
93−import qualified Data.ByteString.Unsafe as B
94−
95−type Parser = T.Parser ByteString
96−type Result = IResult ByteString
97−type Failure r = T.Failure ByteString Buffer r
98−type Success a r = T.Success ByteString Buffer a r
99−
100−-- | The parser @satisfy p@ succeeds for any byte for which the
101−-- predicate @p@ returns 'True'. Returns the byte that is actually
102−-- parsed.
103−--
104−-- >digit = satisfy isDigit
105−-- > where isDigit w = w >= 48 && w <= 57
106−satisfy :: (Word8 -> Bool) -> Parser Word8
107−satisfy p = do
108− h <- peekWord8'
109− if p h
110− then advance 1 >> return h
111− else fail "satisfy"
112−{-# INLINE satisfy #-}
113−
114−-- | The parser @skip p@ succeeds for any byte for which the predicate
115−-- @p@ returns 'True'.
116−--
117−-- >skipDigit = skip isDigit
118−-- > where isDigit w = w >= 48 && w <= 57
119−skip :: (Word8 -> Bool) -> Parser ()
120−skip p = do
121− h <- peekWord8'
122− if p h
123− then advance 1
124− else fail "skip"
125−
126−-- | The parser @satisfyWith f p@ transforms a byte, and succeeds if
127−-- the predicate @p@ returns 'True' on the transformed value. The
128−-- parser returns the transformed byte that was parsed.
129−satisfyWith :: (Word8 -> a) -> (a -> Bool) -> Parser a
130−satisfyWith f p = do
131− h <- peekWord8'
132− let c = f h
133− if p c
134− then advance 1 >> return c
135− else fail "satisfyWith"
136−{-# INLINE satisfyWith #-}
137−
138−storable :: Storable a => Parser a
139−storable = hack undefined
140− where
141− hack :: Storable b => b -> Parser b
142− hack dummy = do
143− (fp,o,_) <- B.toForeignPtr `fmap` take (sizeOf dummy)
144− return . inlinePerformIO . withForeignPtr fp $ \p ->
145− peek (castPtr $ p `plusPtr` o)
146−
147−-- | Consume exactly @n@ bytes of input.
148−take :: Int -> Parser ByteString
149−take n0 = do
150− let n = max n0 0
151− s <- ensure n
152− advance n >> return s
153−{-# INLINE take #-}
154−
155−-- | @string s@ parses a sequence of bytes that identically match
156−-- @s@. Returns the parsed string (i.e. @s@). This parser consumes no
157−-- input if it fails (even if a partial match).
158−--
159−-- /Note/: The behaviour of this parser is different to that of the
160−-- similarly-named parser in Parsec, as this one is all-or-nothing.
161−-- To illustrate the difference, the following parser will fail under
162−-- Parsec given an input of @\"for\"@:
163−--
164−-- >string "foo" <|> string "for"
165−--
166−-- The reason for its failure is that the first branch is a
167−-- partial match, and will consume the letters @\'f\'@ and @\'o\'@
168−-- before failing. In attoparsec, the above parser will /succeed/ on
169−-- that input, because the failed first branch will consume nothing.
170−string :: ByteString -> Parser ByteString
171−string s = string_ (stringSuspended id) id s
172−{-# INLINE string #-}
173−
174−-- ASCII-specific but fast, oh yes.
175−toLower :: Word8 -> Word8
176−toLower w | w >= 65 && w <= 90 = w + 32
177− | otherwise = w
178−
179−-- | Satisfy a literal string, ignoring case.
180−stringCI :: ByteString -> Parser ByteString
181−stringCI s = string_ (stringSuspended lower) lower s
182− where lower = B8.map toLower
183−{-# INLINE stringCI #-}
184−
185−string_ :: (forall r. ByteString -> ByteString -> Buffer -> Pos -> More
186− -> Failure r -> Success ByteString r -> Result r)
187− -> (ByteString -> ByteString)
188− -> ByteString -> Parser ByteString
189−string_ suspended f s0 = T.Parser $ \t pos more lose succ ->
190− let n = B.length s
191− s = f s0
192− in if lengthAtLeast pos n t
193− then let t' = substring pos (Pos n) t
194− in if s == f t'
195− then succ t (pos + Pos n) more t'
196− else lose t pos more [] "string"
197− else let t' = Buf.unsafeDrop (fromPos pos) t
198− in if f t' `B.isPrefixOf` s
199− then suspended s (B.drop (B.length t') s) t pos more lose succ
200− else lose t pos more [] "string"
201−{-# INLINE string_ #-}
202−
203−stringSuspended :: (ByteString -> ByteString)
204− -> ByteString -> ByteString -> Buffer -> Pos -> More
205− -> Failure r
206− -> Success ByteString r
207− -> Result r
208−stringSuspended f s0 s t pos more lose succ =
209− runParser (demandInput_ >>= go) t pos more lose succ
210− where go s'0 = T.Parser $ \t' pos' more' lose' succ' ->
211− let m = B.length s
212− s' = f s'0
213− n = B.length s'
214− in if n >= m
215− then if B.unsafeTake m s' == s
216− then let o = Pos (B.length s0)
217− in succ' t' (pos' + o) more'
218− (substring pos' o t')
219− else lose' t' pos' more' [] "string"
220− else if s' == B.unsafeTake n s
221− then stringSuspended f s0 (B.unsafeDrop n s)
222− t' pos' more' lose' succ'
223− else lose' t' pos' more' [] "string"
224−
225−-- | Skip past input for as long as the predicate returns 'True'.
226−skipWhile :: (Word8 -> Bool) -> Parser ()
227−skipWhile p = go
228− where
229− go = do
230− t <- B8.takeWhile p <$> get
231− continue <- inputSpansChunks (B.length t)
232− when continue go
233−{-# INLINE skipWhile #-}
234−
235−-- | Consume input as long as the predicate returns 'False'
236−-- (i.e. until it returns 'True'), and return the consumed input.
237−--
238−-- This parser does not fail. It will return an empty string if the
239−-- predicate returns 'True' on the first byte of input.
240−--
241−-- /Note/: Because this parser does not fail, do not use it with
242−-- combinators such as 'Control.Applicative.many', because such
243−-- parsers loop until a failure occurs. Careless use will thus result
244−-- in an infinite loop.
245−takeTill :: (Word8 -> Bool) -> Parser ByteString
246−takeTill p = takeWhile (not . p)
247−{-# INLINE takeTill #-}
248−
249−-- | Consume input as long as the predicate returns 'True', and return
250−-- the consumed input.
251−--
252−-- This parser does not fail. It will return an empty string if the
253−-- predicate returns 'False' on the first byte of input.
254−--
255−-- /Note/: Because this parser does not fail, do not use it with
256−-- combinators such as 'Control.Applicative.many', because such
257−-- parsers loop until a failure occurs. Careless use will thus result
258−-- in an infinite loop.
259−takeWhile :: (Word8 -> Bool) -> Parser ByteString
260−takeWhile p = do
261− s <- B8.takeWhile p <$> get
262− continue <- inputSpansChunks (B.length s)
263− if continue
264− then takeWhileAcc p [s]
265− else return s
266−{-# INLINE takeWhile #-}
267−
268−takeWhileAcc :: (Word8 -> Bool) -> [ByteString] -> Parser ByteString
269−takeWhileAcc p = go
270− where
271− go acc = do
272− s <- B8.takeWhile p <$> get
273− continue <- inputSpansChunks (B.length s)
274− if continue
275− then go (s:acc)
276− else return $ concatReverse (s:acc)
277−{-# INLINE takeWhileAcc #-}
278−
279−takeRest :: Parser [ByteString]
280−takeRest = go []
281− where
282− go acc = do
283− input <- wantInput
284− if input
285− then do
286− s <- get
287− advance (B.length s)
288− go (s:acc)
289− else return (reverse acc)
290−
291−-- | Consume all remaining input and return it as a single string.
292−takeByteString :: Parser ByteString
293−takeByteString = B.concat `fmap` takeRest
294−
295−-- | Consume all remaining input and return it as a single string.
296−takeLazyByteString :: Parser L.ByteString
297−takeLazyByteString = L.fromChunks `fmap` takeRest
298−
299−data T s = T {-# UNPACK #-} !Int s
300−
301−scan_ :: (s -> [ByteString] -> Parser r) -> s -> (s -> Word8 -> Maybe s)
302− -> Parser r
303−scan_ f s0 p = go [] s0
304− where
305− go acc s1 = do
306− let scanner (B.PS fp off len) =
307− withForeignPtr fp $ \ptr0 -> do
308− let start = ptr0 `plusPtr` off
309− end = start `plusPtr` len
310− inner ptr !s
311− | ptr < end = do
312− w <- peek ptr
313− case p s w of
314− Just s' -> inner (ptr `plusPtr` 1) s'
315− _ -> done (ptr `minusPtr` start) s
316− | otherwise = done (ptr `minusPtr` start) s
317− done !i !s = return (T i s)
318− inner start s1
319− bs <- get
320− let T i s' = inlinePerformIO $ scanner bs
321− !h = B.unsafeTake i bs
322− continue <- inputSpansChunks i
323− if continue
324− then go (h:acc) s'
325− else f s' (h:acc)
326−{-# INLINE scan_ #-}
327−
328−-- | A stateful scanner. The predicate consumes and transforms a
329−-- state argument, and each transformed state is passed to successive
330−-- invocations of the predicate on each byte of the input until one
331−-- returns 'Nothing' or the input ends.
332−--
333−-- This parser does not fail. It will return an empty string if the
334−-- predicate returns 'Nothing' on the first byte of input.
335−--
336−-- /Note/: Because this parser does not fail, do not use it with
337−-- combinators such as 'Control.Applicative.many', because such
338−-- parsers loop until a failure occurs. Careless use will thus result
339−-- in an infinite loop.
340−scan :: s -> (s -> Word8 -> Maybe s) -> Parser ByteString
341−scan = scan_ $ \_ chunks -> return $! concatReverse chunks
342−{-# INLINE scan #-}
343−
344−-- | Like 'scan', but generalized to return the final state of the
345−-- scanner.
346−runScanner :: s -> (s -> Word8 -> Maybe s) -> Parser (ByteString, s)
347−runScanner = scan_ $ \s xs -> let !sx = concatReverse xs in return (sx, s)
348−{-# INLINE runScanner #-}
349−
350−-- | Consume input as long as the predicate returns 'True', and return
351−-- the consumed input.
352−--
353−-- This parser requires the predicate to succeed on at least one byte
354−-- of input: it will fail if the predicate never returns 'True' or if
355−-- there is no input left.
356−takeWhile1 :: (Word8 -> Bool) -> Parser ByteString
357−takeWhile1 p = do
358− (`when` demandInput) =<< endOfChunk
359− s <- B8.takeWhile p <$> get
360− let len = B.length s
361− if len == 0
362− then fail "takeWhile1"
363− else do
364− advance len
365− eoc <- endOfChunk
366− if eoc
367− then takeWhileAcc p [s]
368− else return s
369−{-# INLINE takeWhile1 #-}
370−
371−-- | Match any byte in a set.
372−--
373−-- >vowel = inClass "aeiou"
374−--
375−-- Range notation is supported.
376−--
377−-- >halfAlphabet = inClass "a-nA-N"
378−--
379−-- To add a literal @\'-\'@ to a set, place it at the beginning or end
380−-- of the string.
381−inClass :: String -> Word8 -> Bool
382−inClass s = (`memberWord8` mySet)
383− where mySet = charClass s
384− {-# NOINLINE mySet #-}
385−{-# INLINE inClass #-}
386−
387−-- | Match any byte not in a set.
388−notInClass :: String -> Word8 -> Bool
389−notInClass s = not . inClass s
390−{-# INLINE notInClass #-}
391−
392−-- | Match any byte.
393−anyWord8 :: Parser Word8
394−anyWord8 = satisfy $ const True
395−{-# INLINE anyWord8 #-}
396−
397−-- | Match a specific byte.
398−word8 :: Word8 -> Parser Word8
399−word8 c = satisfy (== c) <?> show c
400−{-# INLINE word8 #-}
401−
402−-- | Match any byte except the given one.
403−notWord8 :: Word8 -> Parser Word8
404−notWord8 c = satisfy (/= c) <?> "not " ++ show c
405−{-# INLINE notWord8 #-}
406−
407−-- | Match any byte, to perform lookahead. Returns 'Nothing' if end of
408−-- input has been reached. Does not consume any input.
409−--
410−-- /Note/: Because this parser does not fail, do not use it with
411−-- combinators such as 'Control.Applicative.many', because such
412−-- parsers loop until a failure occurs. Careless use will thus result
413−-- in an infinite loop.
414−peekWord8 :: Parser (Maybe Word8)
415−peekWord8 = T.Parser $ \t pos@(Pos pos_) more _lose succ ->
416− case () of
417− _| pos_ < Buf.length t ->
418− let !w = Buf.unsafeIndex t pos_
419− in succ t pos more (Just w)
420− | more == Complete ->
421− succ t pos more Nothing
422− | otherwise ->
423− let succ' t' pos' more' = let !w = Buf.unsafeIndex t' pos_
424− in succ t' pos' more' (Just w)
425− lose' t' pos' more' = succ t' pos' more' Nothing
426− in prompt t pos more lose' succ'
427−{-# INLINE peekWord8 #-}
428−
429−-- | Match any byte, to perform lookahead. Does not consume any
430−-- input, but will fail if end of input has been reached.
431−peekWord8' :: Parser Word8
432−peekWord8' = T.Parser $ \t pos more lose succ ->
433− if lengthAtLeast pos 1 t
434− then succ t pos more (Buf.unsafeIndex t (fromPos pos))
435− else let succ' t' pos' more' bs' = succ t' pos' more' $! B.unsafeHead bs'
436− in ensureSuspended 1 t pos more lose succ'
437−{-# INLINE peekWord8' #-}
438−
439−-- | Match either a single newline character @\'\\n\'@, or a carriage
440−-- return followed by a newline character @\"\\r\\n\"@.
441−endOfLine :: Parser ()
442−endOfLine = (word8 10 >> return ()) <|> (string "\r\n" >> return ())
443−
444−-- | Terminal failure continuation.
445−failK :: Failure a
446−failK t (Pos pos) _more stack msg = Fail (Buf.unsafeDrop pos t) stack msg
447−{-# INLINE failK #-}
448−
449−-- | Terminal success continuation.
450−successK :: Success a a
451−successK t (Pos pos) _more a = Done (Buf.unsafeDrop pos t) a
452−{-# INLINE successK #-}
453−
454−-- | Run a parser.
455−parse :: Parser a -> ByteString -> Result a
456−parse m s = T.runParser m (buffer s) (Pos 0) Incomplete failK successK
457−{-# INLINE parse #-}
458−
459−-- | Run a parser that cannot be resupplied via a 'Partial' result.
460−--
461−-- This function does not force a parser to consume all of its input.
462−-- Instead, any residual input will be discarded. To force a parser
463−-- to consume all of its input, use something like this:
464−--
465−-- @
466−--'parseOnly' (myParser 'Control.Applicative.<*' 'endOfInput')
467−-- @
468−parseOnly :: Parser a -> ByteString -> Either String a
469−parseOnly m s = case T.runParser m (buffer s) (Pos 0) Complete failK successK of
470− Fail _ [] err -> Left err
471− Fail _ ctxs err -> Left (intercalate " > " ctxs ++ ": " ++ err)
472− Done _ a -> Right a
473− _ -> error "parseOnly: impossible error!"
474−{-# INLINE parseOnly #-}
475−
476−get :: Parser ByteString
477−get = T.Parser $ \t pos more _lose succ ->
478− succ t pos more (Buf.unsafeDrop (fromPos pos) t)
479−{-# INLINE get #-}
480−
481−endOfChunk :: Parser Bool
482−endOfChunk = T.Parser $ \t pos more _lose succ ->
483− succ t pos more (fromPos pos == Buf.length t)
484−{-# INLINE endOfChunk #-}
485−
486−inputSpansChunks :: Int -> Parser Bool
487−inputSpansChunks i = T.Parser $ \t pos_ more _lose succ ->
488− let pos = pos_ + Pos i
489− in if fromPos pos < Buf.length t || more == Complete
490− then succ t pos more False
491− else let lose' t' pos' more' = succ t' pos' more' False
492− succ' t' pos' more' = succ t' pos' more' True
493− in prompt t pos more lose' succ'
494−{-# INLINE inputSpansChunks #-}
495−
496−advance :: Int -> Parser ()
497−advance n = T.Parser $ \t pos more _lose succ ->
498− succ t (pos + Pos n) more ()
499−{-# INLINE advance #-}
500−
501−ensureSuspended :: Int -> Buffer -> Pos -> More
502− -> Failure r
503− -> Success ByteString r
504− -> Result r
505−ensureSuspended n t pos more lose succ =
506− runParser (demandInput >> go) t pos more lose succ
507− where go = T.Parser $ \t' pos' more' lose' succ' ->
508− if lengthAtLeast pos' n t'
509− then succ' t' pos' more' (substring pos (Pos n) t')
510− else runParser (demandInput >> go) t' pos' more' lose' succ'
511−
512−-- | If at least @n@ elements of input are available, return the
513−-- current input, otherwise fail.
514−ensure :: Int -> Parser ByteString
515−ensure n = T.Parser $ \t pos more lose succ ->
516− if lengthAtLeast pos n t
517− then succ t pos more (substring pos (Pos n) t)
518− -- The uncommon case is kept out-of-line to reduce code size:
519− else ensureSuspended n t pos more lose succ
520−{-# INLINE ensure #-}
521−
522−-- | Return both the result of a parse and the portion of the input
523−-- that was consumed while it was being parsed.
524−match :: Parser a -> Parser (ByteString, a)
525−match p = T.Parser $ \t pos more lose succ ->
526− let succ' t' pos' more' a =
527− succ t' pos' more' (substring pos (pos'-pos) t', a)
528− in runParser p t pos more lose succ'
529−
530−lengthAtLeast :: Pos -> Int -> Buffer -> Bool
531−lengthAtLeast (Pos pos) n bs = Buf.length bs >= pos + n
532−{-# INLINE lengthAtLeast #-}
533−
534−substring :: Pos -> Pos -> Buffer -> ByteString
535−substring (Pos pos) (Pos n) = Buf.substring pos n
536−{-# INLINE substring #-}
Data/Attoparsec/ByteString/Lazy.hsdeleted−110
@@ -1,110 +0,0 @@
1−{-# LANGUAGE CPP #-}
2−#if __GLASGOW_HASKELL__ >= 702
3−{-# LANGUAGE Trustworthy #-} -- Imports internal modules
4−#endif
5−
6−-- |
7−-- Module : Data.Attoparsec.ByteString.Lazy
8−-- Copyright : Bryan O'Sullivan 2007-2015
9−-- License : BSD3
10−--
11−-- Maintainer : bos@serpentine.com
12−-- Stability : experimental
13−-- Portability : unknown
14−--
15−-- Simple, efficient combinator parsing that can consume lazy
16−-- 'ByteString' strings, loosely based on the Parsec library.
17−--
18−-- This is essentially the same code as in the 'Data.Attoparsec'
19−-- module, only with a 'parse' function that can consume a lazy
20−-- 'ByteString' incrementally, and a 'Result' type that does not allow
21−-- more input to be fed in. Think of this as suitable for use with a
22−-- lazily read file, e.g. via 'L.readFile' or 'L.hGetContents'.
23−--
24−-- /Note:/ The various parser functions and combinators such as
25−-- 'string' still expect /strict/ 'B.ByteString' parameters, and
26−-- return strict 'B.ByteString' results. Behind the scenes, strict
27−-- 'B.ByteString' values are still used internally to store parser
28−-- input and manipulate it efficiently.
29−
30−module Data.Attoparsec.ByteString.Lazy
31− (
32− Result(..)
33− , module Data.Attoparsec.ByteString
34− -- * Running parsers
35− , parse
36− , parseTest
37− -- ** Result conversion
38− , maybeResult
39− , eitherResult
40− ) where
41−
42−import Control.DeepSeq (NFData(rnf))
43−import Data.ByteString.Lazy.Internal (ByteString(..), chunk)
44−import Data.List (intercalate)
45−import qualified Data.ByteString as B
46−import qualified Data.Attoparsec.ByteString as A
47−import qualified Data.Attoparsec.Internal.Types as T
48−import Data.Attoparsec.ByteString
49− hiding (IResult(..), Result, eitherResult, maybeResult,
50− parse, parseWith, parseTest)
51−
52−-- | The result of a parse.
53−data Result r = Fail ByteString [String] String
54− -- ^ The parse failed. The 'ByteString' is the input
55− -- that had not yet been consumed when the failure
56− -- occurred. The @[@'String'@]@ is a list of contexts
57− -- in which the error occurred. The 'String' is the
58− -- message describing the error, if any.
59− | Done ByteString r
60− -- ^ The parse succeeded. The 'ByteString' is the
61− -- input that had not yet been consumed (if any) when
62− -- the parse succeeded.
63−
64−instance NFData r => NFData (Result r) where
65− rnf (Fail bs ctxs msg) = rnfBS bs `seq` rnf ctxs `seq` rnf msg
66− rnf (Done bs r) = rnfBS bs `seq` rnf r
67− {-# INLINE rnf #-}
68−
69−rnfBS :: ByteString -> ()
70−rnfBS (Chunk _ xs) = rnfBS xs
71−rnfBS Empty = ()
72−{-# INLINE rnfBS #-}
73−
74−instance Show r => Show (Result r) where
75− show (Fail bs stk msg) =
76− "Fail " ++ show bs ++ " " ++ show stk ++ " " ++ show msg
77− show (Done bs r) = "Done " ++ show bs ++ " " ++ show r
78−
79−fmapR :: (a -> b) -> Result a -> Result b
80−fmapR _ (Fail st stk msg) = Fail st stk msg
81−fmapR f (Done bs r) = Done bs (f r)
82−
83−instance Functor Result where
84− fmap = fmapR
85−
86−-- | Run a parser and return its result.
87−parse :: A.Parser a -> ByteString -> Result a
88−parse p s = case s of
89− Chunk x xs -> go (A.parse p x) xs
90− empty -> go (A.parse p B.empty) empty
91− where
92− go (T.Fail x stk msg) ys = Fail (chunk x ys) stk msg
93− go (T.Done x r) ys = Done (chunk x ys) r
94− go (T.Partial k) (Chunk y ys) = go (k y) ys
95− go (T.Partial k) empty = go (k B.empty) empty
96−
97−-- | Run a parser and print its result to standard output.
98−parseTest :: (Show a) => A.Parser a -> ByteString -> IO ()
99−parseTest p s = print (parse p s)
100−
101−-- | Convert a 'Result' value to a 'Maybe' value.
102−maybeResult :: Result r -> Maybe r
103−maybeResult (Done _ r) = Just r
104−maybeResult _ = Nothing
105−
106−-- | Convert a 'Result' value to an 'Either' value.
107−eitherResult :: Result r -> Either String r
108−eitherResult (Done _ r) = Right r
109−eitherResult (Fail _ [] msg) = Left msg
110−eitherResult (Fail _ ctxs msg) = Left (intercalate " > " ctxs ++ ": " ++ msg)
Data/Attoparsec/Char8.hsdeleted−23
@@ -1,23 +0,0 @@
1−-- |
2−-- Module : Data.Attoparsec.Char8
3−-- Copyright : Bryan O'Sullivan 2007-2015
4−-- License : BSD3
5−--
6−-- Maintainer : bos@serpentine.com
7−-- Stability : experimental
8−-- Portability : unknown
9−--
10−-- Simple, efficient, character-oriented combinator parsing for
11−-- 'Data.ByteString.ByteString' strings, loosely based on the Parsec
12−-- library.
13−--
14−-- This module is deprecated. Use "Data.Attoparsec.ByteString.Char8"
15−-- instead.
16−
17−module Data.Attoparsec.Char8
18− {-# DEPRECATED "This module will be removed in the next major release." #-}
19− (
20− module Data.Attoparsec.ByteString.Char8
21− ) where
22−
23−import Data.Attoparsec.ByteString.Char8
Data/Attoparsec/Combinator.hsdeleted−255
@@ -1,255 +0,0 @@
1−{-# LANGUAGE BangPatterns, CPP #-}
2−#if __GLASGOW_HASKELL__ >= 702
3−{-# LANGUAGE Trustworthy #-} -- Imports internal modules
4−#endif
5−-- |
6−-- Module : Data.Attoparsec.Combinator
7−-- Copyright : Daan Leijen 1999-2001, Bryan O'Sullivan 2007-2015
8−-- License : BSD3
9−--
10−-- Maintainer : bos@serpentine.com
11−-- Stability : experimental
12−-- Portability : portable
13−--
14−-- Useful parser combinators, similar to those provided by Parsec.
15−module Data.Attoparsec.Combinator
16− (
17− -- * Combinators
18− try
19− , (<?>)
20− , choice
21− , count
22− , option
23− , many'
24− , many1
25− , many1'
26− , manyTill
27− , manyTill'
28− , sepBy
29− , sepBy'
30− , sepBy1
31− , sepBy1'
32− , skipMany
33− , skipMany1
34− , eitherP
35− , feed
36− , satisfyElem
37− , endOfInput
38− , atEnd
39− , lookAhead
40− ) where
41−
42−#if !MIN_VERSION_base(4,8,0)
43−import Control.Applicative (Applicative(..), (<$>))
44−import Data.Monoid (Monoid(mappend))
45−#endif
46−import Control.Applicative (Alternative(..), empty, liftA2, many, (<|>))
47−import Control.Monad (MonadPlus(..))
48−import Data.Attoparsec.Internal.Types (Parser(..), IResult(..))
49−import Data.Attoparsec.Internal (endOfInput, atEnd, satisfyElem)
50−import Data.ByteString (ByteString)
51−import Data.Text (Text)
52−import qualified Data.Attoparsec.Zepto as Z
53−import Prelude hiding (succ)
54−
55−-- | Attempt a parse, and if it fails, rewind the input so that no
56−-- input appears to have been consumed.
57−--
58−-- This combinator is provided for compatibility with Parsec.
59−-- attoparsec parsers always backtrack on failure.
60−try :: Parser i a -> Parser i a
61−try p = p
62−{-# INLINE try #-}
63−
64−-- | Name the parser, in case failure occurs.
65−(<?>) :: Parser i a
66− -> String -- ^ the name to use if parsing fails
67− -> Parser i a
68−p <?> msg0 = Parser $ \t pos more lose succ ->
69− let lose' t' pos' more' strs msg = lose t' pos' more' (msg0:strs) msg
70− in runParser p t pos more lose' succ
71−{-# INLINE (<?>) #-}
72−infix 0 <?>
73−
74−-- | @choice ps@ tries to apply the actions in the list @ps@ in order,
75−-- until one of them succeeds. Returns the value of the succeeding
76−-- action.
77−choice :: Alternative f => [f a] -> f a
78−choice = foldr (<|>) empty
79−{-# SPECIALIZE choice :: [Parser ByteString a]
80− -> Parser ByteString a #-}
81−{-# SPECIALIZE choice :: [Parser Text a] -> Parser Text a #-}
82−{-# SPECIALIZE choice :: [Z.Parser a] -> Z.Parser a #-}
83−
84−-- | @option x p@ tries to apply action @p@. If @p@ fails without
85−-- consuming input, it returns the value @x@, otherwise the value
86−-- returned by @p@.
87−--
88−-- > priority = option 0 (digitToInt <$> digit)
89−option :: Alternative f => a -> f a -> f a
90−option x p = p <|> pure x
91−{-# SPECIALIZE option :: a -> Parser ByteString a -> Parser ByteString a #-}
92−{-# SPECIALIZE option :: a -> Parser Text a -> Parser Text a #-}
93−{-# SPECIALIZE option :: a -> Z.Parser a -> Z.Parser a #-}
94−
95−-- | A version of 'liftM2' that is strict in the result of its first
96−-- action.
97−liftM2' :: (Monad m) => (a -> b -> c) -> m a -> m b -> m c
98−liftM2' f a b = do
99− !x <- a
100− y <- b
101− return (f x y)
102−{-# INLINE liftM2' #-}
103−
104−-- | @many' p@ applies the action @p@ /zero/ or more times. Returns a
105−-- list of the returned values of @p@. The value returned by @p@ is
106−-- forced to WHNF.
107−--
108−-- > word = many' letter
109−many' :: (MonadPlus m) => m a -> m [a]
110−many' p = many_p
111− where many_p = some_p `mplus` return []
112− some_p = liftM2' (:) p many_p
113−{-# INLINE many' #-}
114−
115−-- | @many1 p@ applies the action @p@ /one/ or more times. Returns a
116−-- list of the returned values of @p@.
117−--
118−-- > word = many1 letter
119−many1 :: Alternative f => f a -> f [a]
120−many1 p = liftA2 (:) p (many p)
121−{-# INLINE many1 #-}
122−
123−-- | @many1' p@ applies the action @p@ /one/ or more times. Returns a
124−-- list of the returned values of @p@. The value returned by @p@ is
125−-- forced to WHNF.
126−--
127−-- > word = many1' letter
128−many1' :: (MonadPlus m) => m a -> m [a]
129−many1' p = liftM2' (:) p (many' p)
130−{-# INLINE many1' #-}
131−
132−-- | @sepBy p sep@ applies /zero/ or more occurrences of @p@, separated
133−-- by @sep@. Returns a list of the values returned by @p@.
134−--
135−-- > commaSep p = p `sepBy` (char ',')
136−sepBy :: Alternative f => f a -> f s -> f [a]
137−sepBy p s = liftA2 (:) p ((s *> sepBy1 p s) <|> pure []) <|> pure []
138−{-# SPECIALIZE sepBy :: Parser ByteString a -> Parser ByteString s
139− -> Parser ByteString [a] #-}
140−{-# SPECIALIZE sepBy :: Parser Text a -> Parser Text s -> Parser Text [a] #-}
141−{-# SPECIALIZE sepBy :: Z.Parser a -> Z.Parser s -> Z.Parser [a] #-}
142−
143−-- | @sepBy' p sep@ applies /zero/ or more occurrences of @p@, separated
144−-- by @sep@. Returns a list of the values returned by @p@. The value
145−-- returned by @p@ is forced to WHNF.
146−--
147−-- > commaSep p = p `sepBy'` (char ',')
148−sepBy' :: (MonadPlus m) => m a -> m s -> m [a]
149−sepBy' p s = scan `mplus` return []
150− where scan = liftM2' (:) p ((s >> sepBy1' p s) `mplus` return [])
151−{-# SPECIALIZE sepBy' :: Parser ByteString a -> Parser ByteString s
152− -> Parser ByteString [a] #-}
153−{-# SPECIALIZE sepBy' :: Parser Text a -> Parser Text s -> Parser Text [a] #-}
154−{-# SPECIALIZE sepBy' :: Z.Parser a -> Z.Parser s -> Z.Parser [a] #-}
155−
156−-- | @sepBy1 p sep@ applies /one/ or more occurrences of @p@, separated
157−-- by @sep@. Returns a list of the values returned by @p@.
158−--
159−-- > commaSep p = p `sepBy1` (char ',')
160−sepBy1 :: Alternative f => f a -> f s -> f [a]
161−sepBy1 p s = scan
162− where scan = liftA2 (:) p ((s *> scan) <|> pure [])
163−{-# SPECIALIZE sepBy1 :: Parser ByteString a -> Parser ByteString s
164− -> Parser ByteString [a] #-}
165−{-# SPECIALIZE sepBy1 :: Parser Text a -> Parser Text s -> Parser Text [a] #-}
166−{-# SPECIALIZE sepBy1 :: Z.Parser a -> Z.Parser s -> Z.Parser [a] #-}
167−
168−-- | @sepBy1' p sep@ applies /one/ or more occurrences of @p@, separated
169−-- by @sep@. Returns a list of the values returned by @p@. The value
170−-- returned by @p@ is forced to WHNF.
171−--
172−-- > commaSep p = p `sepBy1'` (char ',')
173−sepBy1' :: (MonadPlus m) => m a -> m s -> m [a]
174−sepBy1' p s = scan
175− where scan = liftM2' (:) p ((s >> scan) `mplus` return [])
176−{-# SPECIALIZE sepBy1' :: Parser ByteString a -> Parser ByteString s
177− -> Parser ByteString [a] #-}
178−{-# SPECIALIZE sepBy1' :: Parser Text a -> Parser Text s -> Parser Text [a] #-}
179−{-# SPECIALIZE sepBy1' :: Z.Parser a -> Z.Parser s -> Z.Parser [a] #-}
180−
181−-- | @manyTill p end@ applies action @p@ /zero/ or more times until
182−-- action @end@ succeeds, and returns the list of values returned by
183−-- @p@. This can be used to scan comments:
184−--
185−-- > simpleComment = string "<!--" *> manyTill anyChar (string "-->")
186−--
187−-- (Note the overlapping parsers @anyChar@ and @string \"-->\"@.
188−-- While this will work, it is not very efficient, as it will cause a
189−-- lot of backtracking.)
190−manyTill :: Alternative f => f a -> f b -> f [a]
191−manyTill p end = scan
192− where scan = (end *> pure []) <|> liftA2 (:) p scan
193−{-# SPECIALIZE manyTill :: Parser ByteString a -> Parser ByteString b
194− -> Parser ByteString [a] #-}
195−{-# SPECIALIZE manyTill :: Parser Text a -> Parser Text b -> Parser Text [a] #-}
196−{-# SPECIALIZE manyTill :: Z.Parser a -> Z.Parser b -> Z.Parser [a] #-}
197−
198−-- | @manyTill' p end@ applies action @p@ /zero/ or more times until
199−-- action @end@ succeeds, and returns the list of values returned by
200−-- @p@. This can be used to scan comments:
201−--
202−-- > simpleComment = string "<!--" *> manyTill' anyChar (string "-->")
203−--
204−-- (Note the overlapping parsers @anyChar@ and @string \"-->\"@.
205−-- While this will work, it is not very efficient, as it will cause a
206−-- lot of backtracking.)
207−--
208−-- The value returned by @p@ is forced to WHNF.
209−manyTill' :: (MonadPlus m) => m a -> m b -> m [a]
210−manyTill' p end = scan
211− where scan = (end >> return []) `mplus` liftM2' (:) p scan
212−{-# SPECIALIZE manyTill' :: Parser ByteString a -> Parser ByteString b
213− -> Parser ByteString [a] #-}
214−{-# SPECIALIZE manyTill' :: Parser Text a -> Parser Text b -> Parser Text [a] #-}
215−{-# SPECIALIZE manyTill' :: Z.Parser a -> Z.Parser b -> Z.Parser [a] #-}
216−
217−-- | Skip zero or more instances of an action.
218−skipMany :: Alternative f => f a -> f ()
219−skipMany p = scan
220− where scan = (p *> scan) <|> pure ()
221−{-# SPECIALIZE skipMany :: Parser ByteString a -> Parser ByteString () #-}
222−{-# SPECIALIZE skipMany :: Parser Text a -> Parser Text () #-}
223−{-# SPECIALIZE skipMany :: Z.Parser a -> Z.Parser () #-}
224−
225−-- | Skip one or more instances of an action.
226−skipMany1 :: Alternative f => f a -> f ()
227−skipMany1 p = p *> skipMany p
228−{-# SPECIALIZE skipMany1 :: Parser ByteString a -> Parser ByteString () #-}
229−{-# SPECIALIZE skipMany1 :: Parser Text a -> Parser Text () #-}
230−{-# SPECIALIZE skipMany1 :: Z.Parser a -> Z.Parser () #-}
231−
232−-- | Apply the given action repeatedly, returning every result.
233−count :: Monad m => Int -> m a -> m [a]
234−count n p = sequence (replicate n p)
235−{-# INLINE count #-}
236−
237−-- | Combine two alternatives.
238−eitherP :: (Alternative f) => f a -> f b -> f (Either a b)
239−eitherP a b = (Left <$> a) <|> (Right <$> b)
240−{-# INLINE eitherP #-}
241−
242−-- | If a parser has returned a 'T.Partial' result, supply it with more
243−-- input.
244−feed :: Monoid i => IResult i r -> i -> IResult i r
245−feed (Fail t ctxs msg) d = Fail (mappend t d) ctxs msg
246−feed (Partial k) d = k d
247−feed (Done t r) d = Done (mappend t d) r
248−{-# INLINE feed #-}
249−
250−-- | Apply a parser without consuming any input.
251−lookAhead :: Parser i a -> Parser i a
252−lookAhead p = Parser $ \t pos more lose succ ->
253− let succ' t' _pos' more' = succ t' pos more'
254− in runParser p t pos more lose succ'
255−{-# INLINE lookAhead #-}
Data/Attoparsec/Internal.hsdeleted−171
@@ -1,171 +0,0 @@
1−{-# LANGUAGE BangPatterns, CPP, ScopedTypeVariables #-}
2−-- |
3−-- Module : Data.Attoparsec.Internal
4−-- Copyright : Bryan O'Sullivan 2007-2015
5−-- License : BSD3
6−--
7−-- Maintainer : bos@serpentine.com
8−-- Stability : experimental
9−-- Portability : unknown
10−--
11−-- Simple, efficient parser combinators, loosely based on the Parsec
12−-- library.
13−
14−module Data.Attoparsec.Internal
15− ( compareResults
16− , prompt
17− , demandInput
18− , demandInput_
19− , wantInput
20− , endOfInput
21− , atEnd
22− , satisfyElem
23− , concatReverse
24− ) where
25−
26−#if !MIN_VERSION_base(4,8,0)
27−import Control.Applicative ((<$>))
28−import Data.Monoid (Monoid, mconcat)
29−#endif
30−import Data.Attoparsec.Internal.Types
31−import Data.ByteString (ByteString)
32−import Data.Text (Text)
33−import Prelude hiding (succ)
34−
35−-- | Compare two 'IResult' values for equality.
36−--
37−-- If both 'IResult's are 'Partial', the result will be 'Nothing', as
38−-- they are incomplete and hence their equality cannot be known.
39−-- (This is why there is no 'Eq' instance for 'IResult'.)
40−compareResults :: (Eq i, Eq r) => IResult i r -> IResult i r -> Maybe Bool
41−compareResults (Fail t0 ctxs0 msg0) (Fail t1 ctxs1 msg1) =
42− Just (t0 == t1 && ctxs0 == ctxs1 && msg0 == msg1)
43−compareResults (Done t0 r0) (Done t1 r1) =
44− Just (t0 == t1 && r0 == r1)
45−compareResults (Partial _) (Partial _) = Nothing
46−compareResults _ _ = Just False
47−
48−-- | Ask for input. If we receive any, pass the augmented input to a
49−-- success continuation, otherwise to a failure continuation.
50−prompt :: Chunk t
51− => State t -> Pos -> More
52− -> (State t -> Pos -> More -> IResult t r)
53− -> (State t -> Pos -> More -> IResult t r)
54− -> IResult t r
55−prompt t pos _more lose succ = Partial $ \s ->
56− if nullChunk s
57− then lose t pos Complete
58− else succ (pappendChunk t s) pos Incomplete
59−{-# SPECIALIZE prompt :: State ByteString -> Pos -> More
60− -> (State ByteString -> Pos -> More
61− -> IResult ByteString r)
62− -> (State ByteString -> Pos -> More
63− -> IResult ByteString r)
64− -> IResult ByteString r #-}
65−{-# SPECIALIZE prompt :: State Text -> Pos -> More
66− -> (State Text -> Pos -> More -> IResult Text r)
67− -> (State Text -> Pos -> More -> IResult Text r)
68− -> IResult Text r #-}
69−
70−-- | Immediately demand more input via a 'Partial' continuation
71−-- result.
72−demandInput :: Chunk t => Parser t ()
73−demandInput = Parser $ \t pos more lose succ ->
74− case more of
75− Complete -> lose t pos more [] "not enough input"
76− _ -> let lose' _ pos' more' = lose t pos' more' [] "not enough input"
77− succ' t' pos' more' = succ t' pos' more' ()
78− in prompt t pos more lose' succ'
79−{-# SPECIALIZE demandInput :: Parser ByteString () #-}
80−{-# SPECIALIZE demandInput :: Parser Text () #-}
81−
82−-- | Immediately demand more input via a 'Partial' continuation
83−-- result. Return the new input.
84−demandInput_ :: Chunk t => Parser t t
85−demandInput_ = Parser $ \t pos more lose succ ->
86− case more of
87− Complete -> lose t pos more [] "not enough input"
88− _ -> Partial $ \s ->
89− if nullChunk s
90− then lose t pos Complete [] "not enough input"
91− else succ (pappendChunk t s) pos more s
92−{-# SPECIALIZE demandInput_ :: Parser ByteString ByteString #-}
93−{-# SPECIALIZE demandInput_ :: Parser Text Text #-}
94−
95−-- | This parser always succeeds. It returns 'True' if any input is
96−-- available either immediately or on demand, and 'False' if the end
97−-- of all input has been reached.
98−wantInput :: forall t . Chunk t => Parser t Bool
99−wantInput = Parser $ \t pos more _lose succ ->
100− case () of
101− _ | pos < atBufferEnd (undefined :: t) t -> succ t pos more True
102− | more == Complete -> succ t pos more False
103− | otherwise -> let lose' t' pos' more' = succ t' pos' more' False
104− succ' t' pos' more' = succ t' pos' more' True
105− in prompt t pos more lose' succ'
106−{-# INLINE wantInput #-}
107−
108−-- | Match only if all input has been consumed.
109−endOfInput :: forall t . Chunk t => Parser t ()
110−endOfInput = Parser $ \t pos more lose succ ->
111− case () of
112− _| pos < atBufferEnd (undefined :: t) t -> lose t pos more [] "endOfInput"
113− | more == Complete -> succ t pos more ()
114− | otherwise ->
115− let lose' t' pos' more' _ctx _msg = succ t' pos' more' ()
116− succ' t' pos' more' _a = lose t' pos' more' [] "endOfInput"
117− in runParser demandInput t pos more lose' succ'
118−{-# SPECIALIZE endOfInput :: Parser ByteString () #-}
119−{-# SPECIALIZE endOfInput :: Parser Text () #-}
120−
121−-- | Return an indication of whether the end of input has been
122−-- reached.
123−atEnd :: Chunk t => Parser t Bool
124−atEnd = not <$> wantInput
125−{-# INLINE atEnd #-}
126−
127−satisfySuspended :: forall t r . Chunk t
128− => (ChunkElem t -> Bool)
129− -> State t -> Pos -> More
130− -> Failure t (State t) r
131− -> Success t (State t) (ChunkElem t) r
132− -> IResult t r
133−satisfySuspended p t pos more lose succ =
134− runParser (demandInput >> go) t pos more lose succ
135− where go = Parser $ \t' pos' more' lose' succ' ->
136− case bufferElemAt (undefined :: t) pos' t' of
137− Just (e, l) | p e -> succ' t' (pos' + Pos l) more' e
138− | otherwise -> lose' t' pos' more' [] "satisfyElem"
139− Nothing -> runParser (demandInput >> go) t' pos' more' lose' succ'
140−{-# SPECIALIZE satisfySuspended :: (ChunkElem ByteString -> Bool)
141− -> State ByteString -> Pos -> More
142− -> Failure ByteString (State ByteString) r
143− -> Success ByteString (State ByteString)
144− (ChunkElem ByteString) r
145− -> IResult ByteString r #-}
146−{-# SPECIALIZE satisfySuspended :: (ChunkElem Text -> Bool)
147− -> State Text -> Pos -> More
148− -> Failure Text (State Text) r
149− -> Success Text (State Text)
150− (ChunkElem Text) r
151− -> IResult Text r #-}
152−
153−-- | The parser @satisfyElem p@ succeeds for any chunk element for which the
154−-- predicate @p@ returns 'True'. Returns the element that is
155−-- actually parsed.
156−satisfyElem :: forall t . Chunk t
157− => (ChunkElem t -> Bool) -> Parser t (ChunkElem t)
158−satisfyElem p = Parser $ \t pos more lose succ ->
159− case bufferElemAt (undefined :: t) pos t of
160− Just (e, l) | p e -> succ t (pos + Pos l) more e
161− | otherwise -> lose t pos more [] "satisfyElem"
162− Nothing -> satisfySuspended p t pos more lose succ
163−{-# INLINE satisfyElem #-}
164−
165−-- | Concatenate a monoid after reversing its elements. Used to
166−-- glue together a series of textual chunks that have been accumulated
167−-- \"backwards\".
168−concatReverse :: Monoid m => [m] -> m
169−concatReverse [x] = x
170−concatReverse xs = mconcat (reverse xs)
171−{-# INLINE concatReverse #-}
Data/Attoparsec/Internal/Fhthagn.hsdeleted−18
@@ -1,18 +0,0 @@
1−{-# LANGUAGE BangPatterns, Rank2Types, OverloadedStrings,
2− RecordWildCards, MagicHash, UnboxedTuples #-}
3−
4−module Data.Attoparsec.Internal.Fhthagn
5− (
6− inlinePerformIO
7− ) where
8−
9−import GHC.Base (realWorld#)
10−import GHC.IO (IO(IO))
11−
12−-- | Just like unsafePerformIO, but we inline it. Big performance gains as
13−-- it exposes lots of things to further inlining. /Very unsafe/. In
14−-- particular, you should do no memory allocation inside an
15−-- 'inlinePerformIO' block. On Hugs this is just @unsafePerformIO@.
16−inlinePerformIO :: IO a -> a
17−inlinePerformIO (IO m) = case m realWorld# of (# _, r #) -> r
18−{-# INLINE inlinePerformIO #-}
Data/Attoparsec/Internal/Types.hsdeleted−266
@@ -1,266 +0,0 @@
1−{-# LANGUAGE CPP, BangPatterns, GeneralizedNewtypeDeriving, OverloadedStrings,
2− Rank2Types, RecordWildCards, TypeFamilies #-}
3−-- |
4−-- Module : Data.Attoparsec.Internal.Types
5−-- Copyright : Bryan O'Sullivan 2007-2015
6−-- License : BSD3
7−--
8−-- Maintainer : bos@serpentine.com
9−-- Stability : experimental
10−-- Portability : unknown
11−--
12−-- Simple, efficient parser combinators, loosely based on the Parsec
13−-- library.
14−
15−module Data.Attoparsec.Internal.Types
16− (
17− Parser(..)
18− , State
19− , Failure
20− , Success
21− , Pos(..)
22− , IResult(..)
23− , More(..)
24− , (<>)
25− , Chunk(..)
26− ) where
27−
28−import Control.Applicative as App (Applicative(..), (<$>))
29−import Control.Applicative (Alternative(..))
30−import Control.DeepSeq (NFData(rnf))
31−import Control.Monad (MonadPlus(..))
32−import qualified Control.Monad.Fail as Fail (MonadFail(..))
33−import Data.Monoid as Mon (Monoid(..))
34−import Data.Semigroup (Semigroup(..))
35−import Data.Word (Word8)
36−import Data.ByteString (ByteString)
37−import qualified Data.ByteString as BS
38−import Data.ByteString.Internal (w2c)
39−import Data.Text (Text)
40−import qualified Data.Text as Text
41−import Data.Text.Unsafe (Iter(..))
42−import Prelude hiding (succ)
43−import qualified Data.Attoparsec.ByteString.Buffer as B
44−import qualified Data.Attoparsec.Text.Buffer as T
45−
46−newtype Pos = Pos { fromPos :: Int }
47− deriving (Eq, Ord, Show, Num)
48−
49−-- | The result of a parse. This is parameterised over the type @i@
50−-- of string that was processed.
51−--
52−-- This type is an instance of 'Functor', where 'fmap' transforms the
53−-- value in a 'Done' result.
54−data IResult i r =
55− Fail i [String] String
56− -- ^ The parse failed. The @i@ parameter is the input that had
57− -- not yet been consumed when the failure occurred. The
58− -- @[@'String'@]@ is a list of contexts in which the error
59− -- occurred. The 'String' is the message describing the error, if
60− -- any.
61− | Partial (i -> IResult i r)
62− -- ^ Supply this continuation with more input so that the parser
63− -- can resume. To indicate that no more input is available, pass
64− -- an empty string to the continuation.
65− --
66− -- __Note__: if you get a 'Partial' result, do not call its
67− -- continuation more than once.
68− | Done i r
69− -- ^ The parse succeeded. The @i@ parameter is the input that had
70− -- not yet been consumed (if any) when the parse succeeded.
71−
72−instance (Show i, Show r) => Show (IResult i r) where
73− showsPrec d ir = showParen (d > 10) $
74− case ir of
75− (Fail t stk msg) -> showString "Fail" . f t . f stk . f msg
76− (Partial _) -> showString "Partial _"
77− (Done t r) -> showString "Done" . f t . f r
78− where f :: Show a => a -> ShowS
79− f x = showChar ' ' . showsPrec 11 x
80−
81−instance (NFData i, NFData r) => NFData (IResult i r) where
82− rnf (Fail t stk msg) = rnf t `seq` rnf stk `seq` rnf msg
83− rnf (Partial _) = ()
84− rnf (Done t r) = rnf t `seq` rnf r
85− {-# INLINE rnf #-}
86−
87−instance Functor (IResult i) where
88− fmap _ (Fail t stk msg) = Fail t stk msg
89− fmap f (Partial k) = Partial (fmap f . k)
90− fmap f (Done t r) = Done t (f r)
91−
92−-- | The core parser type. This is parameterised over the type @i@
93−-- of string being processed.
94−--
95−-- This type is an instance of the following classes:
96−--
97−-- * 'Monad', where 'fail' throws an exception (i.e. fails) with an
98−-- error message.
99−--
100−-- * 'Functor' and 'Applicative', which follow the usual definitions.
101−--
102−-- * 'MonadPlus', where 'mzero' fails (with no error message) and
103−-- 'mplus' executes the right-hand parser if the left-hand one
104−-- fails. When the parser on the right executes, the input is reset
105−-- to the same state as the parser on the left started with. (In
106−-- other words, attoparsec is a backtracking parser that supports
107−-- arbitrary lookahead.)
108−--
109−-- * 'Alternative', which follows 'MonadPlus'.
110−newtype Parser i a = Parser {
111− runParser :: forall r.
112− State i -> Pos -> More
113− -> Failure i (State i) r
114− -> Success i (State i) a r
115− -> IResult i r
116− }
117−
118−type family State i
119−type instance State ByteString = B.Buffer
120−type instance State Text = T.Buffer
121−
122−type Failure i t r = t -> Pos -> More -> [String] -> String
123− -> IResult i r
124−type Success i t a r = t -> Pos -> More -> a -> IResult i r
125−
126−-- | Have we read all available input?
127−data More = Complete | Incomplete
128− deriving (Eq, Show)
129−
130−instance Semigroup More where
131− c@Complete <> _ = c
132− _ <> m = m
133−
134−instance Mon.Monoid More where
135− mappend = (<>)
136− mempty = Incomplete
137−
138−instance Monad (Parser i) where
139−#if !(MIN_VERSION_base(4,13,0))
140− fail = Fail.fail
141− {-# INLINE fail #-}
142−#endif
143−
144− return = App.pure
145− {-# INLINE return #-}
146−
147− m >>= k = Parser $ \t !pos more lose succ ->
148− let succ' t' !pos' more' a = runParser (k a) t' pos' more' lose succ
149− in runParser m t pos more lose succ'
150− {-# INLINE (>>=) #-}
151−
152− (>>) = (*>)
153− {-# INLINE (>>) #-}
154−
155−
156−instance Fail.MonadFail (Parser i) where
157− fail err = Parser $ \t pos more lose _succ -> lose t pos more [] msg
158− where msg = "Failed reading: " ++ err
159− {-# INLINE fail #-}
160−
161−plus :: Parser i a -> Parser i a -> Parser i a
162−plus f g = Parser $ \t pos more lose succ ->
163− let lose' t' _pos' more' _ctx _msg = runParser g t' pos more' lose succ
164− in runParser f t pos more lose' succ
165−
166−instance MonadPlus (Parser i) where
167− mzero = fail "mzero"
168− {-# INLINE mzero #-}
169− mplus = plus
170−
171−instance Functor (Parser i) where
172− fmap f p = Parser $ \t pos more lose succ ->
173− let succ' t' pos' more' a = succ t' pos' more' (f a)
174− in runParser p t pos more lose succ'
175− {-# INLINE fmap #-}
176−
177−apP :: Parser i (a -> b) -> Parser i a -> Parser i b
178−apP d e = do
179− b <- d
180− a <- e
181− return (b a)
182−{-# INLINE apP #-}
183−
184−instance Applicative (Parser i) where
185− pure v = Parser $ \t !pos more _lose succ -> succ t pos more v
186− {-# INLINE pure #-}
187− (<*>) = apP
188− {-# INLINE (<*>) #-}
189− m *> k = m >>= \_ -> k
190− {-# INLINE (*>) #-}
191− x <* y = x >>= \a -> y >> pure a
192− {-# INLINE (<*) #-}
193−
194−instance Semigroup (Parser i a) where
195− (<>) = plus
196− {-# INLINE (<>) #-}
197−
198−instance Monoid (Parser i a) where
199− mempty = fail "mempty"
200− {-# INLINE mempty #-}
201− mappend = (<>)
202− {-# INLINE mappend #-}
203−
204−instance Alternative (Parser i) where
205− empty = fail "empty"
206− {-# INLINE empty #-}
207−
208− (<|>) = plus
209− {-# INLINE (<|>) #-}
210−
211− many v = many_v
212− where
213− many_v = some_v <|> pure []
214− some_v = (:) <$> v <*> many_v
215− {-# INLINE many #-}
216−
217− some v = some_v
218− where
219− many_v = some_v <|> pure []
220− some_v = (:) <$> v <*> many_v
221− {-# INLINE some #-}
222−
223−-- | A common interface for input chunks.
224−class Monoid c => Chunk c where
225− type ChunkElem c
226− -- | Test if the chunk is empty.
227− nullChunk :: c -> Bool
228− -- | Append chunk to a buffer.
229− pappendChunk :: State c -> c -> State c
230− -- | Position at the end of a buffer. The first argument is ignored.
231− atBufferEnd :: c -> State c -> Pos
232− -- | Return the buffer element at the given position along with its length.
233− bufferElemAt :: c -> Pos -> State c -> Maybe (ChunkElem c, Int)
234− -- | Map an element to the corresponding character.
235− -- The first argument is ignored.
236− chunkElemToChar :: c -> ChunkElem c -> Char
237−
238−instance Chunk ByteString where
239− type ChunkElem ByteString = Word8
240− nullChunk = BS.null
241− {-# INLINE nullChunk #-}
242− pappendChunk = B.pappend
243− {-# INLINE pappendChunk #-}
244− atBufferEnd _ = Pos . B.length
245− {-# INLINE atBufferEnd #-}
246− bufferElemAt _ (Pos i) buf
247− | i < B.length buf = Just (B.unsafeIndex buf i, 1)
248− | otherwise = Nothing
249− {-# INLINE bufferElemAt #-}
250− chunkElemToChar _ = w2c
251− {-# INLINE chunkElemToChar #-}
252−
253−instance Chunk Text where
254− type ChunkElem Text = Char
255− nullChunk = Text.null
256− {-# INLINE nullChunk #-}
257− pappendChunk = T.pappend
258− {-# INLINE pappendChunk #-}
259− atBufferEnd _ = Pos . T.length
260− {-# INLINE atBufferEnd #-}
261− bufferElemAt _ (Pos i) buf
262− | i < T.length buf = let Iter c l = T.iter buf i in Just (c, l)
263− | otherwise = Nothing
264− {-# INLINE bufferElemAt #-}
265− chunkElemToChar _ = id
266− {-# INLINE chunkElemToChar #-}
Data/Attoparsec/Lazy.hsdeleted−29
@@ -1,29 +0,0 @@
1−-- |
2−-- Module : Data.Attoparsec.Lazy
3−-- Copyright : Bryan O'Sullivan 2007-2015
4−-- License : BSD3
5−--
6−-- Maintainer : bos@serpentine.com
7−-- Stability : experimental
8−-- Portability : unknown
9−--
10−-- Simple, efficient combinator parsing for lazy 'ByteString'
11−-- strings, loosely based on the Parsec library.
12−--
13−-- This is essentially the same code as in the 'Data.Attoparsec'
14−-- module, only with a 'parse' function that can consume a lazy
15−-- 'ByteString' incrementally, and a 'Result' type that does not allow
16−-- more input to be fed in. Think of this as suitable for use with a
17−-- lazily read file, e.g. via 'L.readFile' or 'L.hGetContents'.
18−--
19−-- Behind the scenes, strict 'B.ByteString' values are still used
20−-- internally to store parser input and manipulate it efficiently.
21−-- High-performance parsers such as 'string' still expect strict
22−-- 'B.ByteString' parameters.
23−
24−module Data.Attoparsec.Lazy
25− (
26− module Data.Attoparsec.ByteString.Lazy
27− ) where
28−
29−import Data.Attoparsec.ByteString.Lazy
Data/Attoparsec/Number.hsdeleted−137
@@ -1,137 +0,0 @@
1−{-# LANGUAGE DeriveDataTypeable #-}
2−-- |
3−-- Module : Data.Attoparsec.Number
4−-- Copyright : Bryan O'Sullivan 2007-2015
5−-- License : BSD3
6−--
7−-- Maintainer : bos@serpentine.com
8−-- Stability : experimental
9−-- Portability : unknown
10−--
11−-- This module is deprecated, and both the module and 'Number' type
12−-- will be removed in the next major release. Use the
13−-- <http://hackage.haskell.org/package/scientific scientific> package
14−-- and the 'Data.Scientific.Scientific' type instead.
15−--
16−-- A simple number type, useful for parsing both exact and inexact
17−-- quantities without losing much precision.
18−module Data.Attoparsec.Number
19− {-# DEPRECATED "This module will be removed in the next major release." #-}
20− (
21− Number(..)
22− ) where
23−
24−import Control.DeepSeq (NFData(rnf))
25−import Data.Data (Data)
26−import Data.Function (on)
27−import Data.Typeable (Typeable)
28−
29−-- | A numeric type that can represent integers accurately, and
30−-- floating point numbers to the precision of a 'Double'.
31−--
32−-- /Note/: this type is deprecated, and will be removed in the next
33−-- major release. Use the 'Data.Scientific.Scientific' type instead.
34−data Number = I !Integer
35− | D {-# UNPACK #-} !Double
36− deriving (Typeable, Data)
37−{-# DEPRECATED Number "Use Scientific instead." #-}
38−
39−instance Show Number where
40− show (I a) = show a
41− show (D a) = show a
42−
43−instance NFData Number where
44− rnf (I _) = ()
45− rnf (D _) = ()
46− {-# INLINE rnf #-}
47−
48−binop :: (Integer -> Integer -> a) -> (Double -> Double -> a)
49− -> Number -> Number -> a
50−binop _ d (D a) (D b) = d a b
51−binop i _ (I a) (I b) = i a b
52−binop _ d (D a) (I b) = d a (fromIntegral b)
53−binop _ d (I a) (D b) = d (fromIntegral a) b
54−{-# INLINE binop #-}
55−
56−instance Eq Number where
57− (==) = binop (==) (==)
58− {-# INLINE (==) #-}
59−
60− (/=) = binop (/=) (/=)
61− {-# INLINE (/=) #-}
62−
63−instance Ord Number where
64− (<) = binop (<) (<)
65− {-# INLINE (<) #-}
66−
67− (<=) = binop (<=) (<=)
68− {-# INLINE (<=) #-}
69−
70− (>) = binop (>) (>)
71− {-# INLINE (>) #-}
72−
73− (>=) = binop (>=) (>=)
74− {-# INLINE (>=) #-}
75−
76− compare = binop compare compare
77− {-# INLINE compare #-}
78−
79−instance Num Number where
80− (+) = binop (((I$!).) . (+)) (((D$!).) . (+))
81− {-# INLINE (+) #-}
82−
83− (-) = binop (((I$!).) . (-)) (((D$!).) . (-))
84− {-# INLINE (-) #-}
85−
86− (*) = binop (((I$!).) . (*)) (((D$!).) . (*))
87− {-# INLINE (*) #-}
88−
89− abs (I a) = I $! abs a
90− abs (D a) = D $! abs a
91− {-# INLINE abs #-}
92−
93− negate (I a) = I $! negate a
94− negate (D a) = D $! negate a
95− {-# INLINE negate #-}
96−
97− signum (I a) = I $! signum a
98− signum (D a) = D $! signum a
99− {-# INLINE signum #-}
100−
101− fromInteger = (I$!) . fromInteger
102− {-# INLINE fromInteger #-}
103−
104−instance Real Number where
105− toRational (I a) = fromIntegral a
106− toRational (D a) = toRational a
107− {-# INLINE toRational #-}
108−
109−instance Fractional Number where
110− fromRational = (D$!) . fromRational
111− {-# INLINE fromRational #-}
112−
113− (/) = binop (((D$!).) . (/) `on` fromIntegral)
114− (((D$!).) . (/))
115− {-# INLINE (/) #-}
116−
117− recip (I a) = D $! recip (fromIntegral a)
118− recip (D a) = D $! recip a
119− {-# INLINE recip #-}
120−
121−instance RealFrac Number where
122− properFraction (I a) = (fromIntegral a,0)
123− properFraction (D a) = case properFraction a of
124− (i,d) -> (i,D d)
125− {-# INLINE properFraction #-}
126− truncate (I a) = fromIntegral a
127− truncate (D a) = truncate a
128− {-# INLINE truncate #-}
129− round (I a) = fromIntegral a
130− round (D a) = round a
131− {-# INLINE round #-}
132− ceiling (I a) = fromIntegral a
133− ceiling (D a) = ceiling a
134− {-# INLINE ceiling #-}
135− floor (I a) = fromIntegral a
136− floor (D a) = floor a
137− {-# INLINE floor #-}
Data/Attoparsec/Text.hsdeleted−493
@@ -1,493 +0,0 @@
1−{-# LANGUAGE BangPatterns, CPP, FlexibleInstances, TypeSynonymInstances #-}
2−#if __GLASGOW_HASKELL__ >= 702
3−{-# LANGUAGE Trustworthy #-} -- Imports internal modules
4−#endif
5−{-# OPTIONS_GHC -fno-warn-warnings-deprecations #-}
6−
7−-- |
8−-- Module : Data.Attoparsec.Text
9−-- Copyright : Bryan O'Sullivan 2007-2015
10−-- License : BSD3
11−--
12−-- Maintainer : bos@serpentine.com
13−-- Stability : experimental
14−-- Portability : unknown
15−--
16−-- Simple, efficient combinator parsing for 'Text' strings,
17−-- loosely based on the Parsec library.
18−
19−module Data.Attoparsec.Text
20− (
21− -- * Differences from Parsec
22− -- $parsec
23−
24− -- * Incremental input
25− -- $incremental
26−
27− -- * Performance considerations
28− -- $performance
29−
30− -- * Parser types
31− Parser
32− , Result
33− , T.IResult(..)
34− , I.compareResults
35−
36− -- * Running parsers
37− , parse
38− , feed
39− , I.parseOnly
40− , parseWith
41− , parseTest
42−
43− -- ** Result conversion
44− , maybeResult
45− , eitherResult
46−
47− -- * Parsing individual characters
48− , I.char
49− , I.anyChar
50− , I.notChar
51− , I.satisfy
52− , I.satisfyWith
53− , I.skip
54−
55− -- ** Lookahead
56− , I.peekChar
57− , I.peekChar'
58−
59− -- ** Special character parsers
60− , digit
61− , letter
62− , space
63−
64− -- ** Character classes
65− , I.inClass
66− , I.notInClass
67−
68− -- * Efficient string handling
69− , I.string
70− , I.stringCI
71− , I.asciiCI
72− , skipSpace
73− , I.skipWhile
74− , I.scan
75− , I.runScanner
76− , I.take
77− , I.takeWhile
78− , I.takeWhile1
79− , I.takeTill
80−
81− -- ** String combinators
82− -- $specalt
83− , (.*>)
84− , (<*.)
85−
86− -- ** Consume all remaining input
87− , I.takeText
88− , I.takeLazyText
89−
90− -- * Text parsing
91− , I.endOfLine
92− , isEndOfLine
93− , isHorizontalSpace
94−
95− -- * Numeric parsers
96− , decimal
97− , hexadecimal
98− , signed
99− , double
100− , Number(..)
101− , number
102− , rational
103− , scientific
104−
105− -- * Combinators
106− , try
107− , (<?>)
108− , choice
109− , count
110− , option
111− , many'
112− , many1
113− , many1'
114− , manyTill
115− , manyTill'
116− , sepBy
117− , sepBy'
118− , sepBy1
119− , sepBy1'
120− , skipMany
121− , skipMany1
122− , eitherP
123− , I.match
124− -- * State observation and manipulation functions
125− , I.endOfInput
126− , I.atEnd
127− ) where
128−
129−#if !MIN_VERSION_base(4,8,0)
130−import Control.Applicative (pure, (*>), (<*), (<$>))
131−import Data.Word (Word)
132−#endif
133−import Control.Applicative ((<|>))
134−import Data.Attoparsec.Combinator
135−import Data.Attoparsec.Number (Number(..))
136−import Data.Scientific (Scientific)
137−import qualified Data.Scientific as Sci
138−import Data.Attoparsec.Text.Internal (Parser, Result, parse, takeWhile1)
139−import Data.Bits (Bits, (.|.), shiftL)
140−import Data.Char (isAlpha, isDigit, isSpace, ord)
141−import Data.Int (Int8, Int16, Int32, Int64)
142−import Data.List (intercalate)
143−import Data.Text (Text)
144−import Data.Word (Word8, Word16, Word32, Word64)
145−import qualified Data.Attoparsec.Internal as I
146−import qualified Data.Attoparsec.Internal.Types as T
147−import qualified Data.Attoparsec.Text.Internal as I
148−import qualified Data.Text as T
149−
150−-- $parsec
151−--
152−-- Compared to Parsec 3, attoparsec makes several tradeoffs. It is
153−-- not intended for, or ideal for, all possible uses.
154−--
155−-- * While attoparsec can consume input incrementally, Parsec cannot.
156−-- Incremental input is a huge deal for efficient and secure network
157−-- and system programming, since it gives much more control to users
158−-- of the library over matters such as resource usage and the I/O
159−-- model to use.
160−--
161−-- * Much of the performance advantage of attoparsec is gained via
162−-- high-performance parsers such as 'I.takeWhile' and 'I.string'.
163−-- If you use complicated combinators that return lists of
164−-- characters, there is less performance difference between the two
165−-- libraries.
166−--
167−-- * Unlike Parsec 3, attoparsec does not support being used as a
168−-- monad transformer.
169−--
170−-- * attoparsec is specialised to deal only with strict 'Text'
171−-- input. Efficiency concerns rule out both lists and lazy text.
172−-- The usual use for lazy text would be to allow consumption of very
173−-- large input without a large footprint. For this need,
174−-- attoparsec's incremental input provides an excellent substitute,
175−-- with much more control over when input takes place. If you must
176−-- use lazy text, see the 'Lazy' module, which feeds lazy chunks to
177−-- a regular parser.
178−--
179−-- * Parsec parsers can produce more helpful error messages than
180−-- attoparsec parsers. This is a matter of focus: attoparsec avoids
181−-- the extra book-keeping in favour of higher performance.
182−
183−-- $incremental
184−--
185−-- attoparsec supports incremental input, meaning that you can feed it
186−-- a 'Text' that represents only part of the expected total amount
187−-- of data to parse. If your parser reaches the end of a fragment of
188−-- input and could consume more input, it will suspend parsing and
189−-- return a 'T.Partial' continuation.
190−--
191−-- Supplying the 'T.Partial' continuation with another string will
192−-- resume parsing at the point where it was suspended, with the string
193−-- you supplied used as new input at the end of the existing
194−-- input. You must be prepared for the result of the resumed parse to
195−-- be another 'Partial' continuation.
196−--
197−-- To indicate that you have no more input, supply the 'Partial'
198−-- continuation with an 'T.empty' 'Text'.
199−--
200−-- Remember that some parsing combinators will not return a result
201−-- until they reach the end of input. They may thus cause 'T.Partial'
202−-- results to be returned.
203−--
204−-- If you do not need support for incremental input, consider using
205−-- the 'I.parseOnly' function to run your parser. It will never
206−-- prompt for more input.
207−--
208−-- /Note/: incremental input does /not/ imply that attoparsec will
209−-- release portions of its internal state for garbage collection as it
210−-- proceeds. Its internal representation is equivalent to a single
211−-- 'Text': if you feed incremental input to an a parser, it will
212−-- require memory proportional to the amount of input you supply.
213−-- (This is necessary to support arbitrary backtracking.)
214−
215−-- $performance
216−--
217−-- If you write an attoparsec-based parser carefully, it can be
218−-- realistic to expect it to perform similarly to a hand-rolled C
219−-- parser (measuring megabytes parsed per second).
220−--
221−-- To actually achieve high performance, there are a few guidelines
222−-- that it is useful to follow.
223−--
224−-- Use the 'Text'-oriented parsers whenever possible,
225−-- e.g. 'I.takeWhile1' instead of 'many1' 'I.anyChar'. There is
226−-- about a factor of 100 difference in performance between the two
227−-- kinds of parser.
228−--
229−-- For very simple character-testing predicates, write them by hand
230−-- instead of using 'I.inClass' or 'I.notInClass'. For instance, both
231−-- of these predicates test for an end-of-line character, but the
232−-- first is much faster than the second:
233−--
234−-- >endOfLine_fast c = c == '\r' || c == '\n'
235−-- >endOfLine_slow = inClass "\r\n"
236−--
237−-- Make active use of benchmarking and profiling tools to measure,
238−-- find the problems with, and improve the performance of your parser.
239−
240−-- | Run a parser and print its result to standard output.
241−parseTest :: (Show a) => I.Parser a -> Text -> IO ()
242−parseTest p s = print (parse p s)
243−
244−-- | Run a parser with an initial input string, and a monadic action
245−-- that can supply more input if needed.
246−parseWith :: Monad m =>
247− (m Text)
248− -- ^ An action that will be executed to provide the parser
249− -- with more input, if necessary. The action must return an
250− -- 'T.empty' string when there is no more input available.
251− -> I.Parser a
252− -> Text
253− -- ^ Initial input for the parser.
254− -> m (Result a)
255−parseWith refill p s = step $ parse p s
256− where step (T.Partial k) = (step . k) =<< refill
257− step r = return r
258−{-# INLINE parseWith #-}
259−
260−-- | Convert a 'Result' value to a 'Maybe' value. A 'Partial' result
261−-- is treated as failure.
262−maybeResult :: Result r -> Maybe r
263−maybeResult (T.Done _ r) = Just r
264−maybeResult _ = Nothing
265−
266−-- | Convert a 'Result' value to an 'Either' value. A 'Partial' result
267−-- is treated as failure.
268−eitherResult :: Result r -> Either String r
269−eitherResult (T.Done _ r) = Right r
270−eitherResult (T.Fail _ [] msg) = Left msg
271−eitherResult (T.Fail _ ctxs msg) = Left (intercalate " > " ctxs ++ ": " ++ msg)
272−eitherResult _ = Left "Result: incomplete input"
273−
274−-- | A predicate that matches either a carriage return @\'\\r\'@ or
275−-- newline @\'\\n\'@ character.
276−isEndOfLine :: Char -> Bool
277−isEndOfLine c = c == '\n' || c == '\r'
278−{-# INLINE isEndOfLine #-}
279−
280−-- | A predicate that matches either a space @\' \'@ or horizontal tab
281−-- @\'\\t\'@ character.
282−isHorizontalSpace :: Char -> Bool
283−isHorizontalSpace c = c == ' ' || c == '\t'
284−{-# INLINE isHorizontalSpace #-}
285−
286−-- | Parse and decode an unsigned hexadecimal number. The hex digits
287−-- @\'a\'@ through @\'f\'@ may be upper or lower case.
288−--
289−-- This parser does not accept a leading @\"0x\"@ string.
290−hexadecimal :: (Integral a, Bits a) => Parser a
291−hexadecimal = T.foldl' step 0 `fmap` takeWhile1 isHexDigit
292− where
293− isHexDigit c = (c >= '0' && c <= '9') ||
294− (c >= 'a' && c <= 'f') ||
295− (c >= 'A' && c <= 'F')
296− step a c | w >= 48 && w <= 57 = (a `shiftL` 4) .|. fromIntegral (w - 48)
297− | w >= 97 = (a `shiftL` 4) .|. fromIntegral (w - 87)
298− | otherwise = (a `shiftL` 4) .|. fromIntegral (w - 55)
299− where w = ord c
300−{-# SPECIALISE hexadecimal :: Parser Int #-}
301−{-# SPECIALISE hexadecimal :: Parser Int8 #-}
302−{-# SPECIALISE hexadecimal :: Parser Int16 #-}
303−{-# SPECIALISE hexadecimal :: Parser Int32 #-}
304−{-# SPECIALISE hexadecimal :: Parser Int64 #-}
305−{-# SPECIALISE hexadecimal :: Parser Integer #-}
306−{-# SPECIALISE hexadecimal :: Parser Word #-}
307−{-# SPECIALISE hexadecimal :: Parser Word8 #-}
308−{-# SPECIALISE hexadecimal :: Parser Word16 #-}
309−{-# SPECIALISE hexadecimal :: Parser Word32 #-}
310−{-# SPECIALISE hexadecimal :: Parser Word64 #-}
311−
312−-- | Parse and decode an unsigned decimal number.
313−decimal :: Integral a => Parser a
314−decimal = T.foldl' step 0 `fmap` takeWhile1 isDecimal
315− where step a c = a * 10 + fromIntegral (ord c - 48)
316−{-# SPECIALISE decimal :: Parser Int #-}
317−{-# SPECIALISE decimal :: Parser Int8 #-}
318−{-# SPECIALISE decimal :: Parser Int16 #-}
319−{-# SPECIALISE decimal :: Parser Int32 #-}
320−{-# SPECIALISE decimal :: Parser Int64 #-}
321−{-# SPECIALISE decimal :: Parser Integer #-}
322−{-# SPECIALISE decimal :: Parser Word #-}
323−{-# SPECIALISE decimal :: Parser Word8 #-}
324−{-# SPECIALISE decimal :: Parser Word16 #-}
325−{-# SPECIALISE decimal :: Parser Word32 #-}
326−{-# SPECIALISE decimal :: Parser Word64 #-}
327−
328−isDecimal :: Char -> Bool
329−isDecimal c = c >= '0' && c <= '9'
330−{-# INLINE isDecimal #-}
331−
332−-- | Parse a number with an optional leading @\'+\'@ or @\'-\'@ sign
333−-- character.
334−signed :: Num a => Parser a -> Parser a
335−{-# SPECIALISE signed :: Parser Int -> Parser Int #-}
336−{-# SPECIALISE signed :: Parser Int8 -> Parser Int8 #-}
337−{-# SPECIALISE signed :: Parser Int16 -> Parser Int16 #-}
338−{-# SPECIALISE signed :: Parser Int32 -> Parser Int32 #-}
339−{-# SPECIALISE signed :: Parser Int64 -> Parser Int64 #-}
340−{-# SPECIALISE signed :: Parser Integer -> Parser Integer #-}
341−signed p = (negate <$> (I.char '-' *> p))
342− <|> (I.char '+' *> p)
343− <|> p
344−
345−-- | Parse a rational number.
346−--
347−-- The syntax accepted by this parser is the same as for 'double'.
348−--
349−-- /Note/: this parser is not safe for use with inputs from untrusted
350−-- sources. An input with a suitably large exponent such as
351−-- @"1e1000000000"@ will cause a huge 'Integer' to be allocated,
352−-- resulting in what is effectively a denial-of-service attack.
353−--
354−-- In most cases, it is better to use 'double' or 'scientific'
355−-- instead.
356−rational :: Fractional a => Parser a
357−{-# SPECIALIZE rational :: Parser Double #-}
358−{-# SPECIALIZE rational :: Parser Float #-}
359−{-# SPECIALIZE rational :: Parser Rational #-}
360−{-# SPECIALIZE rational :: Parser Scientific #-}
361−rational = scientifically realToFrac
362−
363−-- | Parse a rational number.
364−--
365−-- This parser accepts an optional leading sign character, followed by
366−-- at least one decimal digit. The syntax similar to that accepted by
367−-- the 'read' function, with the exception that a trailing @\'.\'@ or
368−-- @\'e\'@ /not/ followed by a number is not consumed.
369−--
370−-- Examples with behaviour identical to 'read', if you feed an empty
371−-- continuation to the first result:
372−--
373−-- >rational "3" == Done 3.0 ""
374−-- >rational "3.1" == Done 3.1 ""
375−-- >rational "3e4" == Done 30000.0 ""
376−-- >rational "3.1e4" == Done 31000.0, ""
377−--
378−-- Examples with behaviour identical to 'read':
379−--
380−-- >rational ".3" == Fail "input does not start with a digit"
381−-- >rational "e3" == Fail "input does not start with a digit"
382−--
383−-- Examples of differences from 'read':
384−--
385−-- >rational "3.foo" == Done 3.0 ".foo"
386−-- >rational "3e" == Done 3.0 "e"
387−--
388−-- This function does not accept string representations of \"NaN\" or
389−-- \"Infinity\".
390−double :: Parser Double
391−double = scientifically Sci.toRealFloat
392−
393−-- | Parse a number, attempting to preserve both speed and precision.
394−--
395−-- The syntax accepted by this parser is the same as for 'double'.
396−--
397−-- This function does not accept string representations of \"NaN\" or
398−-- \"Infinity\".
399−number :: Parser Number
400−number = scientifically $ \s ->
401− let e = Sci.base10Exponent s
402− c = Sci.coefficient s
403− in if e >= 0
404− then I (c * 10 ^ e)
405− else D (Sci.toRealFloat s)
406−{-# DEPRECATED number "Use 'scientific' instead." #-}
407−
408−-- | Parse a scientific number.
409−--
410−-- The syntax accepted by this parser is the same as for 'double'.
411−scientific :: Parser Scientific
412−scientific = scientifically id
413−
414−-- A strict pair
415−data SP = SP !Integer {-# UNPACK #-}!Int
416−
417−{-# INLINE scientifically #-}
418−scientifically :: (Scientific -> a) -> Parser a
419−scientifically h = do
420− !positive <- ((== '+') <$> I.satisfy (\c -> c == '-' || c == '+')) <|>
421− pure True
422−
423− n <- decimal
424−
425− let f fracDigits = SP (T.foldl' step n fracDigits)
426− (negate $ T.length fracDigits)
427− step a c = a * 10 + fromIntegral (ord c - 48)
428−
429− SP c e <- (I.satisfy (=='.') *> (f <$> I.takeWhile isDigit)) <|>
430− pure (SP n 0)
431−
432− let !signedCoeff | positive = c
433− | otherwise = -c
434−
435− (I.satisfy (\w -> w == 'e' || w == 'E') *>
436− fmap (h . Sci.scientific signedCoeff . (e +)) (signed decimal)) <|>
437− return (h $ Sci.scientific signedCoeff e)
438−
439−-- | Parse a single digit, as recognised by 'isDigit'.
440−digit :: Parser Char
441−digit = I.satisfy isDigit <?> "digit"
442−{-# INLINE digit #-}
443−
444−-- | Parse a letter, as recognised by 'isAlpha'.
445−letter :: Parser Char
446−letter = I.satisfy isAlpha <?> "letter"
447−{-# INLINE letter #-}
448−
449−-- | Parse a space character, as recognised by 'isSpace'.
450−space :: Parser Char
451−space = I.satisfy isSpace <?> "space"
452−{-# INLINE space #-}
453−
454−-- | Skip over white space.
455−skipSpace :: Parser ()
456−skipSpace = I.skipWhile isSpace
457−{-# INLINE skipSpace #-}
458−
459−-- $specalt
460−--
461−-- If you enable the @OverloadedStrings@ language extension, you can
462−-- use the '*>' and '<*' combinators to simplify the common task of
463−-- matching a statically known string, then immediately parsing
464−-- something else.
465−--
466−-- Instead of writing something like this:
467−--
468−-- @
469−--'I.string' \"foo\" '*>' wibble
470−-- @
471−--
472−-- Using @OverloadedStrings@, you can omit the explicit use of
473−-- 'I.string', and write a more compact version:
474−--
475−-- @
476−-- \"foo\" '*>' wibble
477−-- @
478−--
479−-- (Note: the '.*>' and '<*.' combinators that were originally
480−-- provided for this purpose are obsolete and unnecessary, and will be
481−-- removed in the next major version.)
482−
483−-- | /Obsolete/. A type-specialized version of '*>' for 'Text'. Use
484−-- '*>' instead.
485−(.*>) :: Text -> Parser a -> Parser a
486−s .*> f = I.string s *> f
487−{-# DEPRECATED (.*>) "This is no longer necessary, and will be removed. Use '*>' instead." #-}
488−
489−-- | /Obsolete/. A type-specialized version of '<*' for 'Text'. Use
490−-- '*>' instead.
491−(<*.) :: Parser a -> Text -> Parser a
492−f <*. s = f <* I.string s
493−{-# DEPRECATED (<*.) "This is no longer necessary, and will be removed. Use '<*' instead." #-}
Data/Attoparsec/Text/Buffer.hsdeleted−172
@@ -1,172 +0,0 @@
1−{-# LANGUAGE BangPatterns, CPP, MagicHash, RankNTypes, RecordWildCards,
2− UnboxedTuples #-}
3−
4−-- |
5−-- Module : Data.Attoparsec.Text.Buffer
6−-- Copyright : Bryan O'Sullivan 2007-2015
7−-- License : BSD3
8−--
9−-- Maintainer : bos@serpentine.com
10−-- Stability : experimental
11−-- Portability : GHC
12−--
13−-- An immutable buffer that supports cheap appends.
14−
15−-- A Buffer is divided into an immutable read-only zone, followed by a
16−-- mutable area that we've preallocated, but not yet written to.
17−--
18−-- We overallocate at the end of a Buffer so that we can cheaply
19−-- append. Since a user of an existing Buffer cannot see past the end
20−-- of its immutable zone into the data that will change during an
21−-- append, this is safe.
22−--
23−-- Once we run out of space at the end of a Buffer, we do the usual
24−-- doubling of the buffer size.
25−
26−module Data.Attoparsec.Text.Buffer
27− (
28− Buffer
29− , buffer
30− , unbuffer
31− , unbufferAt
32− , length
33− , pappend
34− , iter
35− , iter_
36− , substring
37− , dropWord16
38− ) where
39−
40−import Control.Exception (assert)
41−import Data.Bits (shiftR)
42−import Data.List (foldl1')
43−import Data.Monoid as Mon (Monoid(..))
44−import Data.Semigroup (Semigroup(..))
45−import Data.Text ()
46−import Data.Text.Internal (Text(..))
47−import Data.Text.Internal.Encoding.Utf16 (chr2)
48−import Data.Text.Internal.Unsafe.Char (unsafeChr)
49−import Data.Text.Unsafe (Iter(..))
50−import Foreign.Storable (sizeOf)
51−import GHC.Base (Int(..), indexIntArray#, unsafeCoerce#, writeIntArray#)
52−import GHC.ST (ST(..), runST)
53−import Prelude hiding (length)
54−import qualified Data.Text.Array as A
55−
56−-- If _cap is zero, this buffer is empty.
57−data Buffer = Buf {
58− _arr :: {-# UNPACK #-} !A.Array
59− , _off :: {-# UNPACK #-} !Int
60− , _len :: {-# UNPACK #-} !Int
61− , _cap :: {-# UNPACK #-} !Int
62− , _gen :: {-# UNPACK #-} !Int
63− }
64−
65−instance Show Buffer where
66− showsPrec p = showsPrec p . unbuffer
67−
68−-- | The initial 'Buffer' has no mutable zone, so we can avoid all
69−-- copies in the (hopefully) common case of no further input being fed
70−-- to us.
71−buffer :: Text -> Buffer
72−buffer (Text arr off len) = Buf arr off len len 0
73−
74−unbuffer :: Buffer -> Text
75−unbuffer (Buf arr off len _ _) = Text arr off len
76−
77−unbufferAt :: Int -> Buffer -> Text
78−unbufferAt s (Buf arr off len _ _) =
79− assert (s >= 0 && s <= len) $
80− Text arr (off+s) (len-s)
81−
82−instance Semigroup Buffer where
83− (Buf _ _ _ 0 _) <> b = b
84− a <> (Buf _ _ _ 0 _) = a
85− buf <> (Buf arr off len _ _) = append buf arr off len
86− {-# INLINE (<>) #-}
87−
88−instance Monoid Buffer where
89− mempty = Buf A.empty 0 0 0 0
90− {-# INLINE mempty #-}
91−
92− mappend = (<>)
93−
94− mconcat [] = Mon.mempty
95− mconcat xs = foldl1' (<>) xs
96−
97−pappend :: Buffer -> Text -> Buffer
98−pappend (Buf _ _ _ 0 _) t = buffer t
99−pappend buf (Text arr off len) = append buf arr off len
100−
101−append :: Buffer -> A.Array -> Int -> Int -> Buffer
102−append (Buf arr0 off0 len0 cap0 gen0) !arr1 !off1 !len1 = runST $ do
103− let woff = sizeOf (0::Int) `shiftR` 1
104− newlen = len0 + len1
105− !gen = if gen0 == 0 then 0 else readGen arr0
106− if gen == gen0 && newlen <= cap0
107− then do
108− let newgen = gen + 1
109− marr <- unsafeThaw arr0
110− writeGen marr newgen
111− A.copyI marr (off0+len0) arr1 off1 (off0+newlen)
112− arr2 <- A.unsafeFreeze marr
113− return (Buf arr2 off0 newlen cap0 newgen)
114− else do
115− let newcap = newlen * 2
116− newgen = 1
117− marr <- A.new (newcap + woff)
118− writeGen marr newgen
119− A.copyI marr woff arr0 off0 (woff+len0)
120− A.copyI marr (woff+len0) arr1 off1 (woff+newlen)
121− arr2 <- A.unsafeFreeze marr
122− return (Buf arr2 woff newlen newcap newgen)
123−
124−length :: Buffer -> Int
125−length (Buf _ _ len _ _) = len
126−{-# INLINE length #-}
127−
128−substring :: Int -> Int -> Buffer -> Text
129−substring s l (Buf arr off len _ _) =
130− assert (s >= 0 && s <= len) .
131− assert (l >= 0 && l <= len-s) $
132− Text arr (off+s) l
133−{-# INLINE substring #-}
134−
135−dropWord16 :: Int -> Buffer -> Text
136−dropWord16 s (Buf arr off len _ _) =
137− assert (s >= 0 && s <= len) $
138− Text arr (off+s) (len-s)
139−{-# INLINE dropWord16 #-}
140−
141−-- | /O(1)/ Iterate (unsafely) one step forwards through a UTF-16
142−-- array, returning the current character and the delta to add to give
143−-- the next offset to iterate at.
144−iter :: Buffer -> Int -> Iter
145−iter (Buf arr off _ _ _) i
146− | m < 0xD800 || m > 0xDBFF = Iter (unsafeChr m) 1
147− | otherwise = Iter (chr2 m n) 2
148− where m = A.unsafeIndex arr j
149− n = A.unsafeIndex arr k
150− j = off + i
151− k = j + 1
152−{-# INLINE iter #-}
153−
154−-- | /O(1)/ Iterate one step through a UTF-16 array, returning the
155−-- delta to add to give the next offset to iterate at.
156−iter_ :: Buffer -> Int -> Int
157−iter_ (Buf arr off _ _ _) i | m < 0xD800 || m > 0xDBFF = 1
158− | otherwise = 2
159− where m = A.unsafeIndex arr (off+i)
160−{-# INLINE iter_ #-}
161−
162−unsafeThaw :: A.Array -> ST s (A.MArray s)
163−unsafeThaw A.Array{..} = ST $ \s# ->
164− (# s#, A.MArray (unsafeCoerce# aBA) #)
165−
166−readGen :: A.Array -> Int
167−readGen a = case indexIntArray# (A.aBA a) 0# of r# -> I# r#
168−
169−writeGen :: A.MArray s -> Int -> ST s ()
170−writeGen a (I# gen#) = ST $ \s0# ->
171− case writeIntArray# (A.maBA a) 0# gen# s0# of
172− s1# -> (# s1#, () #)
Data/Attoparsec/Text/FastSet.hsdeleted−121
@@ -1,121 +0,0 @@
1−{-# LANGUAGE BangPatterns #-}
2−
3−------------------------------------------------------------------------------
4−-- |
5−-- Module : Data.Attoparsec.FastSet
6−-- Copyright : Felipe Lessa 2010, Bryan O'Sullivan 2007-2015
7−-- License : BSD3
8−--
9−-- Maintainer : felipe.lessa@gmail.com
10−-- Stability : experimental
11−-- Portability : unknown
12−--
13−-- Fast set membership tests for 'Char' values. We test for
14−-- membership using a hashtable implemented with Robin Hood
15−-- collision resolution. The set representation is unboxed,
16−-- and the characters and hashes interleaved, for efficiency.
17−--
18−--
19−-----------------------------------------------------------------------------
20−module Data.Attoparsec.Text.FastSet
21− (
22− -- * Data type
23− FastSet
24− -- * Construction
25− , fromList
26− , set
27− -- * Lookup
28− , member
29− -- * Handy interface
30− , charClass
31− ) where
32−
33−import Data.Bits ((.|.), (.&.), shiftR)
34−import Data.Function (on)
35−import Data.List (sort, sortBy)
36−import qualified Data.Array.Base as AB
37−import qualified Data.Array.Unboxed as A
38−import qualified Data.Text as T
39−
40−data FastSet = FastSet {
41− table :: {-# UNPACK #-} !(A.UArray Int Int)
42− , mask :: {-# UNPACK #-} !Int
43− }
44−
45−data Entry = Entry {
46− key :: {-# UNPACK #-} !Char
47− , initialIndex :: {-# UNPACK #-} !Int
48− , index :: {-# UNPACK #-} !Int
49− }
50−
51−offset :: Entry -> Int
52−offset e = index e - initialIndex e
53−
54−resolveCollisions :: [Entry] -> [Entry]
55−resolveCollisions [] = []
56−resolveCollisions [e] = [e]
57−resolveCollisions (a:b:entries) = a' : resolveCollisions (b' : entries)
58− where (a', b')
59− | index a < index b = (a, b)
60− | offset a < offset b = (b { index=index a }, a { index=index a + 1 })
61− | otherwise = (a, b { index=index a + 1 })
62−
63−pad :: Int -> [Entry] -> [Entry]
64−pad = go 0
65− where -- ensure that we pad enough so that lookups beyond the
66− -- last hash in the table fall within the array
67− go !_ !m [] = replicate (max 1 m + 1) empty
68− go k m (e:entries) = map (const empty) [k..i - 1] ++ e :
69− go (i + 1) (m + i - k - 1) entries
70− where i = index e
71− empty = Entry '\0' maxBound 0
72−
73−nextPowerOf2 :: Int -> Int
74−nextPowerOf2 0 = 1
75−nextPowerOf2 x = go (x - 1) 1
76− where go y 32 = y + 1
77− go y k = go (y .|. (y `shiftR` k)) $ k * 2
78−
79−fastHash :: Char -> Int
80−fastHash = fromEnum
81−
82−fromList :: String -> FastSet
83−fromList s = FastSet (AB.listArray (0, length interleaved - 1) interleaved)
84− mask'
85− where s' = ordNub (sort s)
86− l = length s'
87− mask' = nextPowerOf2 ((5 * l) `div` 4) - 1
88− entries = pad mask' .
89− resolveCollisions .
90− sortBy (compare `on` initialIndex) .
91− zipWith (\c i -> Entry c i i) s' .
92− map ((.&. mask') . fastHash) $ s'
93− interleaved = concatMap (\e -> [fromEnum $ key e, initialIndex e])
94− entries
95−
96−ordNub :: Eq a => [a] -> [a]
97−ordNub [] = []
98−ordNub (y:ys) = go y ys
99− where go x (z:zs)
100− | x == z = go x zs
101− | otherwise = x : go z zs
102− go x [] = [x]
103−
104−set :: T.Text -> FastSet
105−set = fromList . T.unpack
106−
107−-- | Check the set for membership.
108−member :: Char -> FastSet -> Bool
109−member c a = go (2 * i)
110− where i = fastHash c .&. mask a
111− lookupAt j b = (i' <= i) && (c == c' || b)
112− where c' = toEnum $ AB.unsafeAt (table a) j
113− i' = AB.unsafeAt (table a) $ j + 1
114− go j = lookupAt j . lookupAt (j + 2) . lookupAt (j + 4) .
115− lookupAt (j + 6) . go $ j + 8
116−
117−charClass :: String -> FastSet
118−charClass = fromList . go
119− where go (a:'-':b:xs) = [a..b] ++ go xs
120− go (x:xs) = x : go xs
121− go _ = ""
Data/Attoparsec/Text/Internal.hsdeleted−549
@@ -1,549 +0,0 @@
1−{-# LANGUAGE BangPatterns, FlexibleInstances, GADTs, OverloadedStrings,
2− Rank2Types, RecordWildCards, TypeFamilies, TypeSynonymInstances #-}
3−{-# OPTIONS_GHC -fno-warn-orphans #-}
4−-- |
5−-- Module : Data.Attoparsec.Text.Internal
6−-- Copyright : Bryan O'Sullivan 2007-2015
7−-- License : BSD3
8−--
9−-- Maintainer : bos@serpentine.com
10−-- Stability : experimental
11−-- Portability : unknown
12−--
13−-- Simple, efficient parser combinators for 'Text' strings, loosely
14−-- based on the Parsec library.
15−
16−module Data.Attoparsec.Text.Internal
17− (
18− -- * Parser types
19− Parser
20− , Result
21−
22− -- * Running parsers
23− , parse
24− , parseOnly
25−
26− -- * Combinators
27− , module Data.Attoparsec.Combinator
28−
29− -- * Parsing individual characters
30− , satisfy
31− , satisfyWith
32− , anyChar
33− , skip
34− , char
35− , notChar
36−
37− -- ** Lookahead
38− , peekChar
39− , peekChar'
40−
41− -- ** Character classes
42− , inClass
43− , notInClass
44−
45− -- * Efficient string handling
46− , skipWhile
47− , string
48− , stringCI
49− , asciiCI
50− , take
51− , scan
52− , runScanner
53− , takeWhile
54− , takeWhile1
55− , takeTill
56−
57− -- ** Consume all remaining input
58− , takeText
59− , takeLazyText
60−
61− -- * Utilities
62− , endOfLine
63− , endOfInput
64− , match
65− , atEnd
66− ) where
67−
68−import Control.Applicative ((<|>), (<$>), pure, (*>))
69−import Control.Monad (when)
70−import Data.Attoparsec.Combinator ((<?>))
71−import Data.Attoparsec.Internal
72−import Data.Attoparsec.Internal.Types hiding (Parser, Failure, Success)
73−import qualified Data.Attoparsec.Text.Buffer as Buf
74−import Data.Attoparsec.Text.Buffer (Buffer, buffer)
75−import Data.Char (isAsciiUpper, isAsciiLower, toUpper, toLower)
76−import Data.List (intercalate)
77−import Data.String (IsString(..))
78−import Data.Text.Internal (Text(..))
79−import Prelude hiding (getChar, succ, take, takeWhile)
80−import qualified Data.Attoparsec.Internal.Types as T
81−import qualified Data.Attoparsec.Text.FastSet as Set
82−import qualified Data.Text as T
83−import qualified Data.Text.Lazy as L
84−import qualified Data.Text.Unsafe as T
85−
86−type Parser = T.Parser Text
87−type Result = IResult Text
88−type Failure r = T.Failure Text Buffer r
89−type Success a r = T.Success Text Buffer a r
90−
91−instance (a ~ Text) => IsString (Parser a) where
92− fromString = string . T.pack
93−
94−-- | The parser @satisfy p@ succeeds for any character for which the
95−-- predicate @p@ returns 'True'. Returns the character that is
96−-- actually parsed.
97−--
98−-- >digit = satisfy isDigit
99−-- > where isDigit c = c >= '0' && c <= '9'
100−satisfy :: (Char -> Bool) -> Parser Char
101−satisfy p = do
102− (k,c) <- ensure 1
103− let !h = T.unsafeHead c
104− if p h
105− then advance k >> return h
106− else fail "satisfy"
107−{-# INLINE satisfy #-}
108−
109−-- | The parser @skip p@ succeeds for any character for which the
110−-- predicate @p@ returns 'True'.
111−--
112−-- >skipDigit = skip isDigit
113−-- > where isDigit c = c >= '0' && c <= '9'
114−skip :: (Char -> Bool) -> Parser ()
115−skip p = do
116− (k,s) <- ensure 1
117− if p (T.unsafeHead s)
118− then advance k
119− else fail "skip"
120−
121−-- | The parser @satisfyWith f p@ transforms a character, and succeeds
122−-- if the predicate @p@ returns 'True' on the transformed value. The
123−-- parser returns the transformed character that was parsed.
124−satisfyWith :: (Char -> a) -> (a -> Bool) -> Parser a
125−satisfyWith f p = do
126− (k,s) <- ensure 1
127− let c = f $! T.unsafeHead s
128− if p c
129− then advance k >> return c
130− else fail "satisfyWith"
131−{-# INLINE satisfyWith #-}
132−
133−-- | Consume @n@ characters of input, but succeed only if the
134−-- predicate returns 'True'.
135−takeWith :: Int -> (Text -> Bool) -> Parser Text
136−takeWith n p = do
137− (k,s) <- ensure n
138− if p s
139− then advance k >> return s
140− else fail "takeWith"
141−
142−-- | Consume exactly @n@ characters of input.
143−take :: Int -> Parser Text
144−take n = takeWith (max n 0) (const True)
145−{-# INLINE take #-}
146−
147−-- | @string s@ parses a sequence of characters that identically match
148−-- @s@. Returns the parsed string (i.e. @s@). This parser consumes no
149−-- input if it fails (even if a partial match).
150−--
151−-- /Note/: The behaviour of this parser is different to that of the
152−-- similarly-named parser in Parsec, as this one is all-or-nothing.
153−-- To illustrate the difference, the following parser will fail under
154−-- Parsec given an input of @\"for\"@:
155−--
156−-- >string "foo" <|> string "for"
157−--
158−-- The reason for its failure is that the first branch is a
159−-- partial match, and will consume the letters @\'f\'@ and @\'o\'@
160−-- before failing. In attoparsec, the above parser will /succeed/ on
161−-- that input, because the failed first branch will consume nothing.
162−string :: Text -> Parser Text
163−string s = string_ (stringSuspended id) id s
164−{-# INLINE string #-}
165−
166−string_ :: (forall r. Text -> Text -> Buffer -> Pos -> More
167− -> Failure r -> Success Text r -> Result r)
168− -> (Text -> Text)
169− -> Text -> Parser Text
170−string_ suspended f s0 = T.Parser $ \t pos more lose succ ->
171− let s = f s0
172− ft = f (Buf.unbufferAt (fromPos pos) t)
173− in case T.commonPrefixes s ft of
174− Nothing
175− | T.null s -> succ t pos more T.empty
176− | T.null ft -> suspended s s t pos more lose succ
177− | otherwise -> lose t pos more [] "string"
178− Just (pfx,ssfx,tsfx)
179− | T.null ssfx -> let l = Pos (T.lengthWord16 pfx)
180− in succ t (pos + l) more (substring pos l t)
181− | not (T.null tsfx) -> lose t pos more [] "string"
182− | otherwise -> suspended s ssfx t pos more lose succ
183−{-# INLINE string_ #-}
184−
185−stringSuspended :: (Text -> Text)
186− -> Text -> Text -> Buffer -> Pos -> More
187− -> Failure r
188− -> Success Text r
189− -> Result r
190−stringSuspended f s000 s0 t0 pos0 more0 lose0 succ0 =
191− runParser (demandInput_ >>= go) t0 pos0 more0 lose0 succ0
192− where
193− go s' = T.Parser $ \t pos more lose succ ->
194− let s = f s'
195− in case T.commonPrefixes s0 s of
196− Nothing -> lose t pos more [] "string"
197− Just (_pfx,ssfx,tsfx)
198− | T.null ssfx -> let l = Pos (T.lengthWord16 s000)
199− in succ t (pos + l) more (substring pos l t)
200− | T.null tsfx -> stringSuspended f s000 ssfx t pos more lose succ
201− | otherwise -> lose t pos more [] "string"
202−
203−-- | Satisfy a literal string, ignoring case.
204−--
205−-- Note: this function is currently quite inefficient. Unicode case
206−-- folding can change the length of a string (\"&#223;\" becomes
207−-- "ss"), which makes a simple, efficient implementation tricky. We
208−-- have (for now) chosen simplicity over efficiency.
209−stringCI :: Text -> Parser Text
210−stringCI s = go 0
211− where
212− go !n
213− | n > T.length fs = fail "stringCI"
214− | otherwise = do
215− (k,t) <- ensure n
216− if T.toCaseFold t == fs
217− then advance k >> return t
218− else go (n+1)
219− fs = T.toCaseFold s
220−{-# INLINE stringCI #-}
221−{-# DEPRECATED stringCI "this is very inefficient, use asciiCI instead" #-}
222−
223−-- | Satisfy a literal string, ignoring case for characters in the ASCII range.
224−asciiCI :: Text -> Parser Text
225−asciiCI s = fmap fst $ match $ T.foldr ((*>) . asciiCharCI) (pure ()) s
226−{-# INLINE asciiCI #-}
227−
228−asciiCharCI :: Char -> Parser Char
229−asciiCharCI c
230− | isAsciiUpper c = char c <|> char (toLower c)
231− | isAsciiLower c = char c <|> char (toUpper c)
232− | otherwise = char c
233−{-# INLINE asciiCharCI #-}
234−
235−-- | Skip past input for as long as the predicate returns 'True'.
236−skipWhile :: (Char -> Bool) -> Parser ()
237−skipWhile p = go
238− where
239− go = do
240− t <- T.takeWhile p <$> get
241− continue <- inputSpansChunks (size t)
242− when continue go
243−{-# INLINE skipWhile #-}
244−
245−-- | Consume input as long as the predicate returns 'False'
246−-- (i.e. until it returns 'True'), and return the consumed input.
247−--
248−-- This parser does not fail. It will return an empty string if the
249−-- predicate returns 'True' on the first character of input.
250−--
251−-- /Note/: Because this parser does not fail, do not use it with
252−-- combinators such as 'Control.Applicative.many', because such
253−-- parsers loop until a failure occurs. Careless use will thus result
254−-- in an infinite loop.
255−takeTill :: (Char -> Bool) -> Parser Text
256−takeTill p = takeWhile (not . p)
257−{-# INLINE takeTill #-}
258−
259−-- | Consume input as long as the predicate returns 'True', and return
260−-- the consumed input.
261−--
262−-- This parser does not fail. It will return an empty string if the
263−-- predicate returns 'False' on the first character of input.
264−--
265−-- /Note/: Because this parser does not fail, do not use it with
266−-- combinators such as 'Control.Applicative.many', because such
267−-- parsers loop until a failure occurs. Careless use will thus result
268−-- in an infinite loop.
269−takeWhile :: (Char -> Bool) -> Parser Text
270−takeWhile p = do
271− h <- T.takeWhile p <$> get
272− continue <- inputSpansChunks (size h)
273− -- only use slow concat path if necessary
274− if continue
275− then takeWhileAcc p [h]
276− else return h
277−{-# INLINE takeWhile #-}
278−
279−takeWhileAcc :: (Char -> Bool) -> [Text] -> Parser Text
280−takeWhileAcc p = go
281− where
282− go acc = do
283− h <- T.takeWhile p <$> get
284− continue <- inputSpansChunks (size h)
285− if continue
286− then go (h:acc)
287− else return $ concatReverse (h:acc)
288−{-# INLINE takeWhileAcc #-}
289−
290−takeRest :: Parser [Text]
291−takeRest = go []
292− where
293− go acc = do
294− input <- wantInput
295− if input
296− then do
297− s <- get
298− advance (size s)
299− go (s:acc)
300− else return (reverse acc)
301−
302−-- | Consume all remaining input and return it as a single string.
303−takeText :: Parser Text
304−takeText = T.concat `fmap` takeRest
305−
306−-- | Consume all remaining input and return it as a single string.
307−takeLazyText :: Parser L.Text
308−takeLazyText = L.fromChunks `fmap` takeRest
309−
310−data Scan s = Continue s
311− | Finished s {-# UNPACK #-} !Int Text
312−
313−scan_ :: (s -> [Text] -> Parser r) -> s -> (s -> Char -> Maybe s) -> Parser r
314−scan_ f s0 p = go [] s0
315− where
316− scanner s !n t =
317− case T.uncons t of
318− Just (c,t') -> case p s c of
319− Just s' -> scanner s' (n+1) t'
320− Nothing -> Finished s n t
321− Nothing -> Continue s
322− go acc s = do
323− input <- get
324− case scanner s 0 input of
325− Continue s' -> do continue <- inputSpansChunks (size input)
326− if continue
327− then go (input : acc) s'
328− else f s' (input : acc)
329− Finished s' n t -> do advance (size input - size t)
330− f s' (T.take n input : acc)
331−{-# INLINE scan_ #-}
332−
333−-- | A stateful scanner. The predicate consumes and transforms a
334−-- state argument, and each transformed state is passed to successive
335−-- invocations of the predicate on each character of the input until one
336−-- returns 'Nothing' or the input ends.
337−--
338−-- This parser does not fail. It will return an empty string if the
339−-- predicate returns 'Nothing' on the first character of input.
340−--
341−-- /Note/: Because this parser does not fail, do not use it with
342−-- combinators such as 'Control.Applicative.many', because such
343−-- parsers loop until a failure occurs. Careless use will thus result
344−-- in an infinite loop.
345−scan :: s -> (s -> Char -> Maybe s) -> Parser Text
346−scan = scan_ $ \_ chunks -> return $! concatReverse chunks
347−{-# INLINE scan #-}
348−
349−-- | Like 'scan', but generalized to return the final state of the
350−-- scanner.
351−runScanner :: s -> (s -> Char -> Maybe s) -> Parser (Text, s)
352−runScanner = scan_ $ \s xs -> let !sx = concatReverse xs in return (sx, s)
353−{-# INLINE runScanner #-}
354−
355−-- | Consume input as long as the predicate returns 'True', and return
356−-- the consumed input.
357−--
358−-- This parser requires the predicate to succeed on at least one
359−-- character of input: it will fail if the predicate never returns
360−-- 'True' or if there is no input left.
361−takeWhile1 :: (Char -> Bool) -> Parser Text
362−takeWhile1 p = do
363− (`when` demandInput) =<< endOfChunk
364− h <- T.takeWhile p <$> get
365− let size' = size h
366− when (size' == 0) $ fail "takeWhile1"
367− advance size'
368− eoc <- endOfChunk
369− if eoc
370− then takeWhileAcc p [h]
371− else return h
372−{-# INLINE takeWhile1 #-}
373−
374−-- | Match any character in a set.
375−--
376−-- >vowel = inClass "aeiou"
377−--
378−-- Range notation is supported.
379−--
380−-- >halfAlphabet = inClass "a-nA-N"
381−--
382−-- To add a literal @\'-\'@ to a set, place it at the beginning or end
383−-- of the string.
384−inClass :: String -> Char -> Bool
385−inClass s = (`Set.member` mySet)
386− where mySet = Set.charClass s
387− {-# NOINLINE mySet #-}
388−{-# INLINE inClass #-}
389−
390−-- | Match any character not in a set.
391−notInClass :: String -> Char -> Bool
392−notInClass s = not . inClass s
393−{-# INLINE notInClass #-}
394−
395−-- | Match any character.
396−anyChar :: Parser Char
397−anyChar = satisfy $ const True
398−{-# INLINE anyChar #-}
399−
400−-- | Match a specific character.
401−char :: Char -> Parser Char
402−char c = satisfy (== c) <?> show c
403−{-# INLINE char #-}
404−
405−-- | Match any character except the given one.
406−notChar :: Char -> Parser Char
407−notChar c = satisfy (/= c) <?> "not " ++ show c
408−{-# INLINE notChar #-}
409−
410−-- | Match any character, to perform lookahead. Returns 'Nothing' if
411−-- end of input has been reached. Does not consume any input.
412−--
413−-- /Note/: Because this parser does not fail, do not use it with
414−-- combinators such as 'Control.Applicative.many', because such
415−-- parsers loop until a failure occurs. Careless use will thus result
416−-- in an infinite loop.
417−peekChar :: Parser (Maybe Char)
418−peekChar = T.Parser $ \t pos more _lose succ ->
419− case () of
420− _| pos < lengthOf t ->
421− let T.Iter !c _ = Buf.iter t (fromPos pos)
422− in succ t pos more (Just c)
423− | more == Complete ->
424− succ t pos more Nothing
425− | otherwise ->
426− let succ' t' pos' more' =
427− let T.Iter !c _ = Buf.iter t' (fromPos pos')
428− in succ t' pos' more' (Just c)
429− lose' t' pos' more' = succ t' pos' more' Nothing
430− in prompt t pos more lose' succ'
431−{-# INLINE peekChar #-}
432−
433−-- | Match any character, to perform lookahead. Does not consume any
434−-- input, but will fail if end of input has been reached.
435−peekChar' :: Parser Char
436−peekChar' = do
437− (_,s) <- ensure 1
438− return $! T.unsafeHead s
439−{-# INLINE peekChar' #-}
440−
441−-- | Match either a single newline character @\'\\n\'@, or a carriage
442−-- return followed by a newline character @\"\\r\\n\"@.
443−endOfLine :: Parser ()
444−endOfLine = (char '\n' >> return ()) <|> (string "\r\n" >> return ())
445−
446−-- | Terminal failure continuation.
447−failK :: Failure a
448−failK t (Pos pos) _more stack msg = Fail (Buf.dropWord16 pos t) stack msg
449−{-# INLINE failK #-}
450−
451−-- | Terminal success continuation.
452−successK :: Success a a
453−successK t (Pos pos) _more a = Done (Buf.dropWord16 pos t) a
454−{-# INLINE successK #-}
455−
456−-- | Run a parser.
457−parse :: Parser a -> Text -> Result a
458−parse m s = runParser m (buffer s) 0 Incomplete failK successK
459−{-# INLINE parse #-}
460−
461−-- | Run a parser that cannot be resupplied via a 'Partial' result.
462−--
463−-- This function does not force a parser to consume all of its input.
464−-- Instead, any residual input will be discarded. To force a parser
465−-- to consume all of its input, use something like this:
466−--
467−-- @
468−--'parseOnly' (myParser 'Control.Applicative.<*' 'endOfInput')
469−-- @
470−parseOnly :: Parser a -> Text -> Either String a
471−parseOnly m s = case runParser m (buffer s) 0 Complete failK successK of
472− Fail _ [] err -> Left err
473− Fail _ ctxs err -> Left (intercalate " > " ctxs ++ ": " ++ err)
474− Done _ a -> Right a
475− _ -> error "parseOnly: impossible error!"
476−{-# INLINE parseOnly #-}
477−
478−get :: Parser Text
479−get = T.Parser $ \t pos more _lose succ ->
480− succ t pos more (Buf.dropWord16 (fromPos pos) t)
481−{-# INLINE get #-}
482−
483−endOfChunk :: Parser Bool
484−endOfChunk = T.Parser $ \t pos more _lose succ ->
485− succ t pos more (pos == lengthOf t)
486−{-# INLINE endOfChunk #-}
487−
488−inputSpansChunks :: Pos -> Parser Bool
489−inputSpansChunks i = T.Parser $ \t pos_ more _lose succ ->
490− let pos = pos_ + i
491− in if pos < lengthOf t || more == Complete
492− then succ t pos more False
493− else let lose' t' pos' more' = succ t' pos' more' False
494− succ' t' pos' more' = succ t' pos' more' True
495− in prompt t pos more lose' succ'
496−{-# INLINE inputSpansChunks #-}
497−
498−advance :: Pos -> Parser ()
499−advance n = T.Parser $ \t pos more _lose succ -> succ t (pos+n) more ()
500−{-# INLINE advance #-}
501−
502−ensureSuspended :: Int -> Buffer -> Pos -> More
503− -> Failure r -> Success (Pos, Text) r
504− -> Result r
505−ensureSuspended n t pos more lose succ =
506− runParser (demandInput >> go) t pos more lose succ
507− where go = T.Parser $ \t' pos' more' lose' succ' ->
508− case lengthAtLeast pos' n t' of
509− Just n' -> succ' t' pos' more' (n', substring pos n' t')
510− Nothing -> runParser (demandInput >> go) t' pos' more' lose' succ'
511−
512−-- | If at least @n@ elements of input are available, return the
513−-- current input, otherwise fail.
514−ensure :: Int -> Parser (Pos, Text)
515−ensure n = T.Parser $ \t pos more lose succ ->
516− case lengthAtLeast pos n t of
517− Just n' -> succ t pos more (n', substring pos n' t)
518− -- The uncommon case is kept out-of-line to reduce code size:
519− Nothing -> ensureSuspended n t pos more lose succ
520−{-# INLINE ensure #-}
521−
522−-- | Return both the result of a parse and the portion of the input
523−-- that was consumed while it was being parsed.
524−match :: Parser a -> Parser (Text, a)
525−match p = T.Parser $ \t pos more lose succ ->
526− let succ' t' pos' more' a = succ t' pos' more'
527− (substring pos (pos'-pos) t', a)
528− in runParser p t pos more lose succ'
529−
530−-- | Ensure that at least @n@ code points of input are available.
531−-- Returns the number of words consumed while traversing.
532−lengthAtLeast :: Pos -> Int -> Buffer -> Maybe Pos
533−lengthAtLeast pos n t = go 0 (fromPos pos)
534− where go i !p
535− | i == n = Just (Pos p - pos)
536− | p == len = Nothing
537− | otherwise = go (i+1) (p + Buf.iter_ t p)
538− Pos len = lengthOf t
539−{-# INLINE lengthAtLeast #-}
540−
541−substring :: Pos -> Pos -> Buffer -> Text
542−substring (Pos pos) (Pos n) = Buf.substring pos n
543−{-# INLINE substring #-}
544−
545−lengthOf :: Buffer -> Pos
546−lengthOf = Pos . Buf.length
547−
548−size :: Text -> Pos
549−size (Text _ _ l) = Pos l
Data/Attoparsec/Text/Lazy.hsdeleted−101
@@ -1,101 +0,0 @@
1−{-# LANGUAGE CPP #-}
2−#if __GLASGOW_HASKELL__ >= 702
3−{-# LANGUAGE Trustworthy #-} -- Imports internal modules
4−#endif
5−
6−{-# OPTIONS_GHC -fno-warn-warnings-deprecations #-}
7−-- |
8−-- Module : Data.Attoparsec.Text.Lazy
9−-- Copyright : Bryan O'Sullivan 2007-2015
10−-- License : BSD3
11−--
12−-- Maintainer : bos@serpentine.com
13−-- Stability : experimental
14−-- Portability : unknown
15−--
16−-- Simple, efficient combinator parsing that can consume lazy 'Text'
17−-- strings, loosely based on the Parsec library.
18−--
19−-- This is essentially the same code as in the 'Data.Attoparsec.Text'
20−-- module, only with a 'parse' function that can consume a lazy
21−-- 'Text' incrementally, and a 'Result' type that does not allow
22−-- more input to be fed in. Think of this as suitable for use with a
23−-- lazily read file, e.g. via 'L.readFile' or 'L.hGetContents'.
24−--
25−-- /Note:/ The various parser functions and combinators such as
26−-- 'string' still expect /strict/ 'T.Text' parameters, and return
27−-- strict 'T.Text' results. Behind the scenes, strict 'T.Text' values
28−-- are still used internally to store parser input and manipulate it
29−-- efficiently.
30−
31−module Data.Attoparsec.Text.Lazy
32− (
33− Result(..)
34− , module Data.Attoparsec.Text
35− -- * Running parsers
36− , parse
37− , parseTest
38− -- ** Result conversion
39− , maybeResult
40− , eitherResult
41− ) where
42−
43−import Control.DeepSeq (NFData(rnf))
44−import Data.List (intercalate)
45−import Data.Text.Lazy.Internal (Text(..), chunk)
46−import qualified Data.Attoparsec.Internal.Types as T
47−import qualified Data.Attoparsec.Text as A
48−import qualified Data.Text as T
49−import Data.Attoparsec.Text hiding (IResult(..), Result, eitherResult,
50− maybeResult, parse, parseWith, parseTest)
51−
52−-- | The result of a parse.
53−data Result r = Fail Text [String] String
54− -- ^ The parse failed. The 'Text' is the input
55− -- that had not yet been consumed when the failure
56− -- occurred. The @[@'String'@]@ is a list of contexts
57− -- in which the error occurred. The 'String' is the
58− -- message describing the error, if any.
59− | Done Text r
60− -- ^ The parse succeeded. The 'Text' is the
61− -- input that had not yet been consumed (if any) when
62− -- the parse succeeded.
63− deriving (Show)
64−
65−instance NFData r => NFData (Result r) where
66− rnf (Fail bs ctxs msg) = rnf bs `seq` rnf ctxs `seq` rnf msg
67− rnf (Done bs r) = rnf bs `seq` rnf r
68− {-# INLINE rnf #-}
69−
70−fmapR :: (a -> b) -> Result a -> Result b
71−fmapR _ (Fail st stk msg) = Fail st stk msg
72−fmapR f (Done bs r) = Done bs (f r)
73−
74−instance Functor Result where
75− fmap = fmapR
76−
77−-- | Run a parser and return its result.
78−parse :: A.Parser a -> Text -> Result a
79−parse p s = case s of
80− Chunk x xs -> go (A.parse p x) xs
81− empty -> go (A.parse p T.empty) empty
82− where
83− go (T.Fail x stk msg) ys = Fail (chunk x ys) stk msg
84− go (T.Done x r) ys = Done (chunk x ys) r
85− go (T.Partial k) (Chunk y ys) = go (k y) ys
86− go (T.Partial k) empty = go (k T.empty) empty
87−
88−-- | Run a parser and print its result to standard output.
89−parseTest :: (Show a) => A.Parser a -> Text -> IO ()
90−parseTest p s = print (parse p s)
91−
92−-- | Convert a 'Result' value to a 'Maybe' value.
93−maybeResult :: Result r -> Maybe r
94−maybeResult (Done _ r) = Just r
95−maybeResult _ = Nothing
96−
97−-- | Convert a 'Result' value to an 'Either' value.
98−eitherResult :: Result r -> Either String r
99−eitherResult (Done _ r) = Right r
100−eitherResult (Fail _ [] msg) = Left msg
101−eitherResult (Fail _ ctxs msg) = Left (intercalate " > " ctxs ++ ": " ++ msg)
Data/Attoparsec/Types.hsdeleted−20
@@ -1,20 +0,0 @@
1−-- |
2−-- Module : Data.Attoparsec.Types
3−-- Copyright : Bryan O'Sullivan 2007-2015
4−-- License : BSD3
5−--
6−-- Maintainer : bos@serpentine.com
7−-- Stability : experimental
8−-- Portability : unknown
9−--
10−-- Simple, efficient parser combinators for strings, loosely based on
11−-- the Parsec library.
12−
13−module Data.Attoparsec.Types
14− (
15− Parser
16− , IResult(..)
17− , Chunk(chunkElemToChar)
18− ) where
19−
20−import Data.Attoparsec.Internal.Types (Parser(..), IResult(..), Chunk(..))
Data/Attoparsec/Zepto.hsdeleted−192
@@ -1,192 +0,0 @@
1−{-# LANGUAGE CPP #-}
2−#if __GLASGOW_HASKELL__ >= 702
3−{-# LANGUAGE Trustworthy #-} -- Data.ByteString.Unsafe
4−#endif
5−{-# LANGUAGE BangPatterns #-}
6−
7−-- |
8−-- Module : Data.Attoparsec.Zepto
9−-- Copyright : Bryan O'Sullivan 2007-2015
10−-- License : BSD3
11−--
12−-- Maintainer : bos@serpentine.com
13−-- Stability : experimental
14−-- Portability : unknown
15−--
16−-- A tiny, highly specialized combinator parser for 'B.ByteString'
17−-- strings.
18−--
19−-- While the main attoparsec module generally performs well, this
20−-- module is particularly fast for simple non-recursive loops that
21−-- should not normally result in failed parses.
22−--
23−-- /Warning/: on more complex inputs involving recursion or failure,
24−-- parsers based on this module may be as much as /ten times slower/
25−-- than regular attoparsec! You should /only/ use this module when you
26−-- have benchmarks that prove that its use speeds your code up.
27−module Data.Attoparsec.Zepto
28− (
29− Parser
30− , ZeptoT
31− , parse
32− , parseT
33− , atEnd
34− , string
35− , take
36− , takeWhile
37− ) where
38−
39−import Control.Applicative
40−import Control.Monad (MonadPlus(..), ap)
41−import qualified Control.Monad.Fail as Fail
42−import Control.Monad.IO.Class (MonadIO(..))
43−import Data.ByteString (ByteString)
44−import Data.Functor.Identity (Identity(runIdentity))
45−import Data.Monoid as Mon (Monoid(..))
46−import Data.Semigroup (Semigroup(..))
47−import Data.Word (Word8)
48−import Prelude hiding (take, takeWhile)
49−import qualified Data.ByteString as B
50−import qualified Data.ByteString.Unsafe as B
51−
52−newtype S = S {
53− input :: ByteString
54− }
55−
56−data Result a = Fail String
57− | OK !a S
58−
59−-- | A simple parser.
60−--
61−-- This monad is strict in its state, and the monadic bind operator
62−-- ('>>=') evaluates each result to weak head normal form before
63−-- passing it along.
64−newtype ZeptoT m a = Parser {
65− runParser :: S -> m (Result a)
66− }
67−
68−type Parser a = ZeptoT Identity a
69−
70−instance Monad m => Functor (ZeptoT m) where
71− fmap f m = Parser $ \s -> do
72− result <- runParser m s
73− case result of
74− OK a s' -> return (OK (f a) s')
75− Fail err -> return (Fail err)
76− {-# INLINE fmap #-}
77−
78−instance MonadIO m => MonadIO (ZeptoT m) where
79− liftIO act = Parser $ \s -> do
80− result <- liftIO act
81− return (OK result s)
82− {-# INLINE liftIO #-}
83−
84−instance Monad m => Monad (ZeptoT m) where
85− return = pure
86− {-# INLINE return #-}
87−
88− m >>= k = Parser $ \s -> do
89− result <- runParser m s
90− case result of
91− OK a s' -> runParser (k a) s'
92− Fail err -> return (Fail err)
93− {-# INLINE (>>=) #-}
94−
95−#if !(MIN_VERSION_base(4,13,0))
96− fail = Fail.fail
97− {-# INLINE fail #-}
98−#endif
99−
100−instance Monad m => Fail.MonadFail (ZeptoT m) where
101− fail msg = Parser $ \_ -> return (Fail msg)
102− {-# INLINE fail #-}
103−
104−instance Monad m => MonadPlus (ZeptoT m) where
105− mzero = fail "mzero"
106− {-# INLINE mzero #-}
107−
108− mplus a b = Parser $ \s -> do
109− result <- runParser a s
110− case result of
111− ok@(OK _ _) -> return ok
112− _ -> runParser b s
113− {-# INLINE mplus #-}
114−
115−instance (Monad m) => Applicative (ZeptoT m) where
116− pure a = Parser $ \s -> return (OK a s)
117− {-# INLINE pure #-}
118− (<*>) = ap
119− {-# INLINE (<*>) #-}
120−
121−gets :: Monad m => (S -> a) -> ZeptoT m a
122−gets f = Parser $ \s -> return (OK (f s) s)
123−{-# INLINE gets #-}
124−
125−put :: Monad m => S -> ZeptoT m ()
126−put s = Parser $ \_ -> return (OK () s)
127−{-# INLINE put #-}
128−
129−-- | Run a parser.
130−parse :: Parser a -> ByteString -> Either String a
131−parse p bs = case runIdentity (runParser p (S bs)) of
132− (OK a _) -> Right a
133− (Fail err) -> Left err
134−{-# INLINE parse #-}
135−
136−-- | Run a parser on top of the given base monad.
137−parseT :: Monad m => ZeptoT m a -> ByteString -> m (Either String a)
138−parseT p bs = do
139− result <- runParser p (S bs)
140− case result of
141− OK a _ -> return (Right a)
142− Fail err -> return (Left err)
143−{-# INLINE parseT #-}
144−
145−instance Monad m => Semigroup (ZeptoT m a) where
146− (<>) = mplus
147− {-# INLINE (<>) #-}
148−
149−instance Monad m => Mon.Monoid (ZeptoT m a) where
150− mempty = fail "mempty"
151− {-# INLINE mempty #-}
152− mappend = (<>)
153− {-# INLINE mappend #-}
154−
155−instance Monad m => Alternative (ZeptoT m) where
156− empty = fail "empty"
157− {-# INLINE empty #-}
158− (<|>) = mplus
159− {-# INLINE (<|>) #-}
160−
161−-- | Consume input while the predicate returns 'True'.
162−takeWhile :: Monad m => (Word8 -> Bool) -> ZeptoT m ByteString
163−takeWhile p = do
164− (h,t) <- gets (B.span p . input)
165− put (S t)
166− return h
167−{-# INLINE takeWhile #-}
168−
169−-- | Consume @n@ bytes of input.
170−take :: Monad m => Int -> ZeptoT m ByteString
171−take !n = do
172− s <- gets input
173− if B.length s >= n
174− then put (S (B.unsafeDrop n s)) >> return (B.unsafeTake n s)
175− else fail "insufficient input"
176−{-# INLINE take #-}
177−
178−-- | Match a string exactly.
179−string :: Monad m => ByteString -> ZeptoT m ()
180−string s = do
181− i <- gets input
182− if s `B.isPrefixOf` i
183− then put (S (B.unsafeDrop (B.length s) i)) >> return ()
184− else fail "string"
185−{-# INLINE string #-}
186−
187−-- | Indicate whether the end of the input has been reached.
188−atEnd :: Monad m => ZeptoT m Bool
189−atEnd = do
190− i <- gets input
191− return $! B.null i
192−{-# INLINE atEnd #-}
README.markdowndeleted−23
@@ -1,23 +0,0 @@
1−# Welcome to attoparsec
2−
3−attoparsec is a fast Haskell parser combinator library, aimed
4−particularly at dealing efficiently with network protocols and
5−complicated text/binary file formats.
6−
7−# Join in!
8−
9−I'm happy to receive bug reports, fixes, documentation enhancements,
10−and other improvements.
11−
12−Please report bugs via the
13−[github issue tracker](https://github.com/bos/attoparsec/issues).
14−
15−Master [git repository](https://github.com/bos/attoparsec):
16−
17−* `git clone git://github.com/bos/attoparsec.git`
18−
19−Authors
20−-------
21−
22−This library is written and maintained by Bryan O'Sullivan,
23−<bos@serpentine.com>.
Setup.hsnew file+2
@@ -0,0 +1,2 @@
1+import Distribution.Simple
2+main = defaultMain
Setup.lhsdeleted−3
@@ -1,3 +0,0 @@
1−#!/usr/bin/env runhaskell
2−> import Distribution.Simple
3−> main = defaultMain
attoparsec.cabaldeleted−194
@@ -1,194 +0,0 @@
1−name: attoparsec
2−version: 0.13.2.2
3−x-revision: 3
4−license: BSD3
5−license-file: LICENSE
6−category: Text, Parsing
7−author: Bryan O'Sullivan <bos@serpentine.com>
8−maintainer: Bryan O'Sullivan <bos@serpentine.com>, Ben Gamari <ben@smart-cactus.org>
9−stability: experimental
10−tested-with: GHC == 7.0.4, GHC == 7.2.2, GHC == 7.4.2, GHC ==7.6.3, GHC ==7.8.4, GHC ==7.10.3, GHC ==8.0.2, GHC ==8.2.2, GHC==8.4.4, GHC==8.6.5, GHC==8.8.1
11−synopsis: Fast combinator parsing for bytestrings and text
12−cabal-version: >= 1.8
13−homepage: https://github.com/bos/attoparsec
14−bug-reports: https://github.com/bos/attoparsec/issues
15−build-type: Simple
16−description:
17− A fast parser combinator library, aimed particularly at dealing
18− efficiently with network protocols and complicated text/binary
19− file formats.
20−extra-source-files:
21− README.markdown
22− benchmarks/*.cabal
23− benchmarks/*.hs
24− benchmarks/*.txt
25− benchmarks/json-data/*.json
26− benchmarks/Makefile
27− benchmarks/med.txt.bz2
28− changelog.md
29− examples/*.c
30− examples/*.hs
31− examples/Makefile
32− tests/*.hs
33− tests/QC/*.hs
34− tests/QC/IPv6/*.hs
35−
36−Flag developer
37− Description: Whether to build the library in development mode
38− Default: False
39− Manual: True
40−
41−library
42− build-depends: array,
43− base >= 4.3 && < 5,
44− bytestring,
45− containers,
46− deepseq,
47− scientific >= 0.3.1 && < 0.4,
48− transformers >= 0.2 && (< 0.4 || >= 0.4.1.0) && < 0.6,
49− text >= 1.1.1.3
50− if impl(ghc < 7.4)
51− build-depends:
52− bytestring < 0.10.4.0
53−
54− if !impl(ghc >= 8.0)
55− -- Data.Semigroup && Control.Monad.Fail are available in base-4.9+
56− build-depends: fail == 4.9.*,
57− semigroups >=0.16.1 && <0.20
58−
59− exposed-modules: Data.Attoparsec
60− Data.Attoparsec.ByteString
61− Data.Attoparsec.ByteString.Char8
62− Data.Attoparsec.ByteString.Lazy
63− Data.Attoparsec.Char8
64− Data.Attoparsec.Combinator
65− Data.Attoparsec.Internal
66− Data.Attoparsec.Internal.Types
67− Data.Attoparsec.Lazy
68− Data.Attoparsec.Number
69− Data.Attoparsec.Text
70− Data.Attoparsec.Text.Lazy
71− Data.Attoparsec.Types
72− Data.Attoparsec.Zepto
73− other-modules: Data.Attoparsec.ByteString.Buffer
74− Data.Attoparsec.ByteString.FastSet
75− Data.Attoparsec.ByteString.Internal
76− Data.Attoparsec.Internal.Fhthagn
77− Data.Attoparsec.Text.Buffer
78− Data.Attoparsec.Text.FastSet
79− Data.Attoparsec.Text.Internal
80− ghc-options: -O2 -Wall
81−
82− if flag(developer)
83− ghc-prof-options: -auto-all
84− ghc-options: -Werror
85−
86−test-suite tests
87− type: exitcode-stdio-1.0
88− hs-source-dirs: tests .
89− main-is: QC.hs
90− other-modules: QC.Buffer
91− QC.ByteString
92− QC.Combinator
93− QC.Common
94− QC.IPv6.Internal
95− QC.IPv6.Types
96− QC.Rechunked
97− QC.Simple
98− QC.Text
99− QC.Text.FastSet
100− QC.Text.Regressions
101−
102− other-modules: Data.Attoparsec.ByteString
103− Data.Attoparsec.ByteString.Buffer
104− Data.Attoparsec.ByteString.Char8
105− Data.Attoparsec.ByteString.FastSet
106− Data.Attoparsec.ByteString.Internal
107− Data.Attoparsec.ByteString.Lazy
108− Data.Attoparsec.Combinator
109− Data.Attoparsec.Internal
110− Data.Attoparsec.Internal.Fhthagn
111− Data.Attoparsec.Internal.Types
112− Data.Attoparsec.Number
113− Data.Attoparsec.Text
114− Data.Attoparsec.Text.Buffer
115− Data.Attoparsec.Text.FastSet
116− Data.Attoparsec.Text.Internal
117− Data.Attoparsec.Text.Lazy
118− Data.Attoparsec.Zepto
119−
120− ghc-options:
121− -Wall -threaded -rtsopts
122−
123− if flag(developer)
124− ghc-options: -Werror
125−
126− build-depends:
127− array,
128− base,
129− bytestring,
130− deepseq >= 1.1,
131− QuickCheck >= 2.13.2 && < 2.14,
132− quickcheck-unicode,
133− scientific,
134− tasty >= 0.11,
135− tasty-quickcheck >= 0.8,
136− text,
137− transformers >= 0.2 && (< 0.4 || >= 0.4.1.0) && < 0.6,
138− vector
139−
140− if !impl(ghc >= 8.0)
141− -- Data.Semigroup && Control.Monad.Fail are available in base-4.9+
142− build-depends: fail == 4.9.*,
143− semigroups >=0.16.1 && <0.20
144−
145−benchmark benchmarks
146− type: exitcode-stdio-1.0
147− hs-source-dirs: benchmarks benchmarks/warp-3.0.1.1 .
148− ghc-options: -O2 -Wall -rtsopts
149− main-is: Benchmarks.hs
150− other-modules:
151− Common
152− HeadersByteString
153− HeadersByteString.Atto
154− HeadersText
155− Links
156− Network.Wai.Handler.Warp.ReadInt
157− Network.Wai.Handler.Warp.RequestHeader
158− Numbers
159− Sets
160− TextFastSet
161− Warp
162− ghc-options: -O2 -Wall
163−
164− if flag(developer)
165− ghc-options: -Werror
166−
167− build-depends:
168− array,
169− base == 4.*,
170− bytestring >= 0.10.4.0,
171− case-insensitive,
172− containers,
173− criterion >= 1.0,
174− deepseq >= 1.1,
175− directory,
176− filepath,
177− ghc-prim,
178− http-types,
179− parsec >= 3.1.2,
180− scientific,
181− text >= 1.1.1.0,
182− transformers >= 0.2 && (< 0.4 || >= 0.4.1.0) && < 0.6,
183− unordered-containers,
184− vector
185−
186− if !impl(ghc >= 8.0)
187− -- Data.Semigroup && Control.Monad.Fail are available in base-4.9+
188− build-depends: fail == 4.9.*,
189− semigroups >=0.16.1 && <0.19
190−
191−source-repository head
192− type: git
193− location: https://github.com/bos/attoparsec
194−
benchmarks/Aeson.hsdeleted−353
@@ -1,353 +0,0 @@
1−{-# LANGUAGE BangPatterns, CPP, OverloadedStrings #-}
2−{-# OPTIONS_GHC -fno-warn-unused-binds #-}
3−
4−module Aeson
5− (
6− aeson
7− , value'
8− ) where
9−
10−import Data.ByteString.Builder
11− (Builder, byteString, toLazyByteString, charUtf8, word8)
12−
13−#if !MIN_VERSION_base(4,8,0)
14−import Control.Applicative ((*>), (<$>), (<*), pure)
15−import Data.Monoid (mappend, mempty)
16−#endif
17−
18−import Common (pathTo)
19−import Control.Applicative (liftA2)
20−import Control.DeepSeq (NFData(..))
21−import Control.Monad (forM)
22−import Data.Attoparsec.ByteString.Char8 (Parser, char, endOfInput, scientific,
23− skipSpace, string)
24−import Data.Bits ((.|.), shiftL)
25−import Data.ByteString (ByteString)
26−import Data.Char (chr)
27−import Data.List (sort)
28−import Data.Scientific (Scientific)
29−import Data.Text (Text)
30−import Data.Text.Encoding (decodeUtf8')
31−import Data.Vector as Vector (Vector, foldl', fromList)
32−import Data.Word (Word8)
33−import System.Directory (getDirectoryContents)
34−import System.FilePath ((</>), dropExtension)
35−import qualified Data.Attoparsec.ByteString as A
36−import qualified Data.Attoparsec.Lazy as L
37−import qualified Data.Attoparsec.Zepto as Z
38−import qualified Data.ByteString as B
39−import qualified Data.ByteString.Lazy as L
40−import qualified Data.ByteString.Unsafe as B
41−import qualified Data.HashMap.Strict as H
42−import Criterion.Main
43−
44−#define BACKSLASH 92
45−#define CLOSE_CURLY 125
46−#define CLOSE_SQUARE 93
47−#define COMMA 44
48−#define DOUBLE_QUOTE 34
49−#define OPEN_CURLY 123
50−#define OPEN_SQUARE 91
51−#define C_0 48
52−#define C_9 57
53−#define C_A 65
54−#define C_F 70
55−#define C_a 97
56−#define C_f 102
57−#define C_n 110
58−#define C_t 116
59−
60−data Result a = Error String
61− | Success a
62− deriving (Eq, Show)
63−
64−
65−-- | A JSON \"object\" (key\/value map).
66−type Object = H.HashMap Text Value
67−
68−-- | A JSON \"array\" (sequence).
69−type Array = Vector Value
70−
71−-- | A JSON value represented as a Haskell value.
72−data Value = Object !Object
73− | Array !Array
74− | String !Text
75− | Number !Scientific
76− | Bool !Bool
77− | Null
78− deriving (Eq, Show)
79−
80−instance NFData Value where
81− rnf (Object o) = rnf o
82− rnf (Array a) = Vector.foldl' (\x y -> rnf y `seq` x) () a
83− rnf (String s) = rnf s
84− rnf (Number n) = rnf n
85− rnf (Bool b) = rnf b
86− rnf Null = ()
87−
88−-- | Parse a top-level JSON value. This must be either an object or
89−-- an array, per RFC 4627.
90−--
91−-- The conversion of a parsed value to a Haskell value is deferred
92−-- until the Haskell value is needed. This may improve performance if
93−-- only a subset of the results of conversions are needed, but at a
94−-- cost in thunk allocation.
95−json :: Parser Value
96−json = json_ object_ array_
97−
98−-- | Parse a top-level JSON value. This must be either an object or
99−-- an array, per RFC 4627.
100−--
101−-- This is a strict version of 'json' which avoids building up thunks
102−-- during parsing; it performs all conversions immediately. Prefer
103−-- this version if most of the JSON data needs to be accessed.
104−json' :: Parser Value
105−json' = json_ object_' array_'
106−
107−json_ :: Parser Value -> Parser Value -> Parser Value
108−json_ obj ary = do
109− w <- skipSpace *> A.satisfy (\w -> w == OPEN_CURLY || w == OPEN_SQUARE)
110− if w == OPEN_CURLY
111− then obj
112− else ary
113−{-# INLINE json_ #-}
114−
115−object_ :: Parser Value
116−object_ = {-# SCC "object_" #-} Object <$> objectValues jstring value
117−
118−object_' :: Parser Value
119−object_' = {-# SCC "object_'" #-} do
120− !vals <- objectValues jstring' value'
121− return (Object vals)
122− where
123− jstring' = do
124− !s <- jstring
125− return s
126−
127−objectValues :: Parser Text -> Parser Value -> Parser (H.HashMap Text Value)
128−objectValues str val = do
129− skipSpace
130− let pair = liftA2 (,) (str <* skipSpace) (char ':' *> skipSpace *> val)
131− H.fromList <$> commaSeparated pair CLOSE_CURLY
132−{-# INLINE objectValues #-}
133−
134−array_ :: Parser Value
135−array_ = {-# SCC "array_" #-} Array <$> arrayValues value
136−
137−array_' :: Parser Value
138−array_' = {-# SCC "array_'" #-} do
139− !vals <- arrayValues value'
140− return (Array vals)
141−
142−commaSeparated :: Parser a -> Word8 -> Parser [a]
143−commaSeparated item endByte = do
144− w <- A.peekWord8'
145− if w == endByte
146− then A.anyWord8 >> return []
147− else loop
148− where
149− loop = do
150− v <- item <* skipSpace
151− ch <- A.satisfy $ \w -> w == COMMA || w == endByte
152− if ch == COMMA
153− then skipSpace >> (v:) <$> loop
154− else return [v]
155−{-# INLINE commaSeparated #-}
156−
157−arrayValues :: Parser Value -> Parser (Vector Value)
158−arrayValues val = do
159− skipSpace
160− Vector.fromList <$> commaSeparated val CLOSE_SQUARE
161−{-# INLINE arrayValues #-}
162−
163−-- | Parse any JSON value. You should usually 'json' in preference to
164−-- this function, as this function relaxes the object-or-array
165−-- requirement of RFC 4627.
166−--
167−-- In particular, be careful in using this function if you think your
168−-- code might interoperate with Javascript. A na&#xef;ve Javascript
169−-- library that parses JSON data using @eval@ is vulnerable to attack
170−-- unless the encoded data represents an object or an array. JSON
171−-- implementations in other languages conform to that same restriction
172−-- to preserve interoperability and security.
173−value :: Parser Value
174−value = do
175− w <- A.peekWord8'
176− case w of
177− DOUBLE_QUOTE -> A.anyWord8 *> (String <$> jstring_)
178− OPEN_CURLY -> A.anyWord8 *> object_
179− OPEN_SQUARE -> A.anyWord8 *> array_
180− C_f -> string "false" *> pure (Bool False)
181− C_t -> string "true" *> pure (Bool True)
182− C_n -> string "null" *> pure Null
183− _ | w >= 48 && w <= 57 || w == 45
184− -> Number <$> scientific
185− | otherwise -> fail "not a valid json value"
186−
187−-- | Strict version of 'value'. See also 'json''.
188−value' :: Parser Value
189−value' = do
190− w <- A.peekWord8'
191− case w of
192− DOUBLE_QUOTE -> do
193− !s <- A.anyWord8 *> jstring_
194− return (String s)
195− OPEN_CURLY -> A.anyWord8 *> object_'
196− OPEN_SQUARE -> A.anyWord8 *> array_'
197− C_f -> string "false" *> pure (Bool False)
198− C_t -> string "true" *> pure (Bool True)
199− C_n -> string "null" *> pure Null
200− _ | w >= 48 && w <= 57 || w == 45
201− -> do
202− !n <- scientific
203− return (Number n)
204− | otherwise -> fail "not a valid json value"
205−
206−-- | Parse a quoted JSON string.
207−jstring :: Parser Text
208−jstring = A.word8 DOUBLE_QUOTE *> jstring_
209−
210−-- | Parse a string without a leading quote.
211−jstring_ :: Parser Text
212−jstring_ = {-# SCC "jstring_" #-} do
213− s <- A.scan False $ \s c -> if s then Just False
214− else if c == DOUBLE_QUOTE
215− then Nothing
216− else Just (c == BACKSLASH)
217− _ <- A.word8 DOUBLE_QUOTE
218− s1 <- if BACKSLASH `B.elem` s
219− then case Z.parse unescape s of
220− Right r -> return r
221− Left err -> fail err
222− else return s
223−
224− case decodeUtf8' s1 of
225− Right r -> return r
226− Left err -> fail $ show err
227−
228−{-# INLINE jstring_ #-}
229−
230−unescape :: Z.Parser ByteString
231−unescape = toByteString <$> go mempty where
232− go acc = do
233− h <- Z.takeWhile (/=BACKSLASH)
234− let rest = do
235− start <- Z.take 2
236− let !slash = B.unsafeHead start
237− !t = B.unsafeIndex start 1
238− escape = case B.findIndex (==t) "\"\\/ntbrfu" of
239− Just i -> i
240− _ -> 255
241− if slash /= BACKSLASH || escape == 255
242− then fail "invalid JSON escape sequence"
243− else do
244− let cont m = go (acc `mappend` byteString h `mappend` m)
245− {-# INLINE cont #-}
246− if t /= 117 -- 'u'
247− then cont (word8 (B.unsafeIndex mapping escape))
248− else do
249− a <- hexQuad
250− if a < 0xd800 || a > 0xdfff
251− then cont (charUtf8 (chr a))
252− else do
253− b <- Z.string "\\u" *> hexQuad
254− if a <= 0xdbff && b >= 0xdc00 && b <= 0xdfff
255− then let !c = ((a - 0xd800) `shiftL` 10) +
256− (b - 0xdc00) + 0x10000
257− in cont (charUtf8 (chr c))
258− else fail "invalid UTF-16 surrogates"
259− done <- Z.atEnd
260− if done
261− then return (acc `mappend` byteString h)
262− else rest
263− mapping = "\"\\/\n\t\b\r\f"
264−
265−hexQuad :: Z.Parser Int
266−hexQuad = do
267− s <- Z.take 4
268− let hex n | w >= C_0 && w <= C_9 = w - C_0
269− | w >= C_a && w <= C_f = w - 87
270− | w >= C_A && w <= C_F = w - 55
271− | otherwise = 255
272− where w = fromIntegral $ B.unsafeIndex s n
273− a = hex 0; b = hex 1; c = hex 2; d = hex 3
274− if (a .|. b .|. c .|. d) /= 255
275− then return $! d .|. (c `shiftL` 4) .|. (b `shiftL` 8) .|. (a `shiftL` 12)
276− else fail "invalid hex escape"
277−
278−decodeWith :: Parser Value -> (Value -> Result a) -> L.ByteString -> Maybe a
279−decodeWith p to s =
280− case L.parse p s of
281− L.Done _ v -> case to v of
282− Success a -> Just a
283− _ -> Nothing
284− _ -> Nothing
285−{-# INLINE decodeWith #-}
286−
287−decodeStrictWith :: Parser Value -> (Value -> Result a) -> B.ByteString
288− -> Maybe a
289−decodeStrictWith p to s =
290− case either Error to (A.parseOnly p s) of
291− Success a -> Just a
292− Error _ -> Nothing
293−{-# INLINE decodeStrictWith #-}
294−
295−eitherDecodeWith :: Parser Value -> (Value -> Result a) -> L.ByteString
296− -> Either String a
297−eitherDecodeWith p to s =
298− case L.parse p s of
299− L.Done _ v -> case to v of
300− Success a -> Right a
301− Error msg -> Left msg
302− L.Fail _ _ msg -> Left msg
303−{-# INLINE eitherDecodeWith #-}
304−
305−eitherDecodeStrictWith :: Parser Value -> (Value -> Result a) -> B.ByteString
306− -> Either String a
307−eitherDecodeStrictWith p to s =
308− case either Error to (A.parseOnly p s) of
309− Success a -> Right a
310− Error msg -> Left msg
311−{-# INLINE eitherDecodeStrictWith #-}
312−
313−-- $lazy
314−--
315−-- The 'json' and 'value' parsers decouple identification from
316−-- conversion. Identification occurs immediately (so that an invalid
317−-- JSON document can be rejected as early as possible), but conversion
318−-- to a Haskell value is deferred until that value is needed.
319−--
320−-- This decoupling can be time-efficient if only a smallish subset of
321−-- elements in a JSON value need to be inspected, since the cost of
322−-- conversion is zero for uninspected elements. The trade off is an
323−-- increase in memory usage, due to allocation of thunks for values
324−-- that have not yet been converted.
325−
326−-- $strict
327−--
328−-- The 'json'' and 'value'' parsers combine identification with
329−-- conversion. They consume more CPU cycles up front, but have a
330−-- smaller memory footprint.
331−
332−-- | Parse a top-level JSON value followed by optional whitespace and
333−-- end-of-input. See also: 'json'.
334−jsonEOF :: Parser Value
335−jsonEOF = json <* skipSpace <* endOfInput
336−
337−-- | Parse a top-level JSON value followed by optional whitespace and
338−-- end-of-input. See also: 'json''.
339−jsonEOF' :: Parser Value
340−jsonEOF' = json' <* skipSpace <* endOfInput
341−
342−toByteString :: Builder -> ByteString
343−toByteString = L.toStrict . toLazyByteString
344−{-# INLINE toByteString #-}
345−
346−aeson :: IO Benchmark
347−aeson = do
348− path <- pathTo "json-data"
349− names <- sort . filter (`notElem` [".", ".."]) <$> getDirectoryContents path
350− benches <- forM names $ \name -> do
351− bs <- B.readFile (path </> name)
352− return . bench (dropExtension name) $ nf (A.parseOnly jsonEOF') bs
353− return $ bgroup "aeson" benches
benchmarks/Alternative.hsdeleted−20
@@ -1,20 +0,0 @@
1−{-# LANGUAGE OverloadedStrings #-}
2−
3−-- This benchmark reveals a huge performance regression that showed up
4−-- under GHC 7.8.1 (https://github.com/bos/attoparsec/issues/56).
5−--
6−-- With GHC 7.6.3 and older, this program runs in 0.04 seconds. Under
7−-- GHC 7.8.1 with (<|>) inlined, time jumps to 12 seconds!
8−
9−import Control.Applicative
10−import Data.Text (Text)
11−import qualified Data.Attoparsec.Text as A
12−import qualified Data.Text as T
13−
14−testParser :: Text -> Either String Int
15−testParser f = fmap length -- avoid printing out the entire matched list
16− . A.parseOnly (many ((() <$ A.string "b") <|> (() <$ A.anyChar)))
17− $ f
18−
19−main :: IO ()
20−main = print . testParser $ T.replicate 50000 "a"
benchmarks/Benchmarks.hsdeleted−126
@@ -1,126 +0,0 @@
1−{-# LANGUAGE BangPatterns, CPP #-}
2−
3−import Common ()
4−import Control.Applicative (many)
5−import Criterion.Main (bench, bgroup, defaultMain, nf)
6−import Data.Bits
7−import Data.Char (isAlpha)
8−import Data.Word (Word32)
9−import Data.Word (Word8)
10−import Numbers (numbers)
11−import Common (chunksOf)
12−import Text.Parsec.Text ()
13−import Text.Parsec.Text.Lazy ()
14−import qualified Warp
15−import qualified Aeson
16−import qualified Genome
17−import qualified Data.Attoparsec.ByteString as AB
18−import qualified Data.Attoparsec.ByteString.Char8 as AC
19−import qualified Data.Attoparsec.ByteString.Lazy as ABL
20−import qualified Data.Attoparsec.Text as AT
21−import qualified Data.Attoparsec.Text.Lazy as ATL
22−import qualified Data.ByteString as B
23−import qualified Data.ByteString.Char8 as BC
24−import qualified Data.ByteString.Lazy as BL
25−import qualified Data.Text as T
26−import qualified Data.Text.Lazy as TL
27−import qualified HeadersByteString
28−import qualified HeadersText
29−import qualified Links
30−import qualified Text.Parsec as P
31−import qualified Sets
32−
33−main :: IO ()
34−main = do
35− let s = take 1024 . cycle $ ['a'..'z'] ++ ['A'..'Z']
36− !b = BC.pack s
37− !bl = BL.fromChunks . map BC.pack . chunksOf 4 $ s
38− !t = T.pack s
39− !tl = TL.fromChunks . map T.pack . chunksOf 4 $ s
40− aeson <- Aeson.aeson
41− headersBS <- HeadersByteString.headers
42− headersT <- HeadersText.headers
43− defaultMain [
44− bgroup "many" [
45− bgroup "attoparsec" [
46− bench "B" $ nf (AB.parse (many (AC.satisfy AC.isAlpha_ascii))) b
47− , bench "BL" $ nf (ABL.parse (many (AC.satisfy AC.isAlpha_ascii))) bl
48− , bench "T" $ nf (AT.parse (many (AT.satisfy AC.isAlpha_ascii))) t
49− , bench "TL" $ nf (ATL.parse (many (AT.satisfy AC.isAlpha_ascii))) tl
50− ]
51− , bgroup "parsec" [
52− bench "S" $ nf (P.parse (many (P.satisfy AC.isAlpha_ascii)) "") s
53− , bench "B" $ nf (P.parse (many (P.satisfy AC.isAlpha_ascii)) "") b
54− , bench "BL" $ nf (P.parse (many (P.satisfy AC.isAlpha_ascii)) "") bl
55− , bench "T" $ nf (P.parse (many (P.satisfy AC.isAlpha_ascii)) "") t
56− , bench "TL" $ nf (P.parse (many (P.satisfy AC.isAlpha_ascii)) "") tl
57− ]
58− ]
59− , bgroup "comparison" [
60− bgroup "many-vs-takeWhile" [
61− bench "many" $ nf (AB.parse (many (AC.satisfy AC.isAlpha_ascii))) b
62− , bench "takeWhile" $ nf (AB.parse (AC.takeWhile AC.isAlpha_ascii)) b
63− ]
64− , bgroup "letter-vs-isAlpha" [
65− bench "letter" $ nf (AB.parse (many AC.letter_ascii)) b
66− , bench "isAlpha" $ nf (AB.parse (many (AC.satisfy AC.isAlpha_ascii))) b
67− ]
68− ]
69− , bgroup "takeWhile" [
70− bench "isAlpha" $ nf (ABL.parse (AC.takeWhile isAlpha)) bl
71− , bench "isAlpha_ascii" $ nf (ABL.parse (AC.takeWhile AC.isAlpha_ascii)) bl
72− , bench "isAlpha_iso8859_15" $
73− nf (ABL.parse (AC.takeWhile AC.isAlpha_iso8859_15)) bl
74− , bench "T isAlpha" $ nf (AT.parse (AT.takeWhile isAlpha)) t
75− , bench "TL isAlpha" $ nf (ATL.parse (AT.takeWhile isAlpha)) tl
76− ]
77− , bgroup "takeWhile1" [
78− bench "isAlpha" $ nf (ABL.parse (AC.takeWhile1 isAlpha)) bl
79− , bench "isAlpha_ascii" $ nf (ABL.parse (AC.takeWhile1 AC.isAlpha_ascii)) bl
80− , bench "T isAlpha" $ nf (AT.parse (AT.takeWhile1 isAlpha)) t
81− , bench "TL isAlpha" $ nf (ATL.parse (AT.takeWhile1 isAlpha)) tl
82− ]
83− , bench "word32LE" $ nf (AB.parse word32LE) b
84− , bgroup "scan" [
85− bench "short" $ nf (AB.parse quotedString) (BC.pack "abcdefghijk\"")
86− , bench "long" $ nf (AB.parse quotedString) b
87− ]
88− , aeson
89− , Genome.genome
90− , headersBS
91− , headersT
92− , Links.links
93− , numbers
94− , Sets.benchmarks
95− , Warp.benchmarks
96− ]
97−
98−-- Benchmarks bind and (potential) bounds-check merging.
99−word32LE :: AB.Parser Word32
100−word32LE = do
101− w1 <- AB.anyWord8
102− w2 <- AB.anyWord8
103− w3 <- AB.anyWord8
104− w4 <- AB.anyWord8
105− return $! (fromIntegral w1 :: Word32) +
106− fromIntegral w2 `unsafeShiftL` 8 +
107− fromIntegral w3 `unsafeShiftL` 16 +
108− fromIntegral w4 `unsafeShiftL` 32
109−
110−doubleQuote, backslash :: Word8
111−doubleQuote = 34
112−backslash = 92
113−{-# INLINE backslash #-}
114−{-# INLINE doubleQuote #-}
115−
116−-- | Parse a string without a leading quote.
117−quotedString :: AB.Parser B.ByteString
118−quotedString = AB.scan False $ \s c -> if s then Just False
119− else if c == doubleQuote
120− then Nothing
121− else Just (c == backslash)
122−
123−#if !MIN_VERSION_base(4,5,0)
124−unsafeShiftL :: Bits a => a -> Int -> a
125−unsafeShiftL = shiftL
126−#endif
benchmarks/Common.hsdeleted−47
@@ -1,47 +0,0 @@
1−{-# LANGUAGE CPP #-}
2−{-# OPTIONS_GHC -fno-warn-orphans #-}
3−
4−module Common (
5− chunksOf
6− , pathTo
7− , rechunkBS
8− , rechunkT
9− ) where
10−
11−import Control.DeepSeq (NFData(rnf))
12−import System.Directory (doesDirectoryExist)
13−import System.FilePath ((</>))
14−import Text.Parsec (ParseError)
15−import qualified Data.ByteString as B
16−import qualified Data.ByteString.Lazy as BL
17−import qualified Data.Text as T
18−import qualified Data.Text.Lazy as TL
19−
20−#if !MIN_VERSION_bytestring(0,10,0)
21−import Data.ByteString.Internal (ByteString(..))
22−
23−instance NFData ByteString where
24− rnf (PS _ _ _) = ()
25−#endif
26−
27−instance NFData ParseError where
28− rnf = rnf . show
29−
30−chunksOf :: Int -> [a] -> [[a]]
31−chunksOf k = go
32− where go xs = case splitAt k xs of
33− ([],_) -> []
34− (y, ys) -> y : go ys
35−
36−rechunkBS :: Int -> B.ByteString -> BL.ByteString
37−rechunkBS n = BL.fromChunks . map B.pack . chunksOf n . B.unpack
38−
39−rechunkT :: Int -> T.Text -> TL.Text
40−rechunkT n = TL.fromChunks . map T.pack . chunksOf n . T.unpack
41−
42−pathTo :: String -> IO FilePath
43−pathTo wat = do
44− exists <- doesDirectoryExist "benchmarks"
45− return $ if exists
46− then "benchmarks" </> wat
47− else wat
benchmarks/Genome.hsdeleted−75
@@ -1,75 +0,0 @@
1−{-# LANGUAGE OverloadedStrings #-}
2−
3−module Genome
4− (
5− genome
6− ) where
7−
8−import Control.Applicative
9−import Criterion.Main
10−import Data.ByteString (ByteString)
11−import qualified Data.ByteString.Char8 as B8
12−import qualified Data.ByteString.Lazy.Char8 as L8
13−import Data.Attoparsec.ByteString.Char8 as B
14−import qualified Data.Attoparsec.ByteString.Lazy as BL
15−import Data.Text (Text)
16−import qualified Data.Text as T
17−import qualified Data.Text.Lazy as TL
18−import Data.Attoparsec.Text as T
19−import qualified Data.Attoparsec.Text.Lazy as TL
20−import Common (rechunkBS, rechunkT)
21−
22−genome :: Benchmark
23−genome = bgroup "genome" [
24− bgroup "bytestring" [
25− bench "s" $ nf (map (B.parse searchBS)) (B8.tails geneB)
26− , bench "l" $ nf (map (BL.parse searchBS)) (L8.tails geneBL)
27− , bgroup "CI" [
28− bench "s" $ nf (map (B.parse searchBSCI)) (B8.tails geneB)
29− , bench "l" $ nf (map (BL.parse searchBSCI)) (L8.tails geneBL)
30− ]
31− ]
32− , bgroup "text" [
33− bench "s" $ nf (map (T.parse searchT)) (T.tails geneT)
34− , bench "l" $ nf (map (TL.parse searchT)) (TL.tails geneTL)
35− , bgroup "CI" [
36− bench "s" $ nf (map (T.parse searchTCI)) (T.tails geneT)
37− , bench "l" $ nf (map (TL.parse searchTCI)) (TL.tails geneTL)
38− ]
39− ]
40− ]
41− where geneB = B8.pack gene
42− geneBL = rechunkBS 4 geneB
43− geneT = T.pack gene
44− geneTL = rechunkT 4 geneT
45−
46−searchBS :: B.Parser ByteString
47−searchBS = "caac" *> ("aaca" <|> "aact")
48−
49−searchBSCI :: B.Parser ByteString
50−searchBSCI = B.stringCI "CAAC" *> (B.stringCI "AACA" <|> B.stringCI "AACT")
51−
52−searchT :: T.Parser Text
53−searchT = "caac" *> ("aaca" <|> "aact")
54−
55−searchTCI :: T.Parser Text
56−searchTCI = T.asciiCI "CAAC" *> (T.asciiCI "AACA" <|> T.asciiCI "AACT")
57−
58−-- Dictyostelium discoideum developmental protein DG1094 (gacT) gene,
59−-- partial cds. http://www.ncbi.nlm.nih.gov/nuccore/AF081586.1
60−
61−gene :: String
62−gene = "atcgatttagaaagatacaaagatagaaccatcaataataaacaagagaagagagcaagt\
63− \agagatattaataaagagattgaaagagagattgaaaagaagagattatcaccaagagaa\
64− \agattaaatttatttggtctttcttcctcatcttcatcagtgaattcaacattaacaaga\
65− \tctacagcaaatattatctctacaatagacggtagtggaggtagtaatcgtaatagtaaa\
66− \aattatggtaatggctcatcctcctcctcaaatagaagatatagtaatactattaatcaa\
67− \caattacaaatgcaattacaacaacttcaaatccaacaacaacaatatcaacaaactcaa\
68− \caatctcaaataccattacaatatcaacaacaacaacagcaacaacaacaacaaaccact\
69− \acaactacaactacatcaagtggtagtaatagattctcttcaaatagatataaaccagtt\
70− \gatcttacacaatcatcttcaaactttcgttattcacgtgaaatttatgatgatgattat\
71− \tattcaaataataatttaatgatgtttggtaatgagcaaccaaatcaaacaccaatttct\
72− \gtatcatcttcatctgcattcacacgtcaaagatctcaaagttgctttgaaccagagaat\
73− \cttgtattgctacaacaacaatatcaacaatatcaacaacaacaacaacaacaacaacaa\
74− \attccattccaagcaaatccacaatatagtaatgctgttattgaacaaaaattggatcaa\
75− \attagagataccattaataatttacatagagataaccgagtctctaga"
benchmarks/HeadersByteString.hsdeleted−37
@@ -1,37 +0,0 @@
1−module HeadersByteString (headers) where
2−
3−import Common (pathTo, rechunkBS)
4−import Criterion.Main (bench, bgroup, nf, nfIO)
5−import Criterion.Types (Benchmark)
6−import HeadersByteString.Atto (request, response)
7−import Network.Wai.Handler.Warp.RequestHeader (parseHeaderLines)
8−import qualified Data.Attoparsec.ByteString.Char8 as B
9−import qualified Data.Attoparsec.ByteString.Lazy as BL
10−import qualified Data.ByteString.Char8 as B
11−
12−-- Note: In the benchmarks for parsing an http request
13−-- from a strict bytestring, we consider warp's implementation,
14−-- which has highly optimized code for handling the first
15−-- line in particular. It's treatment of the headers
16−-- is more relaxed from the treatment they are given by the
17−-- attoparsec parser benchmarked here. Consequently, it
18−-- is should not be possible to match its performance since
19−-- it accepts header names with disallowed characters.
20−
21−headers :: IO Benchmark
22−headers = do
23− req <- B.readFile =<< pathTo "http-request.txt"
24− resp <- B.readFile =<< pathTo "http-response.txt"
25− let reql = rechunkBS 4 req
26− respl = rechunkBS 4 resp
27− return $ bgroup "headers" [
28− bgroup "B" [
29− bench "request" $ nf (B.parseOnly request) req
30− , bench "warp" $ nfIO (parseHeaderLines (B.split '\n' req))
31− , bench "response" $ nf (B.parseOnly response) resp
32− ]
33− , bgroup "BL" [
34− bench "request" $ nf (BL.parse request) reql
35− , bench "response" $ nf (BL.parse response) respl
36− ]
37− ]
benchmarks/HeadersByteString/Atto.hsdeleted−57
@@ -1,57 +0,0 @@
1−{-# LANGUAGE BangPatterns, OverloadedStrings #-}
2−{-# OPTIONS_GHC -fno-warn-missing-signatures -fno-warn-orphans #-}
3−module HeadersByteString.Atto
4− (
5− request
6− , response
7− ) where
8−
9−import Control.Applicative
10−import Control.DeepSeq (NFData(..))
11−import Network.HTTP.Types.Version (HttpVersion, http11)
12−import qualified Data.Attoparsec.ByteString.Char8 as B
13−import qualified Data.ByteString.Char8 as B
14−
15−instance NFData HttpVersion where
16− rnf !_ = ()
17−
18−isHeaderChar :: Char -> Bool
19−isHeaderChar c =
20− (c >= 'a' && c <= 'z') ||
21− (c >= 'A' && c <= 'Z') ||
22− (c >= '0' && c <= '9') ||
23− (c == '_') ||
24− (c == '-')
25−
26−header = do
27− name <- B.takeWhile1 isHeaderChar <* B.char ':' <* B.skipSpace
28− body <- bodyLine
29− return (name, body)
30−
31−bodyLine = B.takeTill (\c -> c == '\r' || c == '\n') <* B.endOfLine
32−
33−requestLine = do
34− m <- (B.takeTill B.isSpace <* B.char ' ')
35− (p,q) <- B.break (=='?') <$> (B.takeTill B.isSpace <* B.char ' ')
36− v <- httpVersion
37− return (m,p,q,v)
38−
39−httpVersion = http11 <$ "HTTP/1.1"
40−
41−responseLine = (,,) <$>
42− (httpVersion <* B.skipSpace) <*>
43− (int <* B.skipSpace) <*>
44− bodyLine
45−
46−int :: B.Parser Int
47−int = B.decimal
48−
49−request = (,) <$> (requestLine <* B.endOfLine) <*> manyheader
50−
51−response = (,) <$> responseLine <*> many header
52−
53−manyheader = do
54− c <- B.peekChar'
55− if c == '\r' || c == '\n'
56− then return []
57− else (:) <$> header <*> manyheader
benchmarks/HeadersText.hsdeleted−57
@@ -1,57 +0,0 @@
1−{-# LANGUAGE OverloadedStrings #-}
2−{-# OPTIONS_GHC -fno-warn-missing-signatures #-}
3−module HeadersText (headers) where
4−
5−import Common (pathTo, rechunkT)
6−import Control.Applicative
7−import Criterion.Main (bench, bgroup, nf)
8−import Criterion.Types (Benchmark)
9−import Data.Char (isSpace)
10−import qualified Data.Attoparsec.Text as T
11−import qualified Data.Attoparsec.Text.Lazy as TL
12−import qualified Data.Text.IO as T
13−
14−header = do
15− name <- T.takeWhile1 (T.inClass "a-zA-Z0-9_-") <* T.char ':' <* T.skipSpace
16− body <- (:) <$> bodyLine <*> many (T.takeWhile1 isSpace *> bodyLine)
17− return (name, body)
18−
19−bodyLine = T.takeTill (\c -> c == '\r' || c == '\n') <* T.endOfLine
20−
21−requestLine =
22− (,,) <$>
23− (method <* T.skipSpace) <*>
24− (T.takeTill isSpace <* T.skipSpace) <*>
25− httpVersion
26− where method = "GET" <|> "POST"
27−
28−httpVersion = "HTTP/" *> ((,) <$> (int <* T.char '.') <*> int)
29−
30−responseLine = (,,) <$>
31− (httpVersion <* T.skipSpace) <*>
32− (int <* T.skipSpace) <*>
33− bodyLine
34−
35−int :: T.Parser Int
36−int = T.decimal
37−
38−request = (,) <$> (requestLine <* T.endOfLine) <*> many header
39−
40−response = (,) <$> responseLine <*> many header
41−
42−headers :: IO Benchmark
43−headers = do
44− req <- T.readFile =<< pathTo "http-request.txt"
45− resp <- T.readFile =<< pathTo "http-response.txt"
46− let reql = rechunkT 4 req
47− respl = rechunkT 4 resp
48− return $ bgroup "headers" [
49− bgroup "T" [
50− bench "request" $ nf (T.parseOnly request) req
51− , bench "response" $ nf (T.parseOnly response) resp
52− ]
53− , bgroup "TL" [
54− bench "request" $ nf (TL.parse request) reql
55− , bench "response" $ nf (TL.parse response) respl
56− ]
57− ]
benchmarks/IsSpace.hsdeleted−123
@@ -1,123 +0,0 @@
1−{-# OPTIONS_GHC -Wall -fwarn-tabs #-}
2−{-# LANGUAGE ForeignFunctionInterface #-}
3−----------------------------------------------------------------
4−-- 2010.10.09
5−-- |
6−-- Module : IsSpace
7−-- Copyright : Copyright (c) 2010 wren ng thornton
8−-- License : BSD
9−-- Maintainer : wren@community.haskell.org
10−-- Stability : experimental
11−-- Portability : portable (FFI)
12−--
13−-- A benchmark for comparing different definitions of predicates
14−-- for detecting whitespace. As of the last run the results are:
15−--
16−-- * Data.Char.isSpace : 14.44786 us +/- 258.0377 ns
17−-- * isSpace_DataChar : 43.25154 us +/- 655.7037 ns
18−-- * isSpace_Char : 29.26598 us +/- 454.1445 ns
19−-- * isPerlSpace :
20−-- * Data.Attoparsec.Char8.isSpace : 81.87335 us +/- 1.195903 us
21−-- * isSpace_Char8 : 11.84677 us +/- 178.9795 ns
22−-- * isSpace_w8 : 11.55470 us +/- 133.7644 ns
23−----------------------------------------------------------------
24−module IsSpace (main) where
25−
26−import qualified Data.Char as C
27−import Data.Word (Word8)
28−import qualified Data.ByteString as B
29−import qualified Data.ByteString.Char8 as B8
30−import Foreign.C.Types (CInt)
31−
32−import Criterion (bench, nf)
33−import Criterion.Main (defaultMain)
34−
35−----------------------------------------------------------------
36−----- Character predicates
37−-- N.B. \x9..\xD == "\t\n\v\f\r"
38−
39−-- | Recognize the same characters as Perl's @/\s/@ in Unicode mode.
40−-- In particular, we recognize POSIX 1003.2 @[[:space:]]@ except
41−-- @\'\v\'@, and recognize the Unicode @\'\x85\'@, @\'\x2028\'@,
42−-- @\'\x2029\'@. Notably, @\'\x85\'@ belongs to Latin-1 (but not
43−-- ASCII) and therefore does not belong to POSIX 1003.2 @[[:space:]]@
44−-- (nor non-Unicode @/\s/@).
45−isPerlSpace :: Char -> Bool
46−isPerlSpace c
47− = (' ' == c)
48− || ('\t' <= c && c <= '\r' && c /= '\v')
49− || ('\x85' == c)
50− || ('\x2028' == c)
51− || ('\x2029' == c)
52−{-# INLINE isPerlSpace #-}
53−
54−
55−-- | 'Data.Attoparsec.Char8.isSpace', duplicated here because it's
56−-- not exported. This is the definition as of attoparsec-0.8.1.0.
57−isSpace :: Char -> Bool
58−isSpace c = c `B8.elem` spaces
59− where
60− spaces = B8.pack " \n\r\t\v\f"
61− {-# NOINLINE spaces #-}
62−{-# INLINE isSpace #-}
63−
64−
65−-- | An alternate version of 'Data.Attoparsec.Char8.isSpace'.
66−isSpace_Char8 :: Char -> Bool
67−isSpace_Char8 c = (' ' == c) || ('\t' <= c && c <= '\r')
68−{-# INLINE isSpace_Char8 #-}
69−
70−
71−-- | An alternate version of 'Data.Char.isSpace'. This uses the
72−-- same trick as 'isSpace_Char8' but we include Unicode whitespaces
73−-- too, in order to have the same results as 'Data.Char.isSpace'
74−-- (whereas 'isSpace_Char8' doesn't recognize Unicode whitespace).
75−isSpace_Char :: Char -> Bool
76−isSpace_Char c
77− = (' ' == c)
78− || ('\t' <= c && c <= '\r')
79− || ('\xA0' == c)
80− || (iswspace (fromIntegral (C.ord c)) /= 0)
81−{-# INLINE isSpace_Char #-}
82−
83−foreign import ccall unsafe "u_iswspace"
84− iswspace :: CInt -> CInt
85−
86−-- | Verbatim version of 'Data.Char.isSpace' (i.e., 'GHC.Unicode.isSpace'
87−-- as of base-4.2.0.2) in order to try to figure out why 'isSpace_Char'
88−-- is slower than 'Data.Char.isSpace'. It appears to be something
89−-- special in how the base library was compiled.
90−isSpace_DataChar :: Char -> Bool
91−isSpace_DataChar c =
92− c == ' ' ||
93− c == '\t' ||
94− c == '\n' ||
95− c == '\r' ||
96− c == '\f' ||
97− c == '\v' ||
98− c == '\xa0' ||
99− iswspace (fromIntegral (C.ord c)) /= 0
100−{-# INLINE isSpace_DataChar #-}
101−
102−
103−-- | A 'Word8' version of 'Data.Attoparsec.Char8.isSpace'.
104−isSpace_w8 :: Word8 -> Bool
105−isSpace_w8 w = (w == 32) || (9 <= w && w <= 13)
106−{-# INLINE isSpace_w8 #-}
107−
108−----------------------------------------------------------------
109−
110−main :: IO ()
111−main = defaultMain
112− [ bench "Data.Char.isSpace" $ nf (map C.isSpace) ['\x0'..'\255']
113− , bench "isSpace_DataChar" $ nf (map isSpace_DataChar) ['\x0'..'\255']
114− , bench "isSpace_Char" $ nf (map isSpace_Char) ['\x0'..'\255']
115− , bench "isPerlSpace" $ nf (map isPerlSpace) ['\x0'..'\255']
116− , bench "Data.Attoparsec.Char8.isSpace"
117− $ nf (map isSpace) ['\x0'..'\255']
118− , bench "isSpace_Char8" $ nf (map isSpace_Char8) ['\x0'..'\255']
119− , bench "isSpace_w8" $ nf (map isSpace_w8) [0..255]
120− ]
121−
122−----------------------------------------------------------------
123−----------------------------------------------------------- fin.
benchmarks/Links.hsdeleted−63
@@ -1,63 +0,0 @@
1−{-# LANGUAGE OverloadedStrings #-}
2−
3−module Links (links) where
4−
5−import Control.Applicative
6−import Control.DeepSeq (NFData(..))
7−import Criterion.Main (Benchmark, bench, nf)
8−import Data.Attoparsec.ByteString as A
9−import Data.Attoparsec.ByteString.Char8 as A8
10−import Data.ByteString.Char8 as B8
11−
12−data Link = Link {
13− linkURL :: ByteString
14− , linkParams :: [(ByteString, ByteString)]
15− } deriving (Eq, Show)
16−
17−instance NFData Link where
18− rnf l = rnf (linkURL l) `seq` rnf (linkParams l)
19−
20−link :: Parser Link
21−link = Link <$> url <*> many (char8 ';' *> skipSpace *> param)
22− where url = char8 '<' *> A8.takeTill (=='>') <* char8 '>' <* skipSpace
23−
24−param :: Parser (ByteString, ByteString)
25−param = do
26− name <- paramName
27− skipSpace *> "=" *> skipSpace
28− c <- peekChar'
29− let isTokenChar = A.inClass "!#$%&'()*+./0-9:<=>?@a-zA-Z[]^_`{|}~-"
30− val <- case c of
31− '"' -> quotedString
32− _ -> A.takeWhile isTokenChar
33− skipSpace
34− return (name, val)
35−
36−data Quot = Literal | Backslash
37−
38−quotedString :: Parser ByteString
39−quotedString = char '"' *> (fixup <$> body) <* char '"'
40− where body = A8.scan Literal $ \s c ->
41− case (s,c) of
42− (Literal, '\\') -> backslash
43− (Literal, '"') -> Nothing
44− _ -> literal
45− literal = Just Literal
46− backslash = Just Backslash
47− fixup = B8.pack . go . B8.unpack
48− where go ('\\' : x@'\\' : xs) = x : go xs
49− go ('\\' : x@'"' : xs) = x : go xs
50− go (x : xs) = x : go xs
51− go xs = xs
52−
53−paramName :: Parser ByteString
54−paramName = do
55− name <- A.takeWhile1 $ A.inClass "a-zA-Z0-9!#$&+-.^_`|~"
56− c <- peekChar
57− return $ case c of
58− Just '*' -> B8.snoc name '*'
59− _ -> name
60−
61−links :: Benchmark
62−links = bench "links" $ nf (A.parseOnly link) lnk
63− where lnk = "<https://api.github.com/search/code?q=addClass+user%3Amozilla&page=2>; rel=\"next\", <https://api.github.com/search/code?q=addClass+user%3Amozilla&page=34>; rel=\"last\""
benchmarks/Makefiledeleted−10
@@ -1,10 +0,0 @@
1−all: med.txt tiny
2−
3−tiny: Tiny.hs
4− ghc -O --make -o $@ $<
5−
6−%: %.bz2
7− bunzip2 -k $<
8−
9−clean:
10− -rm -f *.o *.hi tiny
benchmarks/Numbers.hsdeleted−82
@@ -1,82 +0,0 @@
1−{-# LANGUAGE BangPatterns #-}
2−{-# OPTIONS_GHC -fno-warn-deprecations #-}
3−
4−module Numbers (numbers) where
5−
6−import Criterion.Main (bench, bgroup, nf)
7−import Criterion.Types (Benchmark)
8−import Data.Scientific (Scientific(..))
9−import Text.Parsec.Text ()
10−import Text.Parsec.Text.Lazy ()
11−import qualified Data.Attoparsec.ByteString.Char8 as AC
12−import qualified Data.Attoparsec.Text as AT
13−import qualified Data.ByteString.Char8 as BC
14−import qualified Data.Text as T
15−
16−strN, strNePos, strNeNeg :: String
17−strN = "1234.56789"
18−strNePos = "1234.56789e3"
19−strNeNeg = "1234.56789e-3"
20−
21−numbers :: Benchmark
22−numbers = bgroup "numbers" [
23− let !tN = T.pack strN
24− !tNePos = T.pack strNePos
25− !tNeNeg = T.pack strNeNeg
26− in bgroup "Text"
27− [
28− bgroup "no power"
29− [ bench "double" $ nf (AT.parseOnly AT.double) tN
30− , bench "number" $ nf (AT.parseOnly AT.number) tN
31− , bench "rational" $
32− nf (AT.parseOnly (AT.rational :: AT.Parser Rational)) tN
33− , bench "scientific" $
34− nf (AT.parseOnly (AT.rational :: AT.Parser Scientific)) tN
35− ]
36− , bgroup "positive power"
37− [ bench "double" $ nf (AT.parseOnly AT.double) tNePos
38− , bench "number" $ nf (AT.parseOnly AT.number) tNePos
39− , bench "rational" $
40− nf (AT.parseOnly (AT.rational :: AT.Parser Rational)) tNePos
41− , bench "scientific" $
42− nf (AT.parseOnly (AT.rational :: AT.Parser Scientific)) tNePos
43− ]
44− , bgroup "negative power"
45− [ bench "double" $ nf (AT.parseOnly AT.double) tNeNeg
46− , bench "number" $ nf (AT.parseOnly AT.number) tNeNeg
47− , bench "rational" $
48− nf (AT.parseOnly (AT.rational :: AT.Parser Rational)) tNeNeg
49− , bench "scientific" $
50− nf (AT.parseOnly (AT.rational :: AT.Parser Scientific)) tNeNeg
51− ]
52− ]
53− , let !bN = BC.pack strN
54− !bNePos = BC.pack strNePos
55− !bNeNeg = BC.pack strNeNeg
56− in bgroup "ByteString"
57− [ bgroup "no power"
58− [ bench "double" $ nf (AC.parseOnly AC.double) bN
59− , bench "number" $ nf (AC.parseOnly AC.number) bN
60− , bench "rational" $
61− nf (AC.parseOnly (AC.rational :: AC.Parser Rational)) bN
62− , bench "scientific" $
63− nf (AC.parseOnly (AC.rational :: AC.Parser Scientific)) bN
64− ]
65− , bgroup "positive power"
66− [ bench "double" $ nf (AC.parseOnly AC.double) bNePos
67− , bench "number" $ nf (AC.parseOnly AC.number) bNePos
68− , bench "rational" $
69− nf (AC.parseOnly (AC.rational :: AC.Parser Rational)) bNePos
70− , bench "scientific" $
71− nf (AC.parseOnly (AC.rational :: AC.Parser Scientific)) bNePos
72− ]
73− , bgroup "negative power"
74− [ bench "double" $ nf (AC.parseOnly AC.double) bNeNeg
75− , bench "number" $ nf (AC.parseOnly AC.number) bNeNeg
76− , bench "rational" $
77− nf (AC.parseOnly (AC.rational :: AC.Parser Rational)) bNeNeg
78− , bench "scientific" $
79− nf (AC.parseOnly (AC.rational :: AC.Parser Scientific)) bNeNeg
80− ]
81− ]
82− ]
benchmarks/Sets.hsdeleted−21
@@ -1,21 +0,0 @@
1−module Sets (benchmarks) where
2−
3−import Criterion
4−import Data.Char (ord)
5−import qualified Data.Attoparsec.Text.FastSet as FastSet
6−import qualified TextFastSet
7−import qualified Data.HashSet as HashSet
8−import qualified Data.IntSet as IntSet
9−
10−smallSet :: String
11−smallSet = ['a'..'z'] ++ ['A'..'Z'] ++ ['0'..'9']
12−
13−benchmarks :: Benchmark
14−benchmarks = bgroup "sets" [
15− bench "Fast" $ whnf (FastSet.member '*') (FastSet.fromList smallSet)
16− , bench "Hash" $ whnf (HashSet.member '*') (HashSet.fromList smallSet)
17− , bench "Int" $ whnf (IntSet.member (ord '*'))
18− (IntSet.fromList (map ord smallSet))
19− , bench "TextFast" $ whnf (TextFastSet.member '*')
20− (TextFastSet.fromList smallSet)
21− ]
benchmarks/TextFastSet.hsdeleted−121
@@ -1,121 +0,0 @@
1−{-# LANGUAGE BangPatterns #-}
2−
3−------------------------------------------------------------------------------
4−-- |
5−-- Module : Data.Attoparsec.FastSet
6−-- Copyright : Felipe Lessa 2010, Bryan O'Sullivan 2007-2015
7−-- License : BSD3
8−--
9−-- Maintainer : felipe.lessa@gmail.com
10−-- Stability : experimental
11−-- Portability : unknown
12−--
13−-- Fast set membership tests for 'Char' values. We test for
14−-- membership using a hashtable implemented with Robin Hood
15−-- collision resolution. The set representation is unboxed,
16−-- and the characters and hashes interleaved, for efficiency.
17−--
18−--
19−-----------------------------------------------------------------------------
20−module TextFastSet
21− (
22− -- * Data type
23− FastSet
24− -- * Construction
25− , fromList
26− , set
27− -- * Lookup
28− , member
29− -- * Handy interface
30− , charClass
31− ) where
32−
33−import Data.Bits ((.|.), (.&.), shiftR)
34−import Data.Function (on)
35−import Data.List (sort, sortBy)
36−import qualified Data.Array.Base as AB
37−import qualified Data.Array.Unboxed as A
38−import qualified Data.Text as T
39−
40−data FastSet = FastSet {
41− table :: {-# UNPACK #-} !(A.UArray Int Int)
42− , mask :: {-# UNPACK #-} !Int
43− }
44−
45−data Entry = Entry {
46− key :: {-# UNPACK #-} !Char
47− , initialIndex :: {-# UNPACK #-} !Int
48− , index :: {-# UNPACK #-} !Int
49− }
50−
51−offset :: Entry -> Int
52−offset e = index e - initialIndex e
53−
54−resolveCollisions :: [Entry] -> [Entry]
55−resolveCollisions [] = []
56−resolveCollisions [e] = [e]
57−resolveCollisions (a:b:entries) = a' : resolveCollisions (b' : entries)
58− where (a', b')
59− | index a < index b = (a, b)
60− | offset a < offset b = (b { index=index a }, a { index=index a + 1 })
61− | otherwise = (a, b { index=index a + 1 })
62−
63−pad :: Int -> [Entry] -> [Entry]
64−pad = go 0
65− where -- ensure that we pad enough so that lookups beyond the
66− -- last hash in the table fall within the array
67− go !_ !m [] = replicate (max 1 m + 1) empty
68− go k m (e:entries) = map (const empty) [k..i - 1] ++ e :
69− go (i + 1) (m + i - k - 1) entries
70− where i = index e
71− empty = Entry '\0' maxBound 0
72−
73−nextPowerOf2 :: Int -> Int
74−nextPowerOf2 0 = 1
75−nextPowerOf2 x = go (x - 1) 1
76− where go y 32 = y + 1
77− go y k = go (y .|. (y `shiftR` k)) $ k * 2
78−
79−fastHash :: Char -> Int
80−fastHash = fromEnum
81−
82−fromList :: String -> FastSet
83−fromList s = FastSet (AB.listArray (0, length interleaved - 1) interleaved)
84− mask'
85− where s' = ordNub (sort s)
86− l = length s'
87− mask' = nextPowerOf2 ((5 * l) `div` 4) - 1
88− entries = pad mask' .
89− resolveCollisions .
90− sortBy (compare `on` initialIndex) .
91− zipWith (\c i -> Entry c i i) s' .
92− map ((.&. mask') . fastHash) $ s'
93− interleaved = concatMap (\e -> [fromEnum $ key e, initialIndex e])
94− entries
95−
96−ordNub :: Eq a => [a] -> [a]
97−ordNub [] = []
98−ordNub (y:ys) = go y ys
99− where go x (z:zs)
100− | x == z = go x zs
101− | otherwise = x : go z zs
102− go x [] = [x]
103−
104−set :: T.Text -> FastSet
105−set = fromList . T.unpack
106−
107−-- | Check the set for membership.
108−member :: Char -> FastSet -> Bool
109−member c a = go (2 * i)
110− where i = fastHash c .&. mask a
111− lookupAt j b = (i' <= i) && (c == c' || b)
112− where c' = toEnum $ AB.unsafeAt (table a) j
113− i' = AB.unsafeAt (table a) $ j + 1
114− go j = lookupAt j . lookupAt (j + 2) . lookupAt (j + 4) .
115− lookupAt (j + 6) . go $ j + 8
116−
117−charClass :: String -> FastSet
118−charClass = fromList . go
119− where go (a:'-':b:xs) = [a..b] ++ go xs
120− go (x:xs) = x : go xs
121− go _ = ""
benchmarks/Tiny.hsdeleted−31
@@ -1,31 +0,0 @@
1−import Control.Applicative ((<|>), many)
2−import Control.Monad (forM_)
3−import System.Environment (getArgs)
4−import qualified Data.Attoparsec.ByteString.Char8 as A
5−import qualified Data.ByteString.Char8 as B
6−import qualified Text.Parsec as P
7−import qualified Text.Parsec.ByteString as P
8−
9−attoparsec = do
10− args <- getArgs
11− forM_ args $ \arg -> do
12− input <- B.readFile arg
13− case A.parse p input `A.feed` B.empty of
14− A.Done _ xs -> print (length xs)
15− what -> print what
16− where
17− slow = many (A.many1 A.letter_ascii <|> A.many1 A.digit)
18− fast = many (A.takeWhile1 isLetter <|> A.takeWhile1 isDigit)
19− isDigit c = c >= '0' && c <= '9'
20− isLetter c = (c >= 'a' && c <= 'z') || (c >= 'A' && c <= 'Z')
21− p = fast
22−
23−parsec = do
24− args <- getArgs
25− forM_ args $ \arg -> do
26− input <- readFile arg
27− case P.parse (P.many (P.many1 P.letter P.<|> P.many1 P.digit)) "" input of
28− Left err -> print err
29− Right xs -> print (length xs)
30−
31−main = attoparsec
benchmarks/Warp.hsdeleted−17
@@ -1,17 +0,0 @@
1−{-# LANGUAGE OverloadedStrings #-}
2−
3−module Warp (benchmarks) where
4−
5−import Criterion.Main (bench, bgroup, nf)
6−import Criterion.Types (Benchmark)
7−import Data.ByteString (ByteString)
8−import Network.Wai.Handler.Warp.ReadInt (readInt)
9−import qualified Data.Attoparsec.ByteString.Char8 as B
10−
11−benchmarks :: Benchmark
12−benchmarks = bgroup "warp" [
13− bgroup "decimal" [
14− bench "warp" $ nf (readInt :: ByteString -> Int) "31337"
15− , bench "atto" $ nf (B.parse (B.decimal :: B.Parser Int)) "31337"
16− ]
17− ]
benchmarks/attoparsec-benchmarks.cabaldeleted−41
@@ -1,41 +0,0 @@
1−-- These benchmarks are not intended to be installed.
2−-- So don't install 'em.
3−
4−name: attoparsec-benchmarks
5−version: 0
6−cabal-version: >=1.6
7−build-type: Simple
8−
9−executable attoparsec-benchmarks
10− main-is: Benchmarks.hs
11− other-modules:
12− Common
13− HeadersByteString
14− HeadersByteString.Atto
15− HeadersText
16− Links
17− Numbers
18− Network.Wai.Handler.Warp.ReadInt
19− Sets
20− TextFastSet
21− Warp
22− hs-source-dirs: .. . warp-3.0.1.1
23− ghc-options: -O2 -Wall -rtsopts
24− build-depends:
25− array,
26− base == 4.*,
27− bytestring >= 0.10.4.0,
28− case-insensitive,
29− containers,
30− criterion >= 1.0,
31− deepseq >= 1.1,
32− directory,
33− filepath,
34− ghc-prim,
35− http-types,
36− parsec >= 3.1.2,
37− scientific >= 0.3.1,
38− text >= 1.1.1.0,
39− transformers,
40− unordered-containers,
41− vector
benchmarks/http-request.txtdeleted−9
@@ -1,9 +0,0 @@
1−GET / HTTP/1.1
2−Host: twitter.com
3−Accept: text/html, application/xhtml+xml, application/xml; q=0.9, image/webp, */*; q=0.8
4−Accept-Encoding: gzip,deflate,sdch
5−Accept-Language: en-GB,en-US;q=0.8,en;q=0.6
6−Cache-Control: max-age=0
7−Cookie: guest_id=v1%3A139; _twitter_sess=BAh7CSIKZmxhc2hJQz-e1e1; __utma=43838368.452555194.1399611824.1; __utmb=43838368; __utmc=43838368; __utmz=1399611824.1.1.utmcsr=(direct)|utmcmd=(none)
8−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10_8_5) AppleWebKit/537.36 (KHTML, like Gecko) Chrome/35.0.1916.86 Safari/537.36
9−
benchmarks/http-response.txtdeleted−14
@@ -1,14 +0,0 @@
1−HTTP/1.1 200 OK
2−Date: Fri, 09 May 2014 04:24:57 GMT
3−Expires: -1
4−Cache-Control: private, max-age=0
5−Content-Type: text/html; charset=ISO-8859-1
6−Set-Cookie: PREF=ID=1a871afc4240db5e:FF:LM=1399609497:S=e5MZ0itEekjVwNcU; expires=Sun, 08-May-2016 04:24:57 GMT; path=/; domain=.google.com
7−Set-Cookie: NID=67=-WlfaDG6VSEPk7abAjrK98HBSoCD2ID6JKkUR95tEumzDmg7Fc8pSQ8; expires=Sat, 08-Nov-2014 04:24:57 GMT; path=/; domain=.google.com; HttpOnly
8−P3P: CP="This is not a P3P policy! See http://www.google.com/support/accounts/bin/answer.py?hl=en&answer=151657 for more info."
9−Server: gws
10−X-XSS-Protection: 1; mode=block
11−X-Frame-Options: SAMEORIGIN
12−Alternate-Protocol: 80:quic
13−Transfer-Encoding: chunked
14−
benchmarks/json-data/example.jsondeleted−88
@@ -1,88 +0,0 @@
1−{"web-app": {
2− "servlet": [
3− {
4− "servlet-name": "cofaxCDS",
5− "servlet-class": "org.cofax.cds.CDSServlet",
6− "init-param": {
7− "configGlossary:installationAt": "Philadelphia, PA",
8− "configGlossary:adminEmail": "ksm@pobox.com",
9− "configGlossary:poweredBy": "Cofax",
10− "configGlossary:poweredByIcon": "/images/cofax.gif",
11− "configGlossary:staticPath": "/content/static",
12− "templateProcessorClass": "org.cofax.WysiwygTemplate",
13− "templateLoaderClass": "org.cofax.FilesTemplateLoader",
14− "templatePath": "templates",
15− "templateOverridePath": "",
16− "defaultListTemplate": "listTemplate.htm",
17− "defaultFileTemplate": "articleTemplate.htm",
18− "useJSP": false,
19− "jspListTemplate": "listTemplate.jsp",
20− "jspFileTemplate": "articleTemplate.jsp",
21− "cachePackageTagsTrack": 200,
22− "cachePackageTagsStore": 200,
23− "cachePackageTagsRefresh": 60,
24− "cacheTemplatesTrack": 100,
25− "cacheTemplatesStore": 50,
26− "cacheTemplatesRefresh": 15,
27− "cachePagesTrack": 200,
28− "cachePagesStore": 100,
29− "cachePagesRefresh": 10,
30− "cachePagesDirtyRead": 10,
31− "searchEngineListTemplate": "forSearchEnginesList.htm",
32− "searchEngineFileTemplate": "forSearchEngines.htm",
33− "searchEngineRobotsDb": "WEB-INF/robots.db",
34− "useDataStore": true,
35− "dataStoreClass": "org.cofax.SqlDataStore",
36− "redirectionClass": "org.cofax.SqlRedirection",
37− "dataStoreName": "cofax",
38− "dataStoreDriver": "com.microsoft.jdbc.sqlserver.SQLServerDriver",
39− "dataStoreUrl": "jdbc:microsoft:sqlserver://LOCALHOST:1433;DatabaseName=goon",
40− "dataStoreUser": "sa",
41− "dataStorePassword": "dataStoreTestQuery",
42− "dataStoreTestQuery": "SET NOCOUNT ON;select test='test';",
43− "dataStoreLogFile": "/usr/local/tomcat/logs/datastore.log",
44− "dataStoreInitConns": 10,
45− "dataStoreMaxConns": 100,
46− "dataStoreConnUsageLimit": 100,
47− "dataStoreLogLevel": "debug",
48− "maxUrlLength": 500}},
49− {
50− "servlet-name": "cofaxEmail",
51− "servlet-class": "org.cofax.cds.EmailServlet",
52− "init-param": {
53− "mailHost": "mail1",
54− "mailHostOverride": "mail2"}},
55− {
56− "servlet-name": "cofaxAdmin",
57− "servlet-class": "org.cofax.cds.AdminServlet"},
58−
59− {
60− "servlet-name": "fileServlet",
61− "servlet-class": "org.cofax.cds.FileServlet"},
62− {
63− "servlet-name": "cofaxTools",
64− "servlet-class": "org.cofax.cms.CofaxToolsServlet",
65− "init-param": {
66− "templatePath": "toolstemplates/",
67− "log": 1,
68− "logLocation": "/usr/local/tomcat/logs/CofaxTools.log",
69− "logMaxSize": "",
70− "dataLog": 1,
71− "dataLogLocation": "/usr/local/tomcat/logs/dataLog.log",
72− "dataLogMaxSize": "",
73− "removePageCache": "/content/admin/remove?cache=pages&id=",
74− "removeTemplateCache": "/content/admin/remove?cache=templates&id=",
75− "fileTransferFolder": "/usr/local/tomcat/webapps/content/fileTransferFolder",
76− "lookInContext": 1,
77− "adminGroupID": 4,
78− "betaServer": true}}],
79− "servlet-mapping": {
80− "cofaxCDS": "/",
81− "cofaxEmail": "/cofaxutil/aemail/*",
82− "cofaxAdmin": "/admin/*",
83− "fileServlet": "/static/*",
84− "cofaxTools": "/tools/*"},
85−
86− "taglib": {
87− "taglib-uri": "cofax.tld",
88− "taglib-location": "/WEB-INF/tlds/cofax.tld"}}}
benchmarks/json-data/geometry.jsondeleted−1
@@ -1 +0,0 @@
1−{"geometry": {"type": "Polygon", "coordinates": [[[-0.939359853061118, 51.57401065198471], [-0.939440892477492, 51.57431080772057], [-0.939543636564569, 51.57460846194951], [-0.939564627628489, 51.574822653966265], [-0.939763179055758, 51.575406210178826], [-0.939787182642249, 51.575552991614], [-0.939819571231525, 51.57564949527348], [-0.939851290904264, 51.57571272360808], [-0.939975682132949, 51.57588648747347], [-0.940036822193859, 51.57598774653439], [-0.940072640734852, 51.57606090267849], [-0.940109693338918, 51.576205104339515], [-0.940125502187331, 51.57645611534466], [-0.940118623499009, 51.57662779459441], [-0.94008851367835, 51.57680555827417], [-0.939998015208524, 51.57709787034017], [-0.939928028667517, 51.577252794653916], [-0.939830628174189, 51.57740747134858], [-0.939796941313687, 51.57749078985784], [-0.939785586773343, 51.57754463746666], [-0.939770656147318, 51.57769016804059], [-0.939658154074368, 51.57824573765943], [-0.939485738834128, 51.57883313597966], [-0.93945717030888, 51.579192545519916], [-0.939524336079755, 51.57928306919007], [-0.939540939284811, 51.57931379092206], [-0.939553921057406, 51.579748206813974], [-0.939549110634237, 51.57983088690364], [-0.939520940649101, 51.58004913048237], [-0.93951863934971, 51.58014801827346], [-0.939525037302583, 51.580245186310094], [-0.939540364690294, 51.58033074581249], [-0.939561798495469, 51.58040197377017], [-0.939594984852117, 51.58046431619436], [-0.939708262827559, 51.580619996404984], [-0.939729069878358, 51.58065615108302], [-0.939759224390201, 51.58072476025555], [-0.939813615319267, 51.58093026195459], [-0.939900523550716, 51.58172321441459], [-0.939894144544868, 51.581997403240464], [-0.939910832471369, 51.58208657162566], [-0.940114353648015, 51.582457967531546], [-0.94022333049887, 51.58267475179605], [-0.940267247821581, 51.58277225843995], [-0.94038427828014, 51.583077233742756], [-0.940493362377966, 51.583289522851196], [-0.940571515796737, 51.58340442254201], [-0.940725857371931, 51.58359464061899], [-0.941198340240742, 51.584069167875626], [-0.941335307610427, 51.584261925920295], [-0.941372786463165, 51.5843261048293], [-0.941416540699353, 51.58443080287741], [-0.941461326187118, 51.584739621364996], [-0.941517445876004, 51.5849954910945], [-0.941575869597484, 51.58533860085252], [-0.941574762730556, 51.58538624677686], [-0.941565185406358, 51.58542572382202], [-0.941550002863301, 51.58545795698674], [-0.941515976834126, 51.58549361692739], [-0.941470510606583, 51.585524677868065], [-0.941423872780384, 51.585544039043356], [-0.94131509921043, 51.585566436558274], [-0.941075026707647, 51.58558675057684], [-0.940953181611661, 51.58561262652464], [-0.940734943851404, 51.58568708689612], [-0.940229533088359, 51.585883040066975], [-0.940067635923264, 51.58595531027499], [-0.939917220191166, 51.58603038143916], [-0.939797255285709, 51.586099433232604], [-0.939675637701456, 51.586177461657186], [-0.939611074554604, 51.58622273608784], [-0.939340396866166, 51.586441486256], [-0.93912244296424, 51.58662744303347], [-0.938817233975319, 51.58671729893312], [-0.938661522913105, 51.586771639765516], [-0.938087678078033, 51.586992141762096], [-0.937332636663603, 51.5873072119485], [-0.93492634290483, 51.58836081134952], [-0.934774110277819, 51.58845114531925], [-0.934663126573178, 51.588505886685766], [-0.934565467487243, 51.588546362183585], [-0.934462140700832, 51.588582290320545], [-0.934337145222589, 51.58861892084846], [-0.934213782000904, 51.588647473549656], [-0.934055887760941, 51.588671216763295], [-0.933259701136762, 51.58864510257983], [-0.933213278816969, 51.588716614209304], [-0.932681740160827, 51.588792708227174], [-0.931992471253759, 51.58900853446031], [-0.930629113767652, 51.58946908647644], [-0.928525036745892, 51.59005953842682], [-0.928533690860491, 51.59024394687689], [-0.928456010745829, 51.59047792078815], [-0.928256501298223, 51.5906748158337], [-0.927916132025856, 51.59066181734799], [-0.927671608556404, 51.590624516635486], [-0.927319567022116, 51.59061680481465], [-0.926850285435352, 51.59062240702726], [-0.926313746570405, 51.59066425819173], [-0.925516790702947, 51.59079184232522], [-0.925387133168341, 51.59078076476673], [-0.925293323156809, 51.59077990606886], [-0.925202187496562, 51.59078806346173], [-0.925112304116411, 51.59080432476366], [-0.925036768134577, 51.59082431403807], [-0.924968299737815, 51.59085066215826], [-0.924899640304234, 51.59088510100373], [-0.924851228495836, 51.590917926896914], [-0.924734051019008, 51.59105082982951], [-0.924694255912291, 51.59108553291224], [-0.924446018071168, 51.59126668934789], [-0.924204972773907, 51.59150995377465], [-0.923492520665307, 51.59215352189589], [-0.922775141969353, 51.59288246146081], [-0.922298613651092, 51.59343737077436], [-0.922101568270595, 51.59365046303728], [-0.92149319027045, 51.59422483935332], [-0.921029930136652, 51.59464499018023], [-0.919455791303858, 51.595519790418045], [-0.919908472816787, 51.59560757835559], [-0.919902358174605, 51.595621908790214], [-0.919721503870405, 51.59588190272939], [-0.919513222918683, 51.59614164398608], [-0.919057326435374, 51.59661490568889], [-0.918991959815932, 51.59669253146064], [-0.918853979663433, 51.59690975873926], [-0.91882720841051, 51.59694278142396], [-0.918711889332325, 51.597056812913756], [-0.918614808732714, 51.59713234806153], [-0.918297245740306, 51.59749448485627], [-0.918073703114389, 51.59778825130676], [-0.917853804369843, 51.59811082427763], [-0.917772408698363, 51.59831598343439], [-0.917709563771812, 51.59853030520902], [-0.917692745480418, 51.59856971355161], [-0.917634249201942, 51.59866178857289], [-0.917443039919903, 51.59887043094418], [-0.917335250471836, 51.598971042984616], [-0.916888284039272, 51.599309503426845], [-0.916921110547038, 51.59938623548714], [-0.916942485633783, 51.5995195094582], [-0.916937652924948, 51.599601289122916], [-0.916945811778801, 51.599683188627004], [-0.916964246289877, 51.599757989575366], [-0.917049297107238, 51.59994580090974], [-0.917089705367533, 51.60000731699611], [-0.917171120773417, 51.60010517795964], [-0.91752823274465, 51.60044925531009], [-0.917834023417531, 51.600765883511485], [-0.917913079603466, 51.600902386385464], [-0.918033251654948, 51.60107073894696], [-0.91851090277833, 51.601507638962644], [-0.918694916056997, 51.601663091331545], [-0.919167224655989, 51.60214309940451], [-0.919302231291783, 51.6024167896932], [-0.919552009673002, 51.60266096432073], [-0.919812571846437, 51.60293760761218], [-0.920091738726093, 51.60358667644501], [-0.920208566517809, 51.603592246724574], [-0.920644522919282, 51.60359715428394], [-0.921093152621479, 51.6036156641763], [-0.921168285587618, 51.603613657034074], [-0.921469264587163, 51.6035867495928], [-0.921584776688781, 51.603586911416876], [-0.921718864440287, 51.603595336217005], [-0.921999521996191, 51.60363387995426], [-0.922136050325758, 51.603661209181794], [-0.922248015684399, 51.60368921195661], [-0.922346882036963, 51.60372159023333], [-0.922478548042792, 51.60377135359644], [-0.922605777045377, 51.603825571929555], [-0.92269948345521, 51.60389297005248], [-0.922855181916126, 51.60396453348124], [-0.922908065211369, 51.60398749776935], [-0.923525984356841, 51.604174796116844], [-0.923689774691443, 51.6042095667925], [-0.923842334751645, 51.60423074681459], [-0.924020987014581, 51.604247669912816], [-0.924152253615336, 51.604253368572344], [-0.924379056519158, 51.60424915231234], [-0.924491916632975, 51.60423939614583], [-0.925129396784027, 51.604149022807746], [-0.925308707040747, 51.60413807581467], [-0.925396812395019, 51.604137083863186], [-0.925816640142735, 51.60415261457396], [-0.926339243350925, 51.604157394450915], [-0.926627592983669, 51.60417621577326], [-0.928219342008724, 51.60433911850777], [-0.928540897883304, 51.60435823822504], [-0.928666454251138, 51.6043611822271], [-0.928925123731038, 51.60435275210506], [-0.929272427371303, 51.60432085222454], [-0.929350681081097, 51.604308977474346], [-0.929525019586135, 51.60426381040009], [-0.929730308556221, 51.60419195021111], [-0.929806393059037, 51.60414948374236], [-0.929854111423592, 51.60408517871234], [-0.929877477717563, 51.604012559228565], [-0.929880189120251, 51.60395863398061], [-0.930157001898001, 51.603362311928585], [-0.930233415197893, 51.60324431822904], [-0.930397156019029, 51.60303540508514], [-0.93058677482955, 51.602831223239896], [-0.930747612253953, 51.60268432562219], [-0.931065151604954, 51.602443542878724], [-0.931358556224333, 51.60224659876122], [-0.931494751600125, 51.602165114969594], [-0.931807666849096, 51.601998019766675], [-0.932115553298882, 51.60186055047904], [-0.932344261944379, 51.601774512081256], [-0.932581062209752, 51.601712824287226], [-0.932837650566022, 51.60166929919289], [-0.93304760157037, 51.60164423223924], [-0.933247236692325, 51.60162806284857], [-0.933524572231589, 51.601623388892406], [-0.93367307135076, 51.60163283011416], [-0.933854562367985, 51.601651562386515], [-0.934222940436163, 51.60170526005669], [-0.934582321335698, 51.60177326158339], [-0.935176916778695, 51.60190903449902], [-0.935323237909383, 51.60194992468383], [-0.935449328012611, 51.60199153042619], [-0.935555166022244, 51.60203475076641], [-0.935754957696255, 51.60213547009268], [-0.935920944220561, 51.60219991608389], [-0.936105992086264, 51.60225194623237], [-0.936251123590137, 51.60228203448254], [-0.9362553703842, 51.602285669620606], [-0.935954861941404, 51.603034649313756], [-0.936025513047831, 51.60328615677915], [-0.937604653681525, 51.60374194595848], [-0.937842729718605, 51.6037494948452], [-0.937998245297976, 51.60376798569096], [-0.938149157504488, 51.60379812385097], [-0.938282536474463, 51.60383709493093], [-0.938398403200176, 51.60388400001471], [-0.938549544157173, 51.60396629131982], [-0.938542113846477, 51.60403725821696], [-0.938540670189083, 51.60403724516617], [-0.938690470772444, 51.60417707075241], [-0.93885671831091, 51.60429276731543], [-0.938949655717409, 51.60433227129961], [-0.939171393952754, 51.60435945147724], [-0.939491406642938, 51.60438302306183], [-0.939580914110842, 51.60438383145672], [-0.939698081584302, 51.604374998744255], [-0.939860253923854, 51.60435578228165], [-0.940131370864495, 51.60430877574863], [-0.940224037565311, 51.60429792302206], [-0.941065905352937, 51.604358569226044], [-0.941456261791824, 51.60439985396626], [-0.94172260946072, 51.604433725629356], [-0.942065117075164, 51.604483568721975], [-0.942405972956444, 51.60454238758566], [-0.942542307804962, 51.60457868292929], [-0.942668453620936, 51.60461848302318], [-0.942754322773386, 51.60465162617505], [-0.942930037674105, 51.6047332338937], [-0.94300827141212, 51.60478429141865], [-0.943050642772121, 51.60482513526179], [-0.943095505071305, 51.604883085645305], [-0.943175837511794, 51.60503037259752], [-0.943199044776033, 51.60508812802956], [-0.943264927978451, 51.605360268787045], [-0.94328295289835, 51.6055168856955], [-0.943285556153251, 51.605653582182974], [-0.94327790338372, 51.60573443814757], [-0.943262026480571, 51.60579633763445], [-0.943228365851772, 51.605877858692274], [-0.943092212068021, 51.60614458434088], [-0.943074097962666, 51.60624063192375], [-0.943061365824471, 51.606415854446915], [-0.943044862244347, 51.60650472320056], [-0.943017897594943, 51.606608783583646], [-0.942979591589439, 51.606703750216774], [-0.942905884027612, 51.60683076806164], [-0.942741267849139, 51.60707925374213], [-0.942655006715899, 51.607249318295594], [-0.942630361430127, 51.60731563455148], [-0.942616263944651, 51.607425205688976], [-0.942621958529523, 51.60749089598715], [-0.942636336634899, 51.60755576531453], [-0.942660904708633, 51.607617129739225], [-0.942696981288364, 51.607680396114986], [-0.942747433102709, 51.60774648940761], [-0.942856244975984, 51.6078490746924], [-0.94299552290573, 51.60794563997599], [-0.943040847342192, 51.60798381288104], [-0.943186973159248, 51.608158666884215], [-0.943285889122319, 51.60825217104693], [-0.943509689787491, 51.60844031193307], [-0.94379690141149, 51.609007570967925], [-0.943824004868445, 51.60908424372538], [-0.943831400135399, 51.609201201602104], [-0.943839541642426, 51.60922375393887], [-0.943852077204152, 51.6092436483043], [-0.943874740412961, 51.60926273459518], [-0.943900416430683, 51.60927645299323], [-0.944008015202393, 51.60930709311221], [-0.944074894993692, 51.60934995527111], [-0.944126815315737, 51.60941516198104], [-0.944143328071964, 51.60945037786937], [-0.944150844233183, 51.609499899486615], [-0.944148608042361, 51.60953404761941], [-0.944074023202655, 51.60969882315075], [-0.94403415265091, 51.60986121332522], [-0.944017357658548, 51.60996266784037], [-0.943992023164905, 51.61030771903426], [-0.943965568458423, 51.61051428886229], [-0.943938629028152, 51.61067949277199], [-0.943919488028492, 51.61075754789674], [-0.943885949921455, 51.61083367520212], [-0.943827406881077, 51.61092935920088], [-0.943739589608875, 51.61104186395993], [-0.943638735204063, 51.61115604969767], [-0.943533757272514, 51.611261206608894], [-0.942952360107171, 51.61179457356613], [-0.942768364001955, 51.61194397664764], [-0.942436714102017, 51.61217027698273], [-0.942010518369458, 51.61248743929258], [-0.941742162181165, 51.61266215641604], [-0.941369087685306, 51.61286829880399], [-0.941218061678922, 51.612965845186196], [-0.941055044244821, 51.613082165678385], [-0.940962318642569, 51.61315685920963], [-0.940802313735133, 51.613329853845215], [-0.940532273923746, 51.613638528438315], [-0.940201080800705, 51.61403027273604], [-0.940058816377521, 51.614185443187054], [-0.939985695447699, 51.614286388653916], [-0.939953592073967, 51.614362527773245], [-0.939906859457064, 51.614508669589505], [-0.939802341993177, 51.61490335803689], [-0.939554942446072, 51.615603370947234], [-0.939452722231603, 51.61596121406953], [-0.939421935085161, 51.61604275989804], [-0.939387192811998, 51.616108085051245], [-0.939207265482904, 51.61639149465681], [-0.939036585027605, 51.61671185322904], [-0.938852844916865, 51.61697274874371], [-0.938765881571911, 51.61710953487875], [-0.938636321443754, 51.617400592062225], [-0.93858227703968, 51.617550263869646], [-0.938563060896774, 51.61763101488344], [-0.938557821588965, 51.617793716095726], [-0.938568952285691, 51.6178738422429], [-0.938586194898738, 51.61793963701825], [-0.93864824402059, 51.61806608070808], [-0.938712639101221, 51.61815388154161], [-0.938801458484915, 51.61824729803767], [-0.938902019778203, 51.61833272809444], [-0.939001577491258, 51.61839926656718], [-0.939080060597956, 51.6184404379885], [-0.939144458958051, 51.618466196342986], [-0.93924483456823, 51.61849767462955], [-0.939389936057716, 51.61853135511866], [-0.939533886937889, 51.618552436752374], [-0.939605967169062, 51.618558482633226], [-0.939704125343146, 51.618561167280205], [-0.940011869234288, 51.61855765138392], [-0.940970156479417, 51.61846828865034], [-0.942814559287174, 51.61834913395653], [-0.9433943585448, 51.61832378069166], [-0.943791844341078, 51.61831207069643], [-0.944095316626396, 51.61830580819228], [-0.944345189840605, 51.61830625638639], [-0.944633949874169, 51.618311549349706], [-0.944866264500346, 51.618321729423634], [-0.945069571918896, 51.61833704343469], [-0.945259736594118, 51.618358533188456], [-0.945405071369022, 51.6183823175338], [-0.945538707551366, 51.61841229079249], [-0.945670733169093, 51.618449442740584], [-0.945789657802543, 51.61849097274293], [-0.945898390514756, 51.618536007789324], [-0.946002624502939, 51.61858819565799], [-0.946144975691139, 51.61867849034559], [-0.946290660655923, 51.61881197458077], [-0.946424293873759, 51.618966930407886], [-0.94648587943588, 51.619052004215185], [-0.946597289998464, 51.61923103785771], [-0.946748500992991, 51.619500344620654], [-0.946865282768134, 51.619759451627154], [-0.94692090631825, 51.619852564183816], [-0.946986743272162, 51.619941272483025], [-0.947121992710119, 51.62008904866086], [-0.947221067183078, 51.620177155655796], [-0.947357337089385, 51.62028088174252], [-0.947636341593443, 51.62045871900467], [-0.947732020809812, 51.62050633282523], [-0.947832261440868, 51.62054409665008], [-0.948024909405708, 51.6205835873772], [-0.948272727755043, 51.62061098363029], [-0.94903310890345, 51.62064836261257], [-0.949342820854191, 51.62068530212313], [-0.949548509996597, 51.62072310869445], [-0.949603327033706, 51.620726296510135], [-0.94966121922192, 51.62072141934501], [-0.949725095662238, 51.62070760405018], [-0.949813979767225, 51.620674230793945], [-0.949850856696741, 51.620766275113425], [-0.949938127431095, 51.62092800552347], [-0.95012170684362, 51.62142328688538], [-0.950137689181391, 51.621481875301626], [-0.950144591409982, 51.621558365780544], [-0.950143525838059, 51.62166715485939], [-0.950086848280287, 51.62218276713024], [-0.950081566444785, 51.62234906486587], [-0.950091380322934, 51.6227375905417], [-0.950012857804674, 51.623198158520914], [-0.949963053357781, 51.62366617649237], [-0.94993621019599, 51.62382778558582], [-0.949887611273865, 51.62405573809743], [-0.94981748429385, 51.62434014525264], [-0.949698012983878, 51.6246969431444], [-0.949601071539472, 51.62520410239216], [-0.949519655994856, 51.62547671925938], [-0.949509640700394, 51.62553507516918], [-0.949509569744091, 51.62560071332227], [-0.949517625184728, 51.6256898023632], [-0.949539397678852, 51.62581048474923], [-0.949602831958219, 51.626066413978656], [-0.949622600072634, 51.6262113557699], [-0.949625807500304, 51.62644786389373], [-0.949588359660548, 51.62688092470566], [-0.949587162842075, 51.62718303218221], [-0.949593421398238, 51.627287390862], [-0.949641886384285, 51.62762860642186], [-0.949677564559904, 51.627772791296934], [-0.949732061930258, 51.62791534613564], [-0.949847071945823, 51.62812767746571], [-0.95005020451512, 51.62890367131774], [-0.949860358893705, 51.62924185674224], [-0.949849459019953, 51.62927592739189], [-0.949848649628705, 51.62931098742953], [-0.949857806222275, 51.62935243070728], [-0.949882540677514, 51.62940750068883], [-0.949782851646605, 51.62940750843079], [-0.949684104107472, 51.6296170289926], [-0.949619670293909, 51.62984214210067], [-0.949589348281571, 51.62990391300069], [-0.949478823262764, 51.63006027755304], [-0.949419643728549, 51.63018293320961], [-0.949378577882241, 51.63033452402259], [-0.949364251310331, 51.63051692549393], [-0.949339228920643, 51.63059942443184], [-0.949248633732607, 51.63076855530058], [-0.949181283974238, 51.630869557872636], [-0.949044504574139, 51.63103647701982], [-0.948893935504611, 51.63136242402941], [-0.948761069414249, 51.631297394415576], [-0.948669492362367, 51.63125880992652], [-0.948537801268757, 51.63120547966423], [-0.948447461288637, 51.63117589768262], [-0.948353982967507, 51.63115707745748], [-0.948302104865814, 51.63115121794117], [-0.948079606840815, 51.63115102360314], [-0.947964190602531, 51.63114369566099], [-0.94782149485015, 51.63112892992514], [-0.947725107052886, 51.63111098229264], [-0.947684910040859, 51.63109983219839], [-0.947483021604023, 51.63102069524269], [-0.947447137482345, 51.63101048287877], [-0.947306094892948, 51.630986739722026], [-0.947000710620611, 51.63094713644845], [-0.946674033898238, 51.6308911565172], [-0.946364247153943, 51.63079216747898], [-0.946230490849763, 51.63076579091048], [-0.946172752135344, 51.63076347450912], [-0.94612066649297, 51.630766603772976], [-0.945914796224295, 51.63079712600587], [-0.94583241748209, 51.63079818492752], [-0.945382953779145, 51.63067905708907], [-0.945085984219956, 51.63058827220451], [-0.944883205963743, 51.630547786680644], [-0.944304065189339, 51.630538086402446], [-0.94394898927073, 51.630523204990325], [-0.943611477254356, 51.63049858971805], [-0.943603681926519, 51.6307098224617], [-0.943277115569317, 51.63102249010073], [-0.943359247728321, 51.63109426279834], [-0.942862682241593, 51.631385618132356], [-0.942777562378065, 51.63144239822567], [-0.942532313252267, 51.63161282917167], [-0.942337892928893, 51.63177202827151], [-0.94226606523137, 51.631816339444626], [-0.942197377359527, 51.63184988892168], [-0.942115813951467, 51.631877927416205], [-0.941937005967162, 51.631924871353945], [-0.941512981586086, 51.63201636159427], [-0.94144898217334, 51.6320346671529], [-0.94125937051438, 51.632111184999914], [-0.940790185204025, 51.6323425346351], [-0.940501042462563, 51.632535943664614], [-0.940243238615803, 51.63268647504363], [-0.940131608045529, 51.632764593869275], [-0.939328651391563, 51.63361514453957], [-0.939011405652477, 51.634145481445906], [-0.93882930544315, 51.63451878632893], [-0.93850479164515, 51.63486472819315], [-0.93841585373771, 51.63483694950617], [-0.938308667759282, 51.63503379600045], [-0.938237520065274, 51.63511048065125], [-0.938174497877949, 51.635148574806536], [-0.938097155068085, 51.63518114448376], [-0.938014243480848, 51.63520467214815], [-0.937885103100742, 51.635227781700706], [-0.937899482630853, 51.63529265131639], [-0.937852791962712, 51.635312010611116], [-0.937756752174709, 51.63534081433219], [-0.93768849662133, 51.635355482713884], [-0.937445207164159, 51.63537845841074], [-0.937282775985471, 51.6354039635962], [-0.936848828519967, 51.635485456519916], [-0.935951432459366, 51.63561220386278], [-0.935719677036262, 51.635636179646525], [-0.935420148631615, 51.63565414571281], [-0.935249454884316, 51.63560044703531], [-0.935077590540852, 51.635535048401415], [-0.934717727795324, 51.63535285185533], [-0.934413155884105, 51.635216113905294], [-0.934240481559584, 51.635123731852076], [-0.934130824273522, 51.63505529964683], [-0.934018404467151, 51.63498144729724], [-0.93379675026591, 51.63482118293064], [-0.933679892303923, 51.6347517857655], [-0.933595523374065, 51.63471415412531], [-0.933350473747258, 51.63462740768713], [-0.933261876876166, 51.63458524160035], [-0.933052343088727, 51.63446285066096], [-0.932887751506176, 51.63439571653097], [-0.932638117941304, 51.63431971687678], [-0.932307197466639, 51.63419801967628], [-0.931343887912331, 51.63380981222079], [-0.931071830619705, 51.63376597498289], [-0.930956833347264, 51.63374065092008], [-0.930823331188951, 51.63370346918478], [-0.930701576222194, 51.633658301797674], [-0.930601553796263, 51.63361063468632], [-0.930506119022842, 51.63355221932683], [-0.930386739592999, 51.633467510133144], [-0.930286034494439, 51.633387466714524], [-0.930225334024314, 51.63332666999925], [-0.930188937852857, 51.633276884582266], [-0.930114567680391, 51.63312155131756], [-0.92999324620862, 51.63293521875163], [-0.929900400330813, 51.63282827174111], [-0.929602366751531, 51.6325378240622], [-0.929499431873266, 51.632429885607195], [-0.929341000864788, 51.63222433167361], [-0.929059923028374, 51.631889079042224], [-0.928963213558906, 51.63176231446386], [-0.928896162303318, 51.6316645934755], [-0.928844852932023, 51.631573310156845], [-0.928688841592085, 51.63126527289447], [-0.928672375509884, 51.6312282570475], [-0.928615004479859, 51.631026321392014], [-0.928599834825331, 51.63099561149414], [-0.928552267379979, 51.63092953870757], [-0.928477466267079, 51.630854225808044], [-0.928389580173335, 51.630782390113474], [-0.928294323595921, 51.6307167812279], [-0.928190294396403, 51.63065558801307], [-0.928078937075949, 51.630598823630024], [-0.927494137115659, 51.630339021667446], [-0.927177150281751, 51.63017967221046], [-0.927053070740772, 51.63011110151437], [-0.926922044883713, 51.63003077810591], [-0.926774152423019, 51.6299305188448], [-0.926569924361936, 51.62976860145066], [-0.926465515994788, 51.62966244509719], [-0.926222881099496, 51.62935271335746], [-0.925807083215573, 51.62885077488713], [-0.925685153671251, 51.62869140695483], [-0.925627779063265, 51.628612654944924], [-0.925107975398826, 51.62780494620014], [-0.925039238852947, 51.627717997425265], [-0.924853081975605, 51.627525670804864], [-0.924566287633664, 51.62725149768458], [-0.924018135317732, 51.62666651663998], [-0.9236755124427, 51.62631000590676], [-0.923506463123086, 51.62618886774415], [-0.92325024557972, 51.62602736696645], [-0.923179326155173, 51.62597186775246], [-0.923151247824846, 51.62593744208942], [-0.923025917353845, 51.62573937605691], [-0.922746731858051, 51.625388839233764], [-0.922647729925315, 51.625421200084226], [-0.922438316532782, 51.62517470633975], [-0.922266691774008, 51.62491866820555], [-0.922176577184834, 51.624819832363215], [-0.921722712186069, 51.62440384906751], [-0.921324388846087, 51.624082786314446], [-0.921078577970903, 51.623909687134365], [-0.920860652296657, 51.62377910436709], [-0.920574889783577, 51.623646099345635], [-0.920239048968319, 51.623492851580735], [-0.920014292502202, 51.62371107994427], [-0.919774493442185, 51.623954346092496], [-0.9196346398006, 51.62406455586703], [-0.919395541436808, 51.62427815528515], [-0.919291601043514, 51.624396787581134], [-0.919216417933559, 51.6245210794288], [-0.919153464283899, 51.62467785367513], [-0.919134125069682, 51.624762197061855], [-0.919115026043568, 51.62495803894169], [-0.919049238753011, 51.62517323267518], [-0.919009465019033, 51.625266379578875], [-0.918926652164549, 51.625407685106715], [-0.91889138185638, 51.62549368011671], [-0.918887531877765, 51.62553410703284], [-0.918896749679156, 51.62569334383204], [-0.918892707420934, 51.62574186144837], [-0.918872585162246, 51.62579832350382], [-0.918836276012485, 51.62586722482348], [-0.918763089019947, 51.62596815648993], [-0.918486277330256, 51.626309088016214], [-0.918317614737411, 51.62653682130949], [-0.917905561785174, 51.626975413689514], [-0.917718470441796, 51.62724883363936], [-0.917588198962995, 51.627380709193844], [-0.917518986462533, 51.627435819379606], [-0.917391270738013, 51.627520961779815], [-0.916852199941663, 51.62783249660931], [-0.916708494011591, 51.62822500463541], [-0.916564194300437, 51.62882431452802], [-0.91642514281193, 51.62950639562586], [-0.916399138398425, 51.62974892972319], [-0.916394191477189, 51.62995659074321], [-0.917260413231125, 51.62992321851857], [-0.917422640699178, 51.63166639247214], [-0.91745600722272, 51.63232848375385], [-0.917204699151121, 51.632324368705305], [-0.916787813832452, 51.632356490901394], [-0.916473041038736, 51.63240843616508], [-0.91615824611563, 51.63246127954521], [-0.916096846672852, 51.632491284427324], [-0.916000979824314, 51.632573122584574], [-0.916035541448316, 51.63300234215989], [-0.916058746179642, 51.633180590521675], [-0.916070697537387, 51.63322475979131], [-0.916098260729099, 51.63328076225654], [-0.916287121367376, 51.6334803208717], [-0.916556537933578, 51.63369500893812], [-0.916833436931067, 51.63389897542989], [-0.916980624704717, 51.63396776999687], [-0.917236275570907, 51.634093312450645], [-0.91746761535009, 51.63414759643489], [-0.917599467742121, 51.63382870989293], [-0.917652284973834, 51.63367364156546], [-0.917677934007693, 51.63362802065708], [-0.917745133700401, 51.63359716923921], [-0.917749446066394, 51.633598108140106], [-0.917778102484095, 51.633608262991594], [-0.918084580428658, 51.633662338963], [-0.918258883815884, 51.633684625273325], [-0.918506861448772, 51.63370758977881], [-0.918953829589691, 51.63374767133924], [-0.919245145699076, 51.633771033193085], [-0.919300707852053, 51.63386505735126], [-0.919518444759651, 51.63449197843591], [-0.919277685382965, 51.63446908250848], [-0.919031520477806, 51.63467362436313], [-0.918786199566619, 51.63490335001199], [-0.918632752044247, 51.63503681158531], [-0.918623327237537, 51.63512933850577], [-0.918590569006466, 51.635413172104], [-0.918679820058316, 51.63554886817429], [-0.918329488250497, 51.63557621368664], [-0.918276435808259, 51.635741170885815], [-0.918247752304029, 51.6360358318421], [-0.918226764712395, 51.6364321689642], [-0.918316733144818, 51.63702374696847], [-0.918287332378286, 51.63783452012518], [-0.918306713699577, 51.63835621240955], [-0.918316674296085, 51.639213205140855], [-0.918347519668651, 51.639799742499974], [-0.918322169732004, 51.63995416480466], [-0.918318885834364, 51.64003146244247], [-0.91832686087795, 51.64012145202931], [-0.91837911416845, 51.640354816042915], [-0.918418495846573, 51.64070405330022], [-0.918530296534871, 51.64128953760163], [-0.918512952473936, 51.64147190762244], [-0.918367217757134, 51.64200916315153], [-0.917905817511154, 51.6420255938785], [-0.917874522823857, 51.64200462484983], [-0.9178264462409, 51.64196012300076], [-0.917792775459127, 51.641917552189355], [-0.917773553228143, 51.64187511449974], [-0.917765526057023, 51.64184806570082], [-0.917757894232724, 51.6417436926823], [-0.917749532884981, 51.64142711089125], [-0.917739557627689, 51.64136048104305], [-0.917720785029217, 51.641299165096676], [-0.917688816437575, 51.64124581999865], [-0.917649452591449, 51.641199600032465], [-0.917568381483579, 51.64114490323613], [-0.917433423830488, 51.64098630616572], [-0.917315173490429, 51.64079369481265], [-0.916601390868836, 51.640243120219885], [-0.916329281834837, 51.640018517003504], [-0.916001068304932, 51.63966211774633], [-0.915790319174844, 51.63947044935813], [-0.915502073944432, 51.63913509831614], [-0.915393357554307, 51.63902799332443], [-0.915169439572157, 51.63884339546647], [-0.914312592230519, 51.638234837864296], [-0.913969150495335, 51.63797270396478], [-0.913808719070197, 51.63773204326735], [-0.913709021859032, 51.63761063348384], [-0.913238840648949, 51.637814889395024], [-0.912211197236081, 51.63818662075986], [-0.912057780107923, 51.6382571327065], [-0.911911629192503, 51.63832591344631], [-0.911683066608314, 51.6384568717294], [-0.911571655864317, 51.638583520328496], [-0.910821072629623, 51.63897039510019], [-0.910799442348496, 51.63890815232427], [-0.910457034748542, 51.63884473254883], [-0.90959863753988, 51.63872527019996], [-0.909397970101408, 51.639078576087414], [-0.909048252097236, 51.63925965643008], [-0.909362542404515, 51.63959166868019], [-0.90780907162756, 51.64013291512084], [-0.906217399025103, 51.640939038154336], [-0.905898125060113, 51.64111499768922], [-0.905490384709512, 51.641363863281036], [-0.905329841704473, 51.64154939281248], [-0.905189541321435, 51.641794455508446], [-0.90489098319803, 51.64194992468491], [-0.904781623731163, 51.641990266433346], [-0.904676706895303, 51.64202615370086], [-0.904609919053975, 51.64203901826923], [-0.904237228330216, 51.64209218907456], [-0.90337364044862, 51.64224597828853], [-0.902975191138407, 51.642348358507896], [-0.90292303291413, 51.6422939216028], [-0.902563354675933, 51.64240655335107], [-0.902346768622897, 51.642458479170756], [-0.900824166346957, 51.64291090498388], [-0.900831401206159, 51.64297031739377], [-0.900456613238591, 51.64299018760407], [-0.900019098619797, 51.64297440185565], [-0.899740380937974, 51.64290615240652], [-0.899740489711103, 51.64290165761423], [-0.899316872364163, 51.642849133775655], [-0.899203336991784, 51.642822893203494], [-0.898949902655656, 51.64272520647125], [-0.898783095909619, 51.642631028913314], [-0.898613530793898, 51.64253143027416], [-0.898274969154989, 51.64230885935864], [-0.898003026265053, 51.642080618381755], [-0.897815191816853, 51.641840577798526], [-0.897681652652772, 51.6416262230417], [-0.897327401428262, 51.64091885338664], [-0.896908641882592, 51.6401308512027], [-0.896689777704333, 51.63985994571793], [-0.896199107519928, 51.639356299928586], [-0.896147069948886, 51.63929736526477], [-0.896071667668875, 51.63912941223961], [-0.896034388155249, 51.63881974973283], [-0.89604243255033, 51.63866696761571], [-0.896079873457203, 51.63849378104931], [-0.896158355572289, 51.63829670279626], [-0.896345617779906, 51.63796397393339], [-0.896436991088377, 51.637771512438086], [-0.896627579786388, 51.63748017587825], [-0.896853716275347, 51.63721255114492], [-0.896930541034958, 51.63714313797598], [-0.897052325259386, 51.63706695367484], [-0.897622203318074, 51.636806151704704], [-0.897875248140837, 51.636679946210485], [-0.898045509693898, 51.63657094674504], [-0.898161794997489, 51.63648302058021], [-0.898300490282884, 51.636364732965696], [-0.898761753797595, 51.63587451909389], [-0.898944791614438, 51.635595696246455], [-0.899167964890093, 51.63497197055003], [-0.899296205851425, 51.63450920414348], [-0.899574174378538, 51.633591065468096], [-0.89965934952667, 51.63323579470252], [-0.899745200652967, 51.632733067337156], [-0.89977291429982, 51.632065248259224], [-0.899749317297925, 51.63190587518938], [-0.899730833669311, 51.631833768913715], [-0.899698165870897, 51.631750739777836], [-0.89965967663145, 51.63166945441679], [-0.899415121605884, 51.63126703489972], [-0.899342021743563, 51.6311233827535], [-0.899274678557411, 51.630980683675816], [-0.899221406706553, 51.63067446858268], [-0.899099405183406, 51.63046202142283], [-0.899036514315775, 51.63037421293725], [-0.898969246754073, 51.63028816171176], [-0.898790586842518, 51.63008867047265], [-0.898592010806669, 51.62987640386868], [-0.898497321924236, 51.62978919602221], [-0.898330098469121, 51.62965455114822], [-0.898092642525963, 51.62949676796704], [-0.897090362270362, 51.62894426419184], [-0.896737033461809, 51.62879887742956], [-0.896347312922056, 51.6286648367393], [-0.895633444660858, 51.62837398981453], [-0.895432402381131, 51.628264199314984], [-0.895328663542796, 51.62819308870188], [-0.895257753282041, 51.62813847178444], [-0.895144755729953, 51.62803220648194], [-0.894948239644532, 51.627795675481295], [-0.894944118635818, 51.62766795529761], [-0.894659948504904, 51.62723368184], [-0.894597856997988, 51.62711350846984], [-0.894557343909314, 51.62699713484451], [-0.894469809950127, 51.62655661915932], [-0.894297931114171, 51.625960652861906], [-0.894027819576293, 51.62530531541029], [-0.893931965007508, 51.62514795788166], [-0.893770350871199, 51.62496210671055], [-0.893637995566781, 51.62476124514902], [-0.893507481839104, 51.62466290563429], [-0.892108104715385, 51.62369479825078], [-0.891788795844237, 51.623459800649094], [-0.891922368328922, 51.62337294285213], [-0.891402229815371, 51.62296161084893], [-0.891224922435199, 51.622768414566416], [-0.890089770742591, 51.621276764770215], [-0.890188416566163, 51.62120036880181], [-0.889947380146256, 51.62101466068101], [-0.889727152716072, 51.62086421627997], [-0.889328903798693, 51.62066892786315], [-0.889153387824523, 51.620758083474584], [-0.888409981594066, 51.6201459098237], [-0.888016456293258, 51.619876030785385], [-0.887588982852847, 51.619754191291285], [-0.887143566599165, 51.61965735685454], [-0.88701981132148, 51.61963820065132], [-0.886790744842007, 51.619613550199404], [-0.886603228328527, 51.619602780759124], [-0.886388075513318, 51.619599841439666], [-0.886090409498186, 51.61960421155123], [-0.8851368584814, 51.61967159165818], [-0.883828125903616, 51.61979133688442], [-0.883515973065361, 51.619797361107345], [-0.883424375160774, 51.6198216668555], [-0.883259776293847, 51.619877648328995], [-0.883163867754863, 51.61990101371408], [-0.883044634749604, 51.619815357981636], [-0.881854770311083, 51.61956485587701], [-0.881704286246311, 51.61951666620604], [-0.881635675440863, 51.619487239450166], [-0.881560131370525, 51.619446057447796], [-0.881477720403852, 51.619390423316226], [-0.881374708667671, 51.619291432867335], [-0.880834298239682, 51.61853547912722], [-0.880617549323506, 51.618127888748454], [-0.880388345702594, 51.61816796449318], [-0.879226788544387, 51.6185884841998], [-0.878534686661489, 51.61883184500677], [-0.878385021629543, 51.61898507235025], [-0.878148819949825, 51.61913297697072], [-0.878102165244257, 51.61915051459153], [-0.87804120240859, 51.61916252048532], [-0.877967464227806, 51.619165412606506], [-0.877896924603018, 51.61915574690363], [-0.877839648002824, 51.61913541789456], [-0.877812586845032, 51.61911987344738], [-0.877382402665225, 51.61869944717381], [-0.877261875140598, 51.61866682400238], [-0.877087293116294, 51.618600414623565], [-0.876592344555959, 51.61846350297477], [-0.876408990128558, 51.61845995037962], [-0.876374465270622, 51.61845422502283], [-0.876347205240439, 51.61844677083749], [-0.87630299358364, 51.61842386858449], [-0.876241963569583, 51.618380124514495], [-0.876216636094276, 51.618352907107045], [-0.876152781748704, 51.618131100785114], [-0.876106882196741, 51.61811807314475], [-0.876305643178539, 51.617614643124426], [-0.875030363348109, 51.6174927341714], [-0.874705473526163, 51.61748872204597], [-0.874564111923802, 51.6174810731233], [-0.874279482039409, 51.61730930128958], [-0.874259717266618, 51.61699889890464], [-0.874416434195306, 51.61673604585861], [-0.874423036602998, 51.61652750219062], [-0.870144618410033, 51.61769939147719], [-0.870074692270606, 51.617607003497994], [-0.869665459226217, 51.61768399010514], [-0.869137937974611, 51.617812887107476], [-0.868711126950696, 51.61789959196275], [-0.868460959800069, 51.617969115035805], [-0.866874516019656, 51.61827841686334], [-0.866642434191741, 51.6183175388698], [-0.866517885416195, 51.61833072340073], [-0.866392071649004, 51.61833670224208], [-0.865776872894858, 51.61833166083683], [-0.865633662902087, 51.618340168339564], [-0.865493072065054, 51.618359490991885], [-0.864874419821269, 51.618492883413026], [-0.864829070270363, 51.61851582340227], [-0.8648101986804, 51.61846169086974], [-0.864778464993556, 51.618402038980314], [-0.864733824417545, 51.61833866562683], [-0.864681918741689, 51.61827702035103], [-0.864649512487616, 51.61824433697217], [-0.864492159027339, 51.61812502442397], [-0.864510219622979, 51.618037979732996], [-0.864490008258273, 51.61792179156664], [-0.863791866117017, 51.616668790850674], [-0.863578496430752, 51.61619016667409], [-0.863939572338851, 51.6160749702936], [-0.864141702322916, 51.61602027805823], [-0.864343742093738, 51.615969181278444], [-0.864684853799959, 51.61590144547291], [-0.864287415633653, 51.61573755014447], [-0.864114344880943, 51.615611790807684], [-0.86394143216696, 51.615479738556914], [-0.863424226660599, 51.6150224515856], [-0.863108525016747, 51.61470918210108], [-0.862999136822108, 51.61463618943345], [-0.862947760773663, 51.614611414387845], [-0.862827479233939, 51.614569786988696], [-0.862764327092327, 51.6145538895073], [-0.862690954996651, 51.614542388851355], [-0.862422671693898, 51.614528100870835], [-0.862278208948609, 51.61452939875511], [-0.862025067586916, 51.614544929155834], [-0.861633333855888, 51.61461576315295], [-0.861195617216796, 51.61467715820802], [-0.860991546767721, 51.61469406144679], [-0.860819513274215, 51.61470048511226], [-0.860591345418716, 51.61469917048917], [-0.860366335624517, 51.61468709604235], [-0.860199196800327, 51.61467108707321], [-0.860140174693704, 51.6146633207896], [-0.859842784619867, 51.61460018922178], [-0.85969929013584, 51.61456282905675], [-0.859501466379857, 51.61450336097874], [-0.859306643699259, 51.614439425872085], [-0.859175017225196, 51.614389591981386], [-0.858977780895874, 51.61430675031806], [-0.858172868778381, 51.61392127488393], [-0.856305510909038, 51.61299763777437], [-0.855879431428414, 51.61282624136621], [-0.855413827571698, 51.612676038205095], [-0.855073660630441, 51.61259179657028], [-0.854915624510577, 51.612558784566126], [-0.854688372582268, 51.61252150056368], [-0.854459541396129, 51.6124895957323], [-0.854208848612115, 51.61246556965946], [-0.853413812340721, 51.612436228916096], [-0.851724243907319, 51.61242871018406], [-0.851450292115, 51.612410744947404], [-0.850998615679464, 51.61233888823236], [-0.850653274334699, 51.61223120468302], [-0.850372939737194, 51.61235164666859], [-0.850315593337778, 51.61233490012849], [-0.850193999216673, 51.612288751000705], [-0.850146601119627, 51.612278395984944], [-0.849926028861458, 51.61226274823948], [-0.849854084982468, 51.61225215268858], [-0.849714847013531, 51.612218418620564], [-0.849473435162227, 51.61217019573735], [-0.849372523204365, 51.61216291272777], [-0.849235958321253, 51.61219484371945], [-0.849170915863905, 51.6121969037703], [-0.849112126238191, 51.61218014249445], [-0.8487984760956, 51.61201881385575], [-0.848813983178796, 51.61186251023449], [-0.848805967905994, 51.611779707971536], [-0.848777693193183, 51.61169850541887], [-0.848751669639592, 51.61164250170296], [-0.848740414389996, 51.61163070213332], [-0.848685616135578, 51.61162746733029], [-0.848598109857592, 51.61148993537107], [-0.848561752293423, 51.61144282198033], [-0.848420551583887, 51.61131555337684], [-0.848346143135118, 51.61123120073643], [-0.848017978126262, 51.61073074025961], [-0.84803240586268, 51.61067423405594], [-0.848009203184881, 51.61062095534751], [-0.848010806265629, 51.61061467688053], [-0.848360723390725, 51.61054078070849], [-0.848731046077576, 51.61040234328455], [-0.848814480324059, 51.61035820278237], [-0.848820437461021, 51.610351067821576], [-0.848690278305866, 51.610072847084595], [-0.847947554822518, 51.60900543974003], [-0.847435103308081, 51.6083125448088], [-0.847167998407497, 51.60796823756615], [-0.846186886755928, 51.60662333116728], [-0.845549998419521, 51.605828497430636], [-0.845383680959569, 51.60566770865375], [-0.844840468159951, 51.60522267062485], [-0.84443530295085, 51.60497141150611], [-0.844232696249957, 51.60481835643492], [-0.843486943931864, 51.60416181103064], [-0.84332558359401, 51.60420428093958], [-0.842908147301968, 51.603868373383044], [-0.842663709069561, 51.603714004109015], [-0.842310199280505, 51.603533382087996], [-0.841471682375652, 51.60311958453644], [-0.841215384127901, 51.602977683579475], [-0.840873068217364, 51.60281155440105], [-0.840467421086961, 51.602637605395635], [-0.840268344470896, 51.602516948405764], [-0.840203154295604, 51.60246864832527], [-0.838474883614574, 51.601841924417336], [-0.838334815858368, 51.60178568911777], [-0.838125139250388, 51.60168470536249], [-0.837520083534699, 51.60134782062488], [-0.837365310402971, 51.60124558073874], [-0.837143016970701, 51.6010734356079], [-0.83702163004049, 51.600964332538595], [-0.836879440722268, 51.60082175386177], [-0.836733036616179, 51.60067463738169], [-0.836105420124444, 51.59992210370809], [-0.836001567218505, 51.59980508080317], [-0.835894758960057, 51.59969072601903], [-0.835646409012494, 51.5994652683849], [-0.835572705263831, 51.59941148620318], [-0.835355212679077, 51.599278049641256], [-0.835001490423373, 51.59910819321327], [-0.834666328550124, 51.59894661249016], [-0.834023851532118, 51.59860753956394], [-0.833813699592692, 51.59846967713012], [-0.832219972267628, 51.59727861587006], [-0.831975375091702, 51.59713321406168], [-0.83180286996819, 51.597047874561696], [-0.83156138306724, 51.59695015903964], [-0.831279067386554, 51.596868221715724], [-0.831119729288761, 51.59683246683902], [-0.830996129682144, 51.596810555210986], [-0.830798964246538, 51.59678611250204], [-0.829935838169309, 51.596720865686486], [-0.82967342169104, 51.596707460026586], [-0.829378950815281, 51.59670542343618], [-0.828672101908656, 51.596738836236966], [-0.828529092462618, 51.59674190522934], [-0.828241907711544, 51.596737240965595], [-0.828066024571149, 51.59672739285258], [-0.827854311754233, 51.596707295846045], [-0.827399248313258, 51.59666228882735], [-0.827164974703315, 51.59662128423301], [-0.827063074447412, 51.59659778687348], [-0.826830893268571, 51.59653162563389], [-0.826403126611598, 51.596379885757386], [-0.826320361645679, 51.596342192238744], [-0.826196596762853, 51.596270819297594], [-0.825930135887572, 51.596078429107884], [-0.825702044863314, 51.59590980062742], [-0.825239717878873, 51.595531118786504], [-0.824901250965003, 51.59522021379687], [-0.824412039116432, 51.59470908081712], [-0.8242790371805, 51.59460434384618], [-0.824162427084317, 51.59453573788591], [-0.823734544991122, 51.59433363318264], [-0.822923577534385, 51.59387232098135], [-0.82274220720895, 51.593740122024236], [-0.822758790294358, 51.59343366962803], [-0.822450529949737, 51.592123177421634], [-0.822408018987733, 51.591980681321466], [-0.82236394886053, 51.59184266543808], [-0.822242174035691, 51.59158338051977], [-0.821801765862476, 51.5908065697487], [-0.821372709449585, 51.59009371260957], [-0.821171850754746, 51.58982284235581], [-0.820679968304875, 51.58936291919855], [-0.820417155492676, 51.58914357740762], [-0.82015811620844, 51.5888901042506], [-0.820045903377484, 51.58876399099103], [-0.81975498206002, 51.5884040936899], [-0.819793038416411, 51.58838379523831], [-0.819648800144719, 51.588268149727725], [-0.819147039514258, 51.58763368041164], [-0.818936357700162, 51.58740856531028], [-0.818746726401906, 51.58698404449756], [-0.818744261992127, 51.58691208559554], [-0.818786542624285, 51.586561832259704], [-0.818798419467402, 51.58638211648965], [-0.818772601288344, 51.58593047014409], [-0.818622316220491, 51.585380460186784], [-0.818493730937228, 51.58471737211902], [-0.818460174123387, 51.58461992329734], [-0.818316632401033, 51.58436670899539], [-0.818092592164715, 51.58404524580265], [-0.817774082795079, 51.58341531231479], [-0.817553796530972, 51.58311636524129], [-0.817445537064436, 51.58300557512581], [-0.81689125274485, 51.582562990062094], [-0.816348587477007, 51.58217357091916], [-0.816214612729635, 51.58210837837547], [-0.816144330954904, 51.58209148442308], [-0.816059129697027, 51.58209332267878], [-0.815742672724781, 51.5820523651453], [-0.815217212787465, 51.58194545592985], [-0.815002344756643, 51.58188304223224], [-0.814826435408141, 51.5818210214772], [-0.814485295861823, 51.581730356582035], [-0.81444044205173, 51.581790148477246], [-0.813566956536122, 51.581635656767844], [-0.813282023122958, 51.58154825394594], [-0.813052037332166, 51.581456910143594], [-0.812870182657061, 51.581346270732034], [-0.812790810356639, 51.58129061819263], [-0.812604263086127, 51.581138568732094], [-0.812386509085548, 51.58085492331321], [-0.812249092317067, 51.58070067277682], [-0.812167619564544, 51.58055957666617], [-0.812051961231651, 51.58029045130041], [-0.812042798783181, 51.580254391465495], [-0.812034433182585, 51.580187767648724], [-0.812033188044369, 51.58012481260171], [-0.812058064730261, 51.580000977815104], [-0.81229781440549, 51.579440518478464], [-0.812247901650195, 51.57941753400863], [-0.812446355706805, 51.57916777205078], [-0.81277233113049, 51.578787120404634], [-0.813191367818544, 51.57821318632392], [-0.813476583358647, 51.57767926033569], [-0.81372993476285, 51.57714950751218], [-0.813894821439398, 51.57669169369027], [-0.813998634879093, 51.57614064720803], [-0.814138744624452, 51.57508193151095], [-0.814120940539715, 51.57493428638376], [-0.81419874804071, 51.57321943977239], [-0.814492542549023, 51.572575897898666], [-0.814547744449169, 51.57211787423915], [-0.814549364628156, 51.57200009817749], [-0.81449843948966, 51.57157247390041], [-0.81447275908744, 51.57022974030085], [-0.814470739157426, 51.56964165674743], [-0.814429823166273, 51.56938407823071], [-0.814416473674158, 51.5693425811485], [-0.814362577800679, 51.569251219648685], [-0.81406844007837, 51.5689659058573], [-0.813908308238922, 51.56874308971205], [-0.813853532979604, 51.56863013877188], [-0.81375715260415, 51.56839717647337], [-0.81371284208748, 51.56815934527622], [-0.813667666933597, 51.567788426746645], [-0.813915408556528, 51.567527470860746], [-0.814280993234198, 51.56684059466537], [-0.814704823511867, 51.56613272518902], [-0.814994772052415, 51.56569055892733], [-0.815202529336662, 51.56519091397622], [-0.815219131565213, 51.56505170869626], [-0.815351636137841, 51.564671793906264], [-0.815511116853932, 51.56436408558186], [-0.815565592175225, 51.5642108755608], [-0.815662011458114, 51.564053592855515], [-0.815731002538058, 51.56389693250399], [-0.815762954470268, 51.56377766396064], [-0.815882314039101, 51.56307031436626], [-0.815899206541573, 51.563030920866616], [-0.815918960262566, 51.5629924554096], [-0.816100387305838, 51.56272812828101], [-0.816239061970809, 51.562387838558415], [-0.816351227865814, 51.56217946080997], [-0.816402225233145, 51.562104443964415], [-0.816445731089239, 51.56204014171416], [-0.816755073070336, 51.56173843863565], [-0.81682883069147, 51.5615089920632], [-0.81709149295673, 51.56100450196165], [-0.817126546068515, 51.5610435199925], [-0.817036868291134, 51.56144185218239], [-0.817602599672938, 51.56148891511105], [-0.817650902097453, 51.56129517879352], [-0.81772376875861, 51.56109989153342], [-0.818544773098936, 51.56114952106405], [-0.818940645385275, 51.56112652991029], [-0.819286252234888, 51.56087194248433], [-0.820505192935939, 51.560762809232635], [-0.821152924392013, 51.56109751750433], [-0.821401734784996, 51.56112699167495], [-0.821468077854438, 51.561127657861135], [-0.821837057068471, 51.56108460493917], [-0.822551882107614, 51.56083281445182], [-0.822991148836609, 51.56069335159132], [-0.823298868990794, 51.56056425765945], [-0.823427756279142, 51.560489119484224], [-0.823816316952276, 51.56018999039105], [-0.823841530161624, 51.56016326766115], [-0.823879440321637, 51.5600917131651], [-0.823939663402364, 51.55926686943448], [-0.824000930577316, 51.55924050793579], [-0.823876052668265, 51.55798579953388], [-0.823797968341331, 51.557154174451156], [-0.823813910366727, 51.55698348995032], [-0.824268965579194, 51.556733581409404], [-0.824612742777356, 51.55649154853787], [-0.826344281900068, 51.55484359477631], [-0.826657025878971, 51.55457337099326], [-0.827233265990788, 51.554040521447654], [-0.827929376968602, 51.55344502444081], [-0.828029419518581, 51.553368693973354], [-0.828246668974642, 51.55322159923911], [-0.828485269800709, 51.5530855074047], [-0.828605105979095, 51.55302466009866], [-0.829372820563392, 51.55267264797847], [-0.830416538296143, 51.552300003050114], [-0.830341853307235, 51.55217517181714], [-0.830015969895102, 51.55217192349864], [-0.82991663595149, 51.55216463892005], [-0.829524156953837, 51.55211486704629], [-0.829282415323888, 51.552092673855796], [-0.828838545910614, 51.55207835426137], [-0.828599504055965, 51.55206338004898], [-0.828680519991051, 51.55199764928292], [-0.828534433277995, 51.55195752639793], [-0.828384829125967, 51.55188589688778], [-0.827987906418731, 51.55167242458396], [-0.827957477145366, 51.551621766572], [-0.827834232346298, 51.55159086272802], [-0.827633977763617, 51.551525919798664], [-0.827259642164726, 51.55144395104261], [-0.826879262755715, 51.5513727108443], [-0.826619197529414, 51.551334143723224], [-0.825020961294276, 51.55117248609027], [-0.825087548806697, 51.55099511486544], [-0.825080332863119, 51.55093929339289], [-0.825041927300218, 51.55086247849746], [-0.82502361605882, 51.55078946149474], [-0.825044884876699, 51.55069166368164], [-0.825058487270179, 51.550667521970404], [-0.82509857658956, 51.550622964257876], [-0.825145597538488, 51.55058926609727], [-0.825325151596322, 51.5505056412203], [-0.824909915146001, 51.550164291306395], [-0.82525013660448, 51.550002248032946], [-0.825332063085088, 51.549957209837], [-0.825638185418255, 51.54977504214384], [-0.82578350044032, 51.54967668704559], [-0.825923116734683, 51.54957557721289], [-0.826170603160388, 51.54937393870707], [-0.826371785812396, 51.54917813090106], [-0.826492161334072, 51.549039961540565], [-0.826611394860751, 51.548890091280356], [-0.82670116630089, 51.54876420424681], [-0.826782355507479, 51.54863553380353], [-0.826823019292071, 51.54856850170786], [-0.827062757600335, 51.548106920435835], [-0.827101368877001, 51.54800749719491], [-0.827194201898492, 51.54770629998806], [-0.827307057244965, 51.54741159704493], [-0.827582602426052, 51.54684696658141], [-0.827901482950928, 51.54639156924703], [-0.828226190833503, 51.54604592938406], [-0.828636291311094, 51.545744301711125], [-0.82879259021163, 51.54566673370386], [-0.828904643767125, 51.545627388779295], [-0.829074413403866, 51.54558682127211], [-0.829642313890905, 51.54554213206049], [-0.831137752395514, 51.5457125947128], [-0.831296230672639, 51.545718668970665], [-0.831381409559054, 51.545715021306385], [-0.831520416985355, 51.54569302674314], [-0.831658465956176, 51.54565213966273], [-0.832162223002951, 51.54540897973132], [-0.832259763552867, 51.545373083913695], [-0.832342495362879, 51.54535232675641], [-0.832449690786029, 51.545333611293344], [-0.832560958333776, 51.54532482723805], [-0.832748224427793, 51.54533298427906], [-0.833594396864807, 51.5455158387706], [-0.833803468208608, 51.5455736658201], [-0.834066591719905, 51.54566080332341], [-0.834319302360527, 51.54576042533909], [-0.834632701147966, 51.545911902800114], [-0.834743597643834, 51.54597414830218], [-0.834972095381443, 51.546118487532766], [-0.835101437527799, 51.546192605160904], [-0.835308853525451, 51.54642845092972], [-0.835597379030446, 51.546650714213946], [-0.835675530378703, 51.54669644865621], [-0.835765285050956, 51.54673960061442], [-0.835946924814448, 51.54679895002405], [-0.836738145066418, 51.54693268079673], [-0.837616543696299, 51.54698454508781], [-0.837668585980954, 51.546979665457], [-0.837867989708348, 51.546964555807335], [-0.83797367625272, 51.54694851789646], [-0.838105566972017, 51.54692284834119], [-0.838233315283634, 51.54688994418392], [-0.838329229403341, 51.54686122067977], [-0.838482151664417, 51.546802489195365], [-0.839036827411148, 51.54642762424692], [-0.83955396219585, 51.54605418383688], [-0.840116011657223, 51.54567219327131], [-0.840736658187885, 51.54525391246058], [-0.840941426195899, 51.54514083988849], [-0.841049279937165, 51.54509604683764], [-0.841194847094701, 51.5450426342828], [-0.841299520083949, 51.545009498946165], [-0.841898633062652, 51.544870644649805], [-0.842282244574123, 51.54481328536381], [-0.842762474116396, 51.54475597844143], [-0.843565178344648, 51.54477737891959], [-0.844086979548171, 51.54484366398717], [-0.845732620874625, 51.545006428046236], [-0.847066038668597, 51.54519847249473], [-0.847735465249349, 51.545415455459946], [-0.84773690700669, 51.54541546961599], [-0.848634731053663, 51.54572550693968], [-0.849946581441456, 51.54620234699594], [-0.850255922443757, 51.54628810259981], [-0.850450510421732, 51.5463493547082], [-0.850677807173489, 51.54642891042725], [-0.850994850981171, 51.546552505063595], [-0.852786328510159, 51.547342426670774], [-0.85300310746802, 51.547496506935786], [-0.853571212311598, 51.54778799706584], [-0.854020445083318, 51.54798930492918], [-0.854581807452525, 51.548205193183556], [-0.85478620907829, 51.54827822314386], [-0.854963577157503, 51.54833660211785], [-0.855161244465997, 51.54839068294659], [-0.855663052553423, 51.5485088736389], [-0.856166529832507, 51.54867563412252], [-0.856279761006, 51.54870371304979], [-0.856530960852844, 51.54875111981111], [-0.856804082121709, 51.54878705024175], [-0.857112033920981, 51.54881432744164], [-0.857381573472553, 51.548820548731904], [-0.857549123049589, 51.54881049056259], [-0.857844479857821, 51.548764809719025], [-0.858057604662229, 51.54872012637499], [-0.858337617310588, 51.54865361386837], [-0.858552497890933, 51.54859635820055], [-0.859049392399301, 51.548450127924276], [-0.859439117962245, 51.5483792842905], [-0.859697682244768, 51.54836291412634], [-0.859779823131423, 51.54836551056866], [-0.860170027263243, 51.548390881318824], [-0.860456238387038, 51.54842243448379], [-0.861009536104037, 51.548500639150554], [-0.861158816462501, 51.54852906321894], [-0.861352413335375, 51.54857320311727], [-0.861544411683264, 51.54862362144007], [-0.861731905414109, 51.5486811891874], [-0.862073439754406, 51.548807688741114], [-0.86254414698236, 51.54901726458452], [-0.86282747298222, 51.54916477803516], [-0.863015068128655, 51.549276295417606], [-0.863120154717426, 51.549342054318615], [-0.863285809311142, 51.54946594721784], [-0.863418211576468, 51.54959311456195], [-0.863530092020445, 51.54973357070672], [-0.863653360363745, 51.549937978681236], [-0.863733641061499, 51.550131180181424], [-0.863790336700716, 51.5503448343906], [-0.863824973966162, 51.550691353426465], [-0.863841717303786, 51.55100353042492], [-0.863889686614544, 51.55116225019172], [-0.863971345177536, 51.55135816235228], [-0.864192531443895, 51.5518009005184], [-0.864636908176204, 51.552606367995786], [-0.864885616784935, 51.55304487507487], [-0.864984710926909, 51.55317801261536], [-0.865042267578469, 51.5532415116859], [-0.86524661818949, 51.553434113390985], [-0.866448255146234, 51.55464702695421], [-0.866553639357719, 51.55475954277147], [-0.86713929523259, 51.555454866418074], [-0.86728119491555, 51.55560729781788], [-0.867357192432134, 51.55568356216347], [-0.867846797612144, 51.55612348793147], [-0.867948777192819, 51.5561991033314], [-0.868039688780355, 51.55625572917072], [-0.868162193200772, 51.55631805467487], [-0.868334859667638, 51.55639345221028], [-0.868507816648064, 51.556457162985154], [-0.868686743286876, 51.556512838449954], [-0.868885971532242, 51.55656421341042], [-0.869870431325262, 51.55700170522159], [-0.870538382015661, 51.557289577406756], [-0.87065953954758, 51.55734829060127], [-0.870968323528286, 51.55751940747054], [-0.871084688448939, 51.55759695683154], [-0.871173919806704, 51.55766345498963], [-0.871421843971099, 51.55790412108149], [-0.871517352960249, 51.558008444760674], [-0.871560414081151, 51.55807539786269], [-0.871689483441928, 51.558339198343305], [-0.871715457861831, 51.558455441841], [-0.871819115572425, 51.558871857901316], [-0.872116688986198, 51.559438501590606], [-0.87224925001588, 51.559678057158926], [-0.872395481580982, 51.5598898694294], [-0.872503199025109, 51.56002578071336], [-0.872616797176149, 51.56015725249727], [-0.872767427555836, 51.560307962534345], [-0.873712440787397, 51.560887112412736], [-0.874019840047307, 51.56105730856152], [-0.874413245272104, 51.56124990894107], [-0.875159636577155, 51.56157807024888], [-0.875469862748955, 51.561692540724444], [-0.875618818634067, 51.561736229028845], [-0.87605776549836, 51.56183754414599], [-0.876366373823489, 51.56190074371407], [-0.87668521195865, 51.561958645316366], [-0.876968369886447, 51.56200091867397], [-0.877197163756339, 51.56202468778881], [-0.877516822654725, 51.5620493254706], [-0.878098847659676, 51.56208186543848], [-0.879220205739232, 51.56212315048378], [-0.879742407250114, 51.562124539056946], [-0.8803196812009, 51.56211566057546], [-0.88047709073344, 51.562109069498774], [-0.880781923890852, 51.5620912956137], [-0.881058065229737, 51.56206695318683], [-0.881262135404653, 51.56204012483733], [-0.881418631531618, 51.562011943580096], [-0.881649213834679, 51.56196288783239], [-0.882003250428868, 51.56187993977645], [-0.882376388095226, 51.56178278572967], [-0.882764299497775, 51.56167138432022], [-0.883194585739291, 51.561537905452155], [-0.883498576630078, 51.5614364931922], [-0.883756281221724, 51.56134003501421], [-0.884086956514705, 51.56120920221847], [-0.884407665982054, 51.56107287871968], [-0.885457870533961, 51.5606602434964], [-0.885606584631741, 51.56059601575753], [-0.88578613479336, 51.56050960117672], [-0.88595858283258, 51.56041862303493], [-0.886091760097573, 51.560340759581955], [-0.886521253482028, 51.56006159461465], [-0.886883345687433, 51.559824949307504], [-0.887389733197074, 51.559468282123994], [-0.887580604245187, 51.55927227271282], [-0.887708691217493, 51.559107139161064], [-0.888191015763102, 51.55861266662589], [-0.888192457957821, 51.55861268028735], [-0.888287760756616, 51.55849039596854], [-0.888562664893145, 51.558278995716826], [-0.888677108662246, 51.55814070717499], [-0.888887527216288, 51.55791161122132], [-0.889030158653071, 51.55774121885465], [-0.889203011709727, 51.557514464273005], [-0.88945350380216, 51.55717964382524], [-0.889600043815338, 51.556967026485395], [-0.889736358446423, 51.55670036168757], [-0.889858423154084, 51.55648571413559], [-0.889957478394766, 51.55626815130874], [-0.88999480235023, 51.556157006507235], [-0.890171676314085, 51.5555274577222], [-0.89040150985715, 51.554855248874496], [-0.891496918227321, 51.55316795557777], [-0.892148150167392, 51.55212836271704], [-0.892302414411729, 51.5517746441604], [-0.892679622502675, 51.55097074336506], [-0.892968782461996, 51.55046633574481], [-0.893655961353766, 51.54930928124159], [-0.894173495307085, 51.548604708475054], [-0.894625223197592, 51.54805597035748], [-0.895275002004698, 51.547308578527485], [-0.895581553072133, 51.54691762432374], [-0.89567259455686, 51.54679079793778], [-0.895853734572665, 51.54651645501248], [-0.896746527292651, 51.54508077321264], [-0.896901839906062, 51.544860136456265], [-0.897255891587921, 51.54494888564188], [-0.898115394177492, 51.545187148067974], [-0.89822539056202, 51.54523044209882], [-0.898280925208036, 51.54525973711452], [-0.898317695099433, 51.54528975512979], [-0.898473190139101, 51.54530020648797], [-0.899619101095523, 51.54544313546729], [-0.901006352145532, 51.54562517973134], [-0.901825064903737, 51.54570208025918], [-0.903152296119515, 51.54586195719927], [-0.903215411109321, 51.54587603470979], [-0.903297183099556, 51.545893883241035], [-0.903017403675823, 51.54655396139701], [-0.902616538461231, 51.54745118838641], [-0.902395351374664, 51.54801290343283], [-0.902224993241029, 51.54837997226972], [-0.902166365216381, 51.54859882282856], [-0.902146545476892, 51.54876318664974], [-0.902208891983797, 51.54892921824649], [-0.902230894835185, 51.549033728477525], [-0.902380735585514, 51.54999904656443], [-0.902673692529055, 51.551610411429984], [-0.902806620567669, 51.55250003963136], [-0.902816651036337, 51.55268266601908], [-0.902804979597758, 51.55292803179951], [-0.902756997764027, 51.55318384821566], [-0.902654701329301, 51.55353896524768], [-0.902427419928527, 51.55423280167036], [-0.901847751389036, 51.555843197130926], [-0.901770133963284, 51.556011515784924], [-0.90172081219273, 51.556082988265544], [-0.902203201151337, 51.55617741874876], [-0.906010818638152, 51.55679743475821], [-0.906204734572883, 51.556771367660915], [-0.906311884484255, 51.55675438267928], [-0.906358975073264, 51.55689599188705], [-0.90638590166065, 51.55691602462513], [-0.906615524939952, 51.55696492104195], [-0.907278267614382, 51.55705831304524], [-0.907858939004531, 51.55720578727805], [-0.908174621569804, 51.5572752632291], [-0.908339760107985, 51.55730647205926], [-0.908420198492941, 51.557320707807335], [-0.908923514869315, 51.557385632424236], [-0.909322889103033, 51.5574540848968], [-0.909506497855653, 51.557497152980005], [-0.909658336207082, 51.557541723987356], [-0.909754316957776, 51.55756959081508], [-0.909871264277585, 51.557625526703404], [-0.91002439519459, 51.55767640345812], [-0.91014009429463, 51.557724234915874], [-0.910363938659539, 51.55783421414451], [-0.910769828656022, 51.55805288423369], [-0.910899633150579, 51.55817457810929], [-0.911134211672749, 51.55843931338367], [-0.911191431662737, 51.558519870694006], [-0.911262279817118, 51.55863382382822], [-0.911345597527786, 51.558829717406], [-0.911347039740573, 51.55882973078292], [-0.911354152248679, 51.55895478193117], [-0.911501156990394, 51.55932300828838], [-0.911744284152759, 51.55977395051585], [-0.911784714781588, 51.55983277167005], [-0.911848028397377, 51.559899897522016], [-0.911951124589094, 51.55999256899618], [-0.912043240814804, 51.56006176008463], [-0.912343203354435, 51.560247072388215], [-0.91252735254784, 51.560389049785144], [-0.912663001694362, 51.56050809825428], [-0.913644040185922, 51.561715780647766], [-0.914729932802775, 51.56149024267299], [-0.915936249212879, 51.561720788632314], [-0.917099342153636, 51.56255696600573], [-0.917716153850379, 51.56209778262442], [-0.918510926061236, 51.561494569835055], [-0.919190082061234, 51.56187308324347], [-0.919265061021478, 51.56187467281339], [-0.919319677161742, 51.561883268238525], [-0.919395565855925, 51.56190734542486], [-0.919450182060758, 51.561915940789575], [-0.919451624375034, 51.56191595406745], [-0.919612764956992, 51.561873377936905], [-0.919684473323871, 51.562134798108005], [-0.919731696029427, 51.56227280618616], [-0.919795125391412, 51.562396576626476], [-0.919877773921036, 51.56250074208832], [-0.920024454979703, 51.56264236275641], [-0.920273793481437, 51.562835281288635], [-0.920455811890565, 51.56300779833283], [-0.92054707457537, 51.56311384087594], [-0.920622684574115, 51.56321074767881], [-0.920768557091237, 51.56344767224896], [-0.920815933327546, 51.56357938704838], [-0.92087756775181, 51.56365728255545], [-0.920897207761338, 51.56368084160506], [-0.920950783915168, 51.5637334861553], [-0.921113636188415, 51.563862665653886], [-0.921195103215065, 51.56395602921301], [-0.921351882125165, 51.56422002842434], [-0.921395592904906, 51.56432383493418], [-0.921420893006769, 51.56441308549212], [-0.921438619701684, 51.56451755238376], [-0.921413985191466, 51.56464410933019], [-0.92167481147157, 51.56453500840272], [-0.923479752756133, 51.56373602685831], [-0.924155377789785, 51.5634113259626], [-0.924873111301507, 51.56399247344971], [-0.924951149378637, 51.56404803772923], [-0.925274524870032, 51.56428388466152], [-0.92664770764064, 51.56515336065692], [-0.927393574791524, 51.56558368874587], [-0.927927453464337, 51.5659491340051], [-0.92835633038721, 51.56599441223158], [-0.928244524844939, 51.56725223174753], [-0.928125342518282, 51.56741209518939], [-0.9281054698832, 51.56745956981058], [-0.927839528670842, 51.568092855254655], [-0.93052584537502, 51.568532778436946], [-0.930434864440691, 51.56872077542371], [-0.930290537945866, 51.568968530677175], [-0.93032458943141, 51.568993118606556], [-0.930407160146686, 51.56904062792432], [-0.930494248489543, 51.56908008580425], [-0.93056005729139, 51.5691040638391], [-0.930644619283805, 51.56912821268005], [-0.930755210497826, 51.569149901051155], [-0.931002865082897, 51.56917193845677], [-0.931506345671459, 51.5692367670135], [-0.9319179887186, 51.56928007686346], [-0.93222706378822, 51.569328746497334], [-0.932389335623021, 51.56936169347699], [-0.932508352034028, 51.56939334769875], [-0.932608510110525, 51.56942932617174], [-0.932871163025979, 51.56955040480943], [-0.933086053531851, 51.569616199317096], [-0.933414865356232, 51.569684826955594], [-0.93386895042082, 51.56976448240679], [-0.934635570791928, 51.5700537823344], [-0.934785550106084, 51.57011898456062], [-0.934985327167408, 51.57021431104797], [-0.935122135234023, 51.5702874858722], [-0.935333952219633, 51.570423383659445], [-0.935683954424458, 51.570697207984594], [-0.935948857561102, 51.57084617434456], [-0.936321009353978, 51.57109861741231], [-0.936776166293208, 51.57138058458356], [-0.936874033955222, 51.57139136186155], [-0.937185388877335, 51.57140497135624], [-0.937358713203379, 51.57139754881963], [-0.937474500211682, 51.571382411871916], [-0.937604964789291, 51.57135661760672], [-0.938082770631526, 51.571224267138255], [-0.938303744516349, 51.57115343316592], [-0.938622419406116, 51.57103852370375], [-0.938583754985448, 51.57127375671787], [-0.938615426417796, 51.5714008261012], [-0.938651384040882, 51.57152973256723], [-0.938810396393867, 51.572013125409214], [-0.938917102284257, 51.5723881447753], [-0.938977920287056, 51.572564931845086], [-0.939147081147104, 51.57298457478389], [-0.93921529881351, 51.57340150695511], [-0.939295227462625, 51.57374930879435], [-0.939359853061118, 51.57401065198471]]]}}
benchmarks/json-data/integers.jsondeleted−1
@@ -1 +0,0 @@
1−[1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 2, 2, 2, 2, 2, 2, 2, 3, 3, 3, 3, 3, 4, 4, 4, 4, 5, 5, 5, 6, 6, 7, 7, 7, 8, 9, 9, 10, 10, 11, 12, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 23, 24, 26, 27, 29, 31, 33, 35, 37, 39, 42, 44, 47, 50, 53, 56, 60, 63, 67, 72, 76, 81, 86, 91, 96, 102, 109, 115, 122, 130, 138, 146, 155, 165, 175, 186, 197, 209, 222, 236, 250, 266, 282, 299, 318, 337, 358, 380, 403, 428, 454, 482, 511, 543, 576, 611, 649, 688, 730, 775, 823, 873, 926, 983, 1043, 1107, 1175, 1247, 1323, 1404, 1490, 1582, 1679, 1781, 1890, 2006, 2129, 2259, 2398, 2544, 2700, 2865, 3041, 3227, 3425, 3634, 3857, 4093, 4343, 4609, 4891, 5191, 5509, 5846, 6204, 6583, 6986, 7414, 7868, 8349, 8860, 9403, 9978, 10589, 11237, 11925, 12655, 13430, 14252, 15124, 16050, 17032, 18075, 19181, 20355, 21601, 22923, 24326, 25815, 27396, 29072, 30852, 32740, 34744, 36871, 39128, 41523, 44064, 46762, 49624, 52661, 55884, 59305, 62935, 66787, 70875, 75213, 79817, 84702, 89887, 95389, 101227, 107423, 113998, 120976, 128381, 136239, 144578, 153427, 162818, 172784, 183360, 194583, 206493, 219132, 232545, 246778, 261883, 277912, 294923, 312975, 332131, 352460, 374034, 396928, 421223, 447005, 474365, 503400, 534212, 566911, 601610, 638433, 677511, 718980, 762987, 809688, 859247, 911840, 967652, 1026880, 1089734, 1156434, 1227217, 1302333, 1382046, 1466638, 1556408, 1651673, 1752769, 1860052, 1973902, 2094721, 2222934, 2358996, 2503385, 2656613, 2819219, 2991777, 3174898, 3369227, 3575451, 3794297, 4026539, 4272995, 4534536, 4812086, 5106625, 5419191, 5750889, 6102889, 6476435, 6872845, 7293518, 7739939, 8213686, 8716429, 9249944, 9816115, 10416939, 11054539, 11731166, 12449207, 13211198, 14019829, 14877955, 15788605, 16754994, 17780533, 18868844, 20023768, 21249383, 22550016, 23930257, 25394980, 26949356, 28598872, 30349352, 32206975, 34178300, 36270285, 38490317, 40846232, 43346349, 45999492, 48815029, 51802899, 54973651, 58338478, 61909260, 65698602, 69719882, 73987297, 78515911, 83321713, 88421668, 93833782, 99577160, 105672079, 112140056, 119003924, 126287916, 134017747, 142220706, 150925751, 160163614, 169966908, 180370243, 191410345, 203126189, 215559137, 228753081, 242754599, 257613123, 273381107, 290114218, 307871529, 326715729, 346713346, 367934976, 390455540, 414354543, 439716356, 466630515, 495192035, 525501749, 557666661, 591800322, 628023236, 666463282, 707256166, 750545902, 796485316, 845236589, 896971830, 951873682, 1010135966, 1071964368, 1137577163, 1207205986, 1281096650, 1359510014, 1442722903, 1531029087, 1624740315, 1724187420, 1829721484, 1941715077, 2060563573, 2186686548, 2320529259, 2462564214, 2613292844, 2773247272, 2942992191, 3123126858, 3314287206, 3517148098, 3732425698, 3960880011, 4203317554, 4460594215, 4733618266, 5023353573, 5330822998, 5657112012, 6003372524, 6370826950, 6760772526, 7174585891, 7613727944, 8079749004, 8574294281, 9099109685, 9656047991, 10247075377, 10874278366, 11539871197, 12246203633, 12995769265, 13791214310, 14635346955, 15531147272, 16481777734, 17490594386, 18561158687, 19697250088, 20902879371, 22182302812, 23540037202, 24980875800, 26509905246, 28132523526, 29854459026, 31681790754, 33620969802, 35678842122, 37862672691, 40180171161, 42639519077, 45249398761, 48019023960, 50958172379, 54077220194, 57387178688, 60899733121, 64627283986, 68582990784, 72780818484, 77235586822, 81963022620, 86979815309, 92303675844, 97953399235, 103948930895, 110311437058, 117063379497, 124228594829, 131832378662, 139901574895, 148464670491, 157551896043, 167195332496, 177429024407, 188289100133, 199813899374, 212044108527, 225022904322, 238796106249, 253412338321, 268923200725, 285383451995, 302851202324, 321388118716, 341059642687, 361935221296, 384088552321, 407597844432, 432546093294, 459021374572, 487117154867, 516932621682, 548573033590, 582150091830, 617782334651, 655595555791, 695723248569, 738307077168, 783497376747, 831453684183, 882345301285, 936351892486, 993664119121, 1054484312524, 1119027188325, 1187520604468, 1260206365627, 1337341076854, 1419197049486, 1506063262491, 1598246382662, 1696071847252, 1799885012878, 1910052374747, 2026962860500, 2151029203266, 2282689398739, 2422408251457, 2570679015712, 2728025136906, 2895002099486, 3072199387991, 3260242568131, 3459795495242, 3671562657914, 3896291665080, 4134775885316, 4387857247705, 4656429214122, 4941439933460, 5243895588908, 5564863950114, 5905478142772, 6266940648935, 6650527552175, 7057593042589, 7489574197539, 7947996055022, 8434476997558, 8950734465625, 9498591020797, 10079980779998, 10696956243580, 11351695541337, 12046510122031, 12783852913581, 13566326982715, 14396694724673, 15277887615381, 16213016560543, 17205382878181, 18258489953389, 19376055606456, 20562025218016, 21820585657560, 23156180064488, 24573523533875, 26077619762337, 27673778712750, 29367635360200, 31165169585327, 33072727285306, 35097042776985, 37245262571278, 39524970602741, 41944215003394, 44511536515321, 47235998642351, 50127219647252, 53195406507421, 56451390948928, 59906667686130, 63573435001862, 67464637811456, 71594013362620, 75976139732519, 80626487293267, 85561473327514, 90798519986944, 96356115798305, 102253880934088, 108512636478302, 115154477931865, 122202853217119, 129682645456833, 137620260819954, 146043721744222, 154982765864743, 164468950997792, 174535766550465, 185218751749486, 196555621106568, 208586397563259, 221353553785311, 234902162105402, 249280053643550, 264537987166964, 280729828285480, 297912739615178, 316147382581544, 335498131574595, 356033301212013, 377825387512598, 400951323831468, 425492752460545, 451536312853150, 479173947490266, 508503226468250, 539627691953919, 572657223723034, 607708427072674, 644905044476938, 684378392439283, 726267825083707, 770721226121430, 817895530929871, 867957280587026, 921083209817197, 977460870923688, 1037289295911185, 1100779699135317, 1168156222959992, 1239656729054927, 1315533638126921, 1396054821049394, 1481504544536185, 1572184474698156, 1668414742025481, 1770535071555377, 1878905982215138, 1993910059574563, 2115953306501003, 2245466576485316, 2382907094698829, 2528760072151156, 2683540418647385, 2847794560591953]
benchmarks/json-data/jp10.jsondeleted−1
@@ -1 +0,0 @@
1−{"results":[{"from_user_id_str":"2458313","profile_image_url":"http://a2.twimg.com/profile_images/1203653060/fure091226_normal.png","created_at":"Thu, 27 Jan 2011 20:30:04 +0000","from_user":"19princess","id_str":"30724239224995840","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6d77\u6674\u300c\u672c\u65e5\u306e\u6771\u4eac\u306e\u304a\u5929\u6c17\u306f\u6674\u6642\u3005\u66c7\u3067\u3057\u3087\u3046\u3002\u6700\u9ad8\u6c17\u6e29\u306f8\u5ea6\u3001\u6700\u4f4e\u6c17\u6e29\u306f1\u5ea6\u3067\u3059\u3002\u3042\u306a\u305f\u306e\u4eca\u65e5\u306e\u4eba\u751f\u306b\u3068\u3073\u3063\u304d\u308a\u306e\u304a\u5929\u6c17\u3092\u2665\u300d","id":30724239224995840,"from_user_id":2458313,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://babyprincess.sakura.ne.jp/about/&quot; rel=&quot;nofollow&quot;&gt;\u5929\u4f7f\u5bb6\u306e\u88cf\u5c71&lt;/a&gt;"},{"from_user_id_str":"66578965","profile_image_url":"http://a0.twimg.com/profile_images/1183763267/fossetta_normal.png","created_at":"Thu, 27 Jan 2011 20:00:04 +0000","from_user":"Fossetta_Tokyo","id_str":"30716689779785729","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u304a\u306f\u3088\u3046\u3054\u3056\u3044\u307e\u3059!!\u6771\u4eac\u90fd\u3001\u672c\u65e5\u306e\u304a\u5929\u6c17\u306f\u6674\u6642\u3005\u66c7\u3002\u6700\u9ad8\u6c17\u6e298\u5ea6\u3001\u6700\u4f4e\u6c17\u6e291\u5ea6\u3002\u6771\u4eac\u5730\u65b9\u3067\u306f\u3001\u7a7a\u6c17\u306e\u4e7e\u71e5\u3057\u305f\u72b6\u614b\u304c\u7d9a\u3044\u3066\u3044\u307e\u3059\u3002\u706b\u306e\u53d6\u308a\u6271\u3044\u306b\u6ce8\u610f\u3057\u3066\u4e0b\u3055\u3044\u3002\u4f0a\u8c46\u8af8\u5cf6\u3068\u5c0f\u7b20\u539f\u8af8\u5cf6\u306b\u306f\u3001\u5f37\u98a8\u3001\u6ce2\u6d6a\u3001\u4e7e\u71e5\u3001\u971c\u306e\u6ce8\u610f\u5831\u3092\u767a\u8868\u4e2d\u3067\u3059\u3002","id":30716689779785729,"from_user_id":66578965,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://bit.ly/Fossetta&quot; rel=&quot;nofollow&quot;&gt;\u30d5\u30a9\u30bb\u30c3\u30bf ver.3.1.1&lt;/a&gt;"},{"from_user_id_str":"104041146","profile_image_url":"http://a2.twimg.com/profile_images/863965118/001jwatokyo_normal.jpg","created_at":"Thu, 27 Jan 2011 19:44:33 +0000","from_user":"jwa_tokyo","id_str":"30712787537756160","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6c17\u8c61\u5e81\u304b\u3089\u6771\u4eac\u306e\u5929\u6c17\u4e88\u5831\u304c\u767a\u8868\u3055\u308c\u307e\u3057\u305f\u3000\u305d\u306e\u5929\u6c17\u4e88\u5831\u3092\u3053\u3053\u3067\u3064\u3076\u3084\u3053\u3046\u304b\u306a\u3041\uff5e\uff1f\u3000\u8003\u3048\u4e2d\u3000\u307e\u3066\u6b21\u53f7\uff08\u7b11","id":30712787537756160,"from_user_id":104041146,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.docodemo.jp/twil/&quot; rel=&quot;nofollow&quot;&gt;Twil2 (Tweet Anytime, Anywhere by Mail)&lt;/a&gt;"},{"from_user_id_str":"144500192","profile_image_url":"http://a3.twimg.com/a/1294874399/images/default_profile_3_normal.png","created_at":"Thu, 27 Jan 2011 18:59:33 +0000","from_user":"kyo4to4","id_str":"30701462774358016","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u90fd \u516b\u4e08\u5cf6 - \u4eca\u65e5\u306e\u5929\u6c17\u306f\u30fb\u30fb\u30fb\u66c7\u306e\u3061\u6674\u3067\u3059\u306e\uff01","id":30701462774358016,"from_user_id":144500192,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/kyo4to4&quot; rel=&quot;nofollow&quot;&gt;lost-sheep-bot&lt;/a&gt;"},{"from_user_id_str":"165724582","profile_image_url":"http://a0.twimg.com/profile_images/1222842347/163087_1256281064506_1753997852_484926_2761052_n_normal.jpg","created_at":"Thu, 27 Jan 2011 17:39:06 +0000","from_user":"Rifqi_19931020","id_str":"30681213748387840","metadata":{"result_type":"recent"},"to_user_id":113796067,"text":"@CHLionRagbaby \u30b1\u30f3\u3061\u3083\u3093\u3001\u671d\u4eca\u307e\u3067\u306e\u81ea\u5206\u306e\u30db\u30fc\u30e0\u30a8\u30ea\u30a2\u304b\u3089\u307e\u3060\u975e\u5e38\u306b\u5bd2\u3044\u3068\u96e8\u304c\u964d\u3063\u3066\u3044\u305f..\u3069\u306e\u3088\u3046\u306b\u73fe\u5728\u306e\u6771\u4eac\u306e\u5929\u6c17\uff1f","id":30681213748387840,"from_user_id":165724582,"to_user":"CHLionRagbaby","geo":null,"iso_language_code":"ja","to_user_id_str":"113796067","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"120911929","profile_image_url":"http://a0.twimg.com/profile_images/772435076/20100312___capture2_normal.png","created_at":"Thu, 27 Jan 2011 17:28:30 +0000","from_user":"Cirno_fan","id_str":"30678546020040705","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u65e5\u306e\u6771\u4eac\u306e\u5929\u6c17\u306f\u3001\u66c7\u6642\u3005\u6674\u3067\u6700\u9ad8\u6c17\u6e29\u306f8\u2103\uff01 \u6700\u4f4e\u6c17\u6e29\u306f2\u2103\u3060\u3063\u305f\u3088\uff01 RT @mimi22999 \uff08\uff65\u2200\uff65\uff09\uff4c\u3001\u865a\u5f31\u306a\u8005\u306b\u3068\u3063\u3066\u3001\u6717\u3089\u304b\u306a\u9854\u306f\u4e0a\u5929\u6c17\u3068\u540c\u3058\u304f\u3089\u3044\u3046\u308c\u3057\u3044\u3082\u306e\u3060\u3002\u30d5\u30e9\u30f3\u30af\u30ea\u30f3 #tenki #bot","id":30678546020040705,"from_user_id":120911929,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://blog.livedoor.jp/fairycirno/archives/34686.html&quot; rel=&quot;nofollow&quot;&gt;\u5e7b\u60f3\u90f7 \u9727\u306e\u6e56&lt;/a&gt;"},{"from_user_id_str":"65976527","profile_image_url":"http://a0.twimg.com/profile_images/452810990/little_italies_____normal.jpg","created_at":"Thu, 27 Jan 2011 17:00:03 +0000","from_user":"heta_weather01","id_str":"30671388754845696","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u30d8\u30bf\u5929\u3011Tere hommikust.\u30a8\u30b9\u30c8\u30cb\u30a2\u3067\u3059\u3002\u4eca\u65e5\u306e\u6771\u4eac\u306e\u5929\u6c17\u306f\u6674\u6642\u3005\u66c7\u3067\u660e\u65e5\u306f\u66c7\u308a\u3067\u3059\u3002\u3061\u306a\u307f\u306b\u50d5\u306e\u3068\u3053\u308d\u3067\u306f\u66c7\u308a\u3067\u6c17\u6e29-7\u2103\u3067\u3059\u3002\u3061\u306a\u307f\u306b\u30b9\u30ab\u30a4\u30d7\u306e\u958b\u767a\u672c\u90e8\u306f\u50d5\u306e\u5bb6\u306b\u3042\u308b\u3093\u3067\u3059\u3002","id":30671388754845696,"from_user_id":65976527,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www15.atpages.jp/~kageyanma/&quot; rel=&quot;nofollow&quot;&gt;\u5730\u7403\u306e\u4e2d&lt;/a&gt;"},{"from_user_id_str":"7278433","profile_image_url":"http://a3.twimg.com/profile_images/1218965303/michael-1_normal.png","created_at":"Thu, 27 Jan 2011 16:50:16 +0000","from_user":"shimohiko","id_str":"30668926035689472","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3042\u308a\u3002\n\u3010\u7f8e\u4eba\u5929\u6c17/\u6771\u4eac\u3011\u7f8e\u4eba\u5929\u6c17\u30ad\u30e3\u30b9\u30bf\u30fc\u306e&quot;\u3055\u3042\u3084\u3093\u3055\u3093&quot;\u306b\u3088\u308b\u3068\u300c1/29(\u571f)\u306f\u304f\u3082\u308a\u3067\u3001\u964d\u6c34\u78ba\u738740%\u3001\u6700\u9ad8\u6c17\u6e29\u306f6\u2103\u3067\u6700\u4f4e\u6c17\u6e29\u306f1\u2103\u3067\u3059\u300d\u7f8e\u4eba\u5929\u6c17\u21d2http://bit.ly/djB8th http://twitpic.com/3twnl0 #bt_tenki","id":30668926035689472,"from_user_id":7278433,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://bijintenki.jp&quot; rel=&quot;nofollow&quot;&gt;bijintenki.jp&lt;/a&gt;"},{"from_user_id_str":"61770","profile_image_url":"http://a3.twimg.com/profile_images/1206955079/tw172a_normal.png","created_at":"Thu, 27 Jan 2011 16:40:52 +0000","from_user":"rsky","id_str":"30666561853333504","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3075\u3068\u591c\u7a7a\u3092\u898b\u4e0a\u3052\u3066\u30aa\u30ea\u30aa\u30f3\u304c\u898b\u3048\u306a\u304f\u3066\u300c\u6771\u4eac\u306b\u306f\u7a7a\u304c\u306a\u3044\u300d\u3068\u667a\u6075\u5b50\u306e\u3088\u3046\u306a\u3053\u3068\u3092\u601d\u3063\u305f\u308f\u3051\u3060\u304c\u3001\u305f\u3076\u3093\u534a\u5206\u3050\u3089\u3044\u306f\u5929\u6c17\u306e\u305b\u3044\u3067\u3059","id":30666561853333504,"from_user_id":61770,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.hootsuite.com&quot; rel=&quot;nofollow&quot;&gt;HootSuite&lt;/a&gt;"},{"from_user_id_str":"103259265","profile_image_url":"http://a0.twimg.com/profile_images/767857973/anime_icon_normal.gif","created_at":"Thu, 27 Jan 2011 16:37:42 +0000","from_user":"liveshowonly","id_str":"30665765698928640","metadata":{"result_type":"recent"},"to_user_id":null,"text":"iPhone\u5929\u6c17\u3002\u6771\u4eac4\u2103\u3063\u3066\u7d50\u69cb\u5bd2\u304f\u306a\u3044\u3058\u3083\u3093\u3002\uff08\u78ba\u304b\u306b\u3082\u306e\u51c4\u304f\u5bd2\u3044\u8a33\u3067\u306f\u7121\u3044\uff09\u3002\u798f\u5ca1\u5e02\u306f1\u2103\u3060\u3002\u52dd\u3061\u3060\u305c\u3002Rock'n'roll","id":30665765698928640,"from_user_id":103259265,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"165242761","profile_image_url":"http://a1.twimg.com/profile_images/1147334744/SN3E00600001_normal.jpg","created_at":"Thu, 27 Jan 2011 16:37:35 +0000","from_user":"deuxavril0502","id_str":"30665736556912640","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6b8b\u5ff5\u3001\u79c1\u306f\u6c96\u7e04\u3067\u3059(&gt;_&lt;)\u3067\u3082\u304a\u5929\u6c17\u826f\u3055\u305d\u3046\u3067\u826f\u304b\u3063\u305f\u306d\u3002\u3053\u3061\u3089\u306f\u96e8\u3088\uff5eRT @rinandy2010: \u305d\u3046\u3067\u3059\u3063\u266a\u51fa\u5f35\u3067(^^)\u304a\u306d\u3048\u3055\u307e\u306f\u6771\u4eac\u3067\u3059\u304b\uff1f\u3081\u3063\u3061\u3083\u5929\u6c17\u826f\u304f\u3066\u3073\u3063\u304f\u308a\u3067\u3059\u3002\u624b\u888b\u3068\u304b\u5168\u7136\u3044\u3089\u306a\u3044\u3067\u3059\u306d\u30fc RT @deuxavril0502 \u6771\u4eac\u306a\u306e\u30fc\uff1f","id":30665736556912640,"from_user_id":165242761,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.echofon.com/&quot; rel=&quot;nofollow&quot;&gt;Echofon&lt;/a&gt;"},{"from_user_id_str":"163900288","profile_image_url":"http://a1.twimg.com/profile_images/1210224823/icon12945064955238_normal.jpg","created_at":"Thu, 27 Jan 2011 16:24:37 +0000","from_user":"nyao_yurichan","id_str":"30662472734089216","metadata":{"result_type":"recent"},"to_user_id":100985873,"text":"@ray_ko302 \u767a\u898b\u3042\u308a\u304c\u3068\u3067\u3059\u3045\u3002\u3053\u3061\u3089\u3067\u3082\u3088\u308d\u3057\u304f\u306d\u3002\u6771\u4eac\u306f\u4eca\u65e5\u3082\u4e7e\u71e5\u3067\u5927\u5909\u3088\u3002\u305d\u3063\u3061\u3068\u771f\u9006\u306e\u5929\u6c17\u3060\u306d\u3002\u30a2\u30a4\u30b9\u30d0\u30fc\u30f3\u304d\u3092\u3064\u3051\u3066\u3088\u306d\u3002","id":30662472734089216,"from_user_id":163900288,"to_user":"ray_ko302","geo":null,"iso_language_code":"ja","to_user_id_str":"100985873","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"49227098","profile_image_url":"http://a3.twimg.com/profile_images/965007882/____normal.jpg","created_at":"Thu, 27 Jan 2011 15:52:26 +0000","from_user":"dosannko6","id_str":"30654371016478720","metadata":{"result_type":"recent"},"to_user_id":108570870,"text":"@peke_hajiP \u4ffa\u304c\u6771\u4eac \u6765\u3066\u6700\u521d\u306b\u9a5a\u3044\u305f\u306e\u304c\u3001\u5929\u6c17\u4e88\u5831\u3067\u82b1\u7c89\u60c5\u5831\u304c\u6d41\u308c\u308b\u3053\u3068\u3067\u3001\u6700\u521d\u306b\u8a66\u3057\u305f\u306e\u304c \u30b4\u30ad\u69d8 \u53ec\u559a\u306e\u5100\u5f0f\u3067\u3059\u304a\uff1f","id":30654371016478720,"from_user_id":49227098,"to_user":"peke_hajip","geo":null,"iso_language_code":"ja","to_user_id_str":"108570870","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"71148934","profile_image_url":"http://a0.twimg.com/profile_images/1209223630/image_normal.jpg","created_at":"Thu, 27 Jan 2011 15:46:49 +0000","from_user":"123keiko","id_str":"30652958311981058","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u9727\u5cf6\u306e\u964d\u7070\u306e\u30cb\u30e5\u30fc\u30b9\u3092\u898b\u3066\u601d\u3044\u51fa\u3057\u307e\u3057\u305f\u3002\u4e0a\u4eac\u3057\u305f\u59cb\u3081\u306e\u9803\u3001\u6771\u4eac\u306f1\u5e74\u4e2d\u3001\u7070\u304c\u964d\u3089\u306a\u3044\u304b\u3089\u7a7a\u6c17\u304c\u6f84\u3093\u3067\u3066\u904e\u3054\u3057\u3084\u3059\u3044\u306a\u3041\u3001\u3068\u601d\u3063\u305f\u306a\u3041\u3001\u3063\u3066\u3002\n\u5b9f\u5bb6\u306f\u51ac\u306e\u5b63\u7bc0\u98a8\u3067\u685c\u5cf6\u306e\u7070\u304c\u964d\u308b\u5730\u533a\u3067\u3057\u305f\u3002\u9e7f\u5150\u5cf6\u306e\u5929\u6c17\u4e88\u5831\u3067\u306f\u3001\u6bce\u65e5\u3001\u685c\u5cf6\u4e0a\u7a7a\u306e\u98a8\u5411\u304d\u4e88\u5831\u304c\u3067\u307e\u3059\u3002\u3053\u308c\u304b\u3089\u306f\u9727\u5cf6\u3082\u304b\u306a\uff1f","id":30652958311981058,"from_user_id":71148934,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"91124773","profile_image_url":"http://a3.twimg.com/profile_images/1139308356/prof101007_3-1_normal.jpg","created_at":"Thu, 27 Jan 2011 15:43:35 +0000","from_user":"sanposuruhito","id_str":"30652146277945345","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u5bb5\u306e\u90fd\u5fc3\u306f\u3001\u8eab\u3082\u5f15\u304d\u7de0\u307e\u308b\u3068\u3044\u3046\u3088\u308a\u306f\u51cd\u3048\u308b\u7a0b\u306e\u51b7\u6c17\u3092\u611f\u3058\u308b\u5bd2\u3044\u591c\u3067\u3059\u3002\u660e\u65e5\u65e5\u4e2d\u306e\u6771\u4eac\u306e\u5929\u6c17\u306f\u3001\u5915\u65b9\u306b\u591a\u5c11\u96f2\u304c\u51fa\u308b\u5834\u6240\u304c\u3042\u308a\u305d\u3046\u306a\u3082\u306e\u306e\u6982\u306d\u6674\u308c\u7a7a\u304c\u5e83\u304c\u308a\u7d9a\u3051\u305d\u3046\u3067\u3059\u3002\u6700\u9ad8\u6c17\u6e29\u306f\u30015-6\u5ea6\u4f4d\u3068\u306a\u308a\u305d\u3046\u3067\u3059\u3002#weather_tokyo","id":30652146277945345,"from_user_id":91124773,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://projects.playwell.jp/go/Saezuri&quot; rel=&quot;nofollow&quot;&gt;Saezuri&lt;/a&gt;"}],"max_id":30724239224995840,"since_id":28179956995457024,"refresh_url":"?since_id=30724239224995840&q=%E6%9D%B1%E4%BA%AC%E3%80%80%E5%A4%A9%E6%B0%97","next_page":"?page=2&max_id=30724239224995840&lang=ja&q=%E6%9D%B1%E4%BA%AC%E3%80%80%E5%A4%A9%E6%B0%97","results_per_page":15,"page":1,"completed_in":0.104827,"warning":"adjusted since_id to 28179956995457024 (), requested since_id was older than allowed -- since_id removed for pagination.","since_id_str":"28179956995457024","max_id_str":"30724239224995840","query":"%E6%9D%B1%E4%BA%AC%E3%80%80%E5%A4%A9%E6%B0%97"}
benchmarks/json-data/jp100.jsondeleted−1
@@ -1 +0,0 @@
1−{"results":[{"from_user_id_str":"178045354","profile_image_url":"http://a0.twimg.com/profile_images/1214479381/154722_10100141954893059_808622_55276626_7445050_n_normal.jpg","created_at":"Fri, 25 Feb 2011 17:40:04 +0000","from_user":"ChuriSta_gt","id_str":"41190705623732224","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3072\u3089\u304c\u306a\u306e\u300c\u3064\u300d\u306f\u3082\u3046Twitter\u306e\u300c\u3064\u300d\u3060\uff01","id":41190705623732224,"from_user_id":178045354,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twipple.jp/&quot; rel=&quot;nofollow&quot;&gt;\u3064\u3044\u3063\u3077\u308b for iPhone&lt;/a&gt;"},{"from_user_id_str":"71746558","profile_image_url":"http://a2.twimg.com/profile_images/591641547/wwd_normal.gif","created_at":"Fri, 25 Feb 2011 17:40:02 +0000","from_user":"fuckkilldiestar","id_str":"41190699571494912","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u306b\u3057\u3066\u3082Twitter\u3084pixiv\u96e2\u308c\u3092\u3069\u3046\u306b\u304b\u3057\u308d\u674f\u4ec1\u30d6\u30eb\u30de","id":41190699571494912,"from_user_id":71746558,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"131230176","profile_image_url":"http://a2.twimg.com/sticky/default_profile_images/default_profile_5_normal.png","created_at":"Fri, 25 Feb 2011 17:39:58 +0000","from_user":"proory_bot","id_str":"41190683922546688","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30ea\u30cd\u30f3\u30dd\u30fc\u30c1 http://bit.ly/btjqlH","id":41190683922546688,"from_user_id":131230176,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://proory.com/&quot; rel=&quot;nofollow&quot;&gt;proory tems&lt;/a&gt;"},{"from_user_id_str":"120359038","profile_image_url":"http://a1.twimg.com/profile_images/946521484/200805161826000_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:58 +0000","from_user":"tukinosuke","id_str":"41190680835391488","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @fuefukioyasumi: \u3082\u3046\u3044\u3044\u3002\u300c\u671d\u751f\u300d\u306a\u3093\u304b\u3044\u3044\u3002BBC\u3082CNN\u3082\u82f1\u8a9e\u653e\u9001\u3060\u3002\u307f\u3093\u306a\u3001\u30c6\u30ec\u30d3\u3092\u3076\u3061\u3063\u3068\u5207\u3063\u3066Twitter\u3092\u898b\u3088\u3046\u3002\u3053\u3053\u306b\u300c\u751f\u304d\u305f\u60c5\u5831\u300d\u304c\u6d41\u308c\u3066\u3044\u308b\u3002\u300c\u751f\u304d\u305f\u53eb\u3073\u300d\u304c\u3042\u308b\u3002\u3053\u3053\u304b\u3089\u3067\u3082\u6b74\u53f2\u306e\u8ee2\u63db\u70b9\u3092\u611f\u3058\u308b\u4e8b\u304c\u3067\u304d\u308b\u306e\u3060\u3002 @gjmorley #libjp","id":41190680835391488,"from_user_id":120359038,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"166512109","profile_image_url":"http://a3.twimg.com/profile_images/1224583217/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:50 +0000","from_user":"yurii1129","id_str":"41190649839620096","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u6c17\u4ed8\u3044\u305f\u2026\u307f\u3043\u304f\u3093\u306eTwitter\u540d\u3001\u3084\u307e\u306d\u3084\u3093(\uffe3\u25c7\uffe3;)","id":41190649839620096,"from_user_id":166512109,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"228999619","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_6_normal.png","created_at":"Fri, 25 Feb 2011 17:39:49 +0000","from_user":"takami926","id_str":"41190644793745408","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u7530\u539f\u3055\u3093\u3001\u5fdc\u63f4\u3057\u3066\u307e\u3059\u3002WEB\u3082TWITTER\u3082\u62dd\u898b\u3057\u3066\u307e\u3059\u3002\u7530\u539f\u3055\u3093\u304c\u653f\u6cbb\u5bb6\u306b\u306a\u3063\u3066\u3001\u65e5\u672c\u3092\u5909\u3048\u3066\u304f\u3060\u3055\u3044\u3002\u5c16\u95a3\u3001\u5317\u65b9\u554f\u984c\u5171\u306b\u65e5\u672c\u306e\u653f\u6cbb\u306e\u5931\u6557\u3067\u3059\u3002\u8a55\u8ad6\u5bb6\u306f\u8272\u3005\u8a00\u3063\u3066\u307e\u3059\u304c\u3001\u4e2d\u6771\u307b\u3069\u56fd\u6c11\u306e\u71b1\u6c17\u304c\u7121\u304f\u3001\u683c\u5dee\u304c\u3042\u308a\u3001\u4f55\u3082\u5909\u308f\u3089\u306a\u3044\u666f\u6c17\u4f4e\u8ff7\u306e\u65e5\u672c\u306b\u56fd\u6c11\u306f\u8ae6\u3081\u3066\u308b\u3093\u3067\u3059\u3002","id":41190644793745408,"from_user_id":228999619,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"151773701","profile_image_url":"http://a0.twimg.com/profile_images/1213699753/obi_nao_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:44 +0000","from_user":"obi_nao","id_str":"41190622949941248","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3060\u3044\u3076\u5e74\u4e0b\u306e\u5f8c\u8f29\u306b\u3001\u30d3\u30b8\u30cd\u30b9\u3084\u308b\u306a\u3089\u771f\u5263\u306bTwitter\u3084\u308c\uff01\u3063\u3066\u6012\u3089\u308c\u305f\u3002\u306a\u306e\u3067\u4eca\u65e5\u304b\u3089\u771f\u5263\u306b\u3064\u3076\u3084\u304f\u3053\u3068\u306b\u3057\u307e\u3059\u3002\u3088\u308d\u3057\u304f\u3067\u3059\u3002","id":41190622949941248,"from_user_id":151773701,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.flight.co.jp/iPhone/TweetMe/&quot; rel=&quot;nofollow&quot;&gt;TweetMe for iPhone&lt;/a&gt;"},{"from_user_id_str":"20817229","profile_image_url":"http://a0.twimg.com/profile_images/1212012721/205_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:43 +0000","from_user":"allte","id_str":"41190619804082176","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u7206\u7b11\u3057\u3066\u547c\u5438\u56f0\u96e3\u3067\u75d9\u6523\u3059\u308b\u5618\u304f\u3093\u304c\u898b\u308c\u308b\u306e\u306fTwitter\u3060\u3051","id":41190619804082176,"from_user_id":20817229,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.movatwi.jp&quot; rel=&quot;nofollow&quot;&gt;www.movatwi.jp&lt;/a&gt;"},{"from_user_id_str":"166907967","profile_image_url":"http://a2.twimg.com/profile_images/1250526230/___normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:43 +0000","from_user":"NTTYAHOOOOOOOI","id_str":"41190618235412480","metadata":{"result_type":"recent"},"to_user_id":106469594,"text":"@takahirororo \u3066\u304b\u4f55\u3067twitter\u4e0a\u3067\u30a2\u30c9\u30d0\u30a4\u30b9\u3082\u3089\u3063\u3066\u3093\u306d\u3093\uff57","id":41190618235412480,"from_user_id":166907967,"to_user":"takahirororo","geo":null,"iso_language_code":"ja","to_user_id_str":"106469594","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"82581287","profile_image_url":"http://a0.twimg.com/profile_images/774721566/miyaru2_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:38 +0000","from_user":"kine_rahchaos","id_str":"41190598132244480","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30a2\u30aa\u30b7\u30de\u3055\u3093\u304cTwitter\u59cb\u3081\u305f\u3060\u3068\u2026","id":41190598132244480,"from_user_id":82581287,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://sourceforge.jp/projects/tween/wiki/FrontPage&quot; rel=&quot;nofollow&quot;&gt;Tween&lt;/a&gt;"},{"from_user_id_str":"136633905","profile_image_url":"http://a2.twimg.com/profile_images/1247161991/yama_normal.png","created_at":"Fri, 25 Feb 2011 17:39:35 +0000","from_user":"yamachi39","id_str":"41190584706285568","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3084\u3063\u3071\u308amixi\u3088\u308atwitter\u306e\u304c\u597d\u304d\u304b\u3082","id":41190584706285568,"from_user_id":136633905,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://jigtwi.jp/?p=1&quot; rel=&quot;nofollow&quot;&gt;jigtwi&lt;/a&gt;"},{"from_user_id_str":"44029295","profile_image_url":"http://a2.twimg.com/profile_images/1112965522/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:32 +0000","from_user":"no2yosee","id_str":"41190572769280000","metadata":{"result_type":"recent"},"to_user_id":97721124,"text":"@hn0345 \u3042\u3001\u500b\u4eba\u7684\u306b\u306f\u4eca\u306ftwitter\u306e\u30d7\u30ed\u30d5\u30a3\u30fc\u30eb\u306b\u66f8\u3044\u3066\u3042\u308b\u30d6\u30ed\u30b0\u306e\u30e6\u30cb\u30c3\u30c8\u3092\u306e\u3093\u3073\u308a\u3084\u3063\u3066\u307e\u3059w","id":41190572769280000,"from_user_id":44029295,"to_user":"hn0345","geo":null,"iso_language_code":"ja","to_user_id_str":"97721124","source":"&lt;a href=&quot;http://www.flight.co.jp/iPhone/TweetMe/&quot; rel=&quot;nofollow&quot;&gt;TweetMe for iPhone&lt;/a&gt;"},{"from_user_id_str":"149872179","profile_image_url":"http://a0.twimg.com/profile_images/1145770150/Winter11_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:31 +0000","from_user":"xmyyyxx","id_str":"41190566951653376","metadata":{"result_type":"recent"},"to_user_id":95069405,"text":"@rindofu \u653b\u7565\u672c\u3042\u308c\u3070\u3044\u3044\u306e\u306b\u3063\u3066\u601d\u3044\u307e\u3059(T\u03c9T)/~~~ \u79c1\u3082\u76f4\u3057\u305f\u3044\u3068\u3053\u3044\u3063\u3071\u3044\u3060\u3051\u3069\u3001\u3042\u306860\u5e74\u304f\u3089\u3044\u3044\u304d\u3089\u308c\u308b\u306f\u305a\u3060\u3057\u3001\u306e\u3093\u3073\u308a\u76f4\u308c\u3070\u3044\u3044\u306a\u3042 \u304a\u3084\u3059\u307f\u3067\u3059^^\uff01\u308a\u3093\u3055\u3093\u3068twitter\u3067\u4ef2\u826f\u304f\u306a\u308c\u3066\u3088\u304b\u3063\u305f\u3067\u3059\u3063","id":41190566951653376,"from_user_id":149872179,"to_user":"rindofu","geo":null,"iso_language_code":"ja","to_user_id_str":"95069405","source":"&lt;a href=&quot;http://twtr.jp&quot; rel=&quot;nofollow&quot;&gt;Keitai Web&lt;/a&gt;"},{"from_user_id_str":"105579892","profile_image_url":"http://a0.twimg.com/profile_images/1212950455/love_happy_pink_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:30 +0000","from_user":"love_happy_pink","id_str":"41190566494601216","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u305d\u308c\u898b\u305f\u3044\u306a\u266aRT @kazukt \u3046\u308b\u304a\u307c\u7d75\u3001\u4ed6\u306e\u4eba\u306e\u3082\u898b\u3066\u3044\u305f\u3089\u3084\u305f\u3089\u30de\u30f3\u30ac\u306e\u30ad\u30e3\u30e9\u30af\u30bf\u30fc\u3067\u3080\u3061\u3083\u304f\u3061\u3083\u4e0a\u624b\u3044\u4eba\u304c\uff01\u2026\u3068\u3001\u30d7\u30ed\u30d5\u30a3\u30fc\u30eb\u898b\u305f\u3089\u3001\u306a\u3093\u3068\u3054\u672c\u4eba\u304c\u66f8\u3044\u3066\u3044\u3089\u3063\u3057\u3083\u3063\u305f\u3002Twitter\u3063\u3066\u30b9\u30b4\u30a4\u308f\u3002","id":41190566494601216,"from_user_id":105579892,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.nibirutech.com/&quot; rel=&quot;nofollow&quot;&gt;TwitBird iPad&lt;/a&gt;"},{"from_user_id_str":"16996368","profile_image_url":"http://a0.twimg.com/profile_images/1198892387/pochi_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:30 +0000","from_user":"HyoYoshikawa","id_str":"41190564187611136","metadata":{"result_type":"recent"},"to_user_id":1800565,"text":"@shinichiro_beck \u73fe\u5730\u304b\u3089\u306a\u3089\u826f\u304f\u3066\u4ed6\u306e\u5730\u57df\u304b\u3089\u3060\u4f59\u8a08\u306a\u3089\u3001\u4f55\u306e\u305f\u3081\u306bTwitter\u304c\u3042\u308b\u306e\u304b\u308f\u304b\u3089\u306a\u3044\u3088\u3002\u3044\u307e\u8d77\u304d\u3066\u308b\u3053\u3068\u306e\u8aac\u660e\u3082\u3064\u304b\u306a\u3044\u3002\u30a2\u30eb\u30b8\u30e3\u30b8\u30fc\u30e9\u304c\u4f1d\u3048\u3066\u308b\u3053\u3068\u304c\u5168\u3066\u3058\u3083\u306a\u3044\u3057\u3001\u65e5\u672c\u306eTV\u306f\u4f1d\u3048\u306a\u3044\u3067\u3057\u3087\u3046\u3002\u77e5\u308a\u305f\u304c\u3063\u3066\u308b\u4eba\u3082\u305f\u304f\u3055\u3093\u3044\u308b\u3002","id":41190564187611136,"from_user_id":16996368,"to_user":"shinichiro_beck","geo":null,"iso_language_code":"ja","to_user_id_str":"1800565","source":"&lt;a href=&quot;http://www.hootsuite.com&quot; rel=&quot;nofollow&quot;&gt;HootSuite&lt;/a&gt;"},{"from_user_id_str":"119070802","profile_image_url":"http://a2.twimg.com/profile_images/1229773005/346d8435099798113a1326e1ba4949ee_normal.jpeg","created_at":"Fri, 25 Feb 2011 17:39:25 +0000","from_user":"takotako726","id_str":"41190545439207424","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u9b54\u6cd5\u5c11\u5973\u307e\u3069\u304b\u30de\u30ae\u30ab\u306e\u53cd\u97ff\u304ctwitter\u3067\u306f\u3093\u3071\u306d\u3048\u4ef6\u3002","id":41190545439207424,"from_user_id":119070802,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://z.twipple.jp/&quot; rel=&quot;nofollow&quot;&gt;\u3064\u3044\u3063\u3077\u308b/twipple&lt;/a&gt;"},{"from_user_id_str":"165695316","profile_image_url":"http://a1.twimg.com/profile_images/681748782/ring_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:21 +0000","from_user":"pandora_shotbar","id_str":"41190526447390720","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u300e\u30b7\u30e7\u30c3\u30c8\u30d0\u30fc\u3000\u30d1\u30f3\u30c9\u30e9\u3000\u30c4\u30a4\u30c3\u30bf\u30fc\u306e\u3064\u3076\u3084\u304d\u300f\u30b7\u30e7\u30c3\u30c8\u30d0\u30fc\u3000\u30d1\u30f3\u30c9\u30e9\u3000\u30c4\u30a4\u30c3\u30bf\u30fc\u306e\u3064\u2026\uff5chttp://pandora-twitter.seesaa.net/article/187809936.html","id":41190526447390720,"from_user_id":165695316,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://blog.seesaa.jp/&quot; rel=&quot;nofollow&quot;&gt;SeesaaBlog&lt;/a&gt;"},{"from_user_id_str":"88862311","profile_image_url":"http://a2.twimg.com/profile_images/1182243698/161113_100001897885617_169366_q_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:16 +0000","from_user":"amebaguide","id_str":"41190504926416896","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u300e\u30a2\u30e1\u30d6\u30ed\u653b\u7565\u30ac\u30a4\u30c9\u306e\u30c4\u30a4\u30c3\u30bf\u30fc\u306e\u3064\u3076\u3084\u304d\u300f\u30d6\u30ed\u30b0\u306e\u653b\u7565\u3000\u30c4\u30a4\u30c3\u30bf\u30fc\u306e\u3064\u3076\u3084\u304d\u96c6\uff5chttp://accessup-twitter.seesaa.net/article/187809931.html","id":41190504926416896,"from_user_id":88862311,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://blog.seesaa.jp/&quot; rel=&quot;nofollow&quot;&gt;SeesaaBlog&lt;/a&gt;"},{"from_user_id_str":"186895007","profile_image_url":"http://a2.twimg.com/profile_images/1229610799/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:11 +0000","from_user":"zizikt","id_str":"41190486123356161","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3053\u308c\u306f\u500b\u4eba\u7684\u306b\u306f\u91cd\u5b9d\u3067\u3059\u3002\n\u25c6iPhone&amp;iPad\u5411\u3051Twitter\u30a2\u30d7\u30ea\u300c\u3064\u3044\u3063\u3077\u308b\u300d\u306bEvernote\u3068\u306e\u9023\u643a\u6a5f\u80fd\u3092\u8ffd\u52a0 \nhttp://bit.ly/hPf44u","id":41190486123356161,"from_user_id":186895007,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"132320738","profile_image_url":"http://a3.twimg.com/profile_images/1229760475/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:04 +0000","from_user":"faina_","id_str":"41190453592334336","metadata":{"result_type":"recent"},"to_user_id":167894537,"text":"@gjmorley \u30e2\u30fc\u30ea\u30fc\u3055\u3093\u306e\u7ffb\u8a33\u306e\u8a00\u8449\u306e\u30bb\u30f3\u30b9\u304c\u3059\u304d\u3067\u3059\u3002\u305d\u3057\u3066\u3001Twitter\u3067\u77e5\u308b\u3001\u73fe\u5730\u306e\u4eba\u306e\u76ee\u306e\u529b\u3084\u3001\u60c5\u5831\u3092\u4f1d\u3048\u3066\u304f\u308c\u308b\u7686\u3055\u3093\u306e\u60c5\u71b1\u306b\u611f\u52d5\u3057\u3066\u3044\u307e\u3059\u3002\u611f\u52d5\u3059\u308b\u3063\u3066\u3059\u3054\u3044\u30a8\u30cd\u30eb\u30ae\u30fc\u3067\u3059\uff01\uff01","id":41190453592334336,"from_user_id":132320738,"to_user":"gjmorley","geo":null,"iso_language_code":"ja","to_user_id_str":"167894537","source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"24870552","profile_image_url":"http://a3.twimg.com/profile_images/907130634/4_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:03 +0000","from_user":"tana1192","id_str":"41190450480021504","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u500b\u4eba\u7684\u306b\u306f\u3001\u30bf\u30b0\u5f3e\u304d\u3059\u308c\u3070\u3044\u3044\uff08\u5f3e\u3051\u308b\u30c4\u30fc\u30eb\u3092\u4f7f\u3063\u3066Twitter\u3092\u3059\u308c\u3070\u3044\u3044\uff09\u3068\u601d\u3046\u3093\u3060\u3051\u3069\u306a\u3042\u3002\u307f\u3093\u306a\u305d\u308c\u306a\u308a\u306bTwitter\u3084\u308b\u4eba\u3060\u3057\u3001\u30c4\u30fc\u30eb\u9078\u3073\u304f\u3089\u3044\u5e45\u3092\u6301\u3063\u3066\u3084\u3063\u3066\u3082\u3002 \u307e\u3042\u3001\u4ffa\u30a2\u30cb\u30e1\u306f\u89b3\u308b\u89b3\u308b\u8a50\u6b3a\u3059\u308b\u3060\u3051\u306e\u4eba\u3060\u304b\u3089\u95a2\u4fc2\u306a\u3044\u3093\u3060\u3051\u3069\u3082\uff57\uff57\u5b9f\u6cc1\u306f\u697d\u3057\u305d\u3046\u306b\u898b\u3048\u308b\u3088\u3002","id":41190450480021504,"from_user_id":24870552,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://sourceforge.jp/projects/tween/wiki/FrontPage&quot; rel=&quot;nofollow&quot;&gt;Tween&lt;/a&gt;"},{"from_user_id_str":"58509646","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Fri, 25 Feb 2011 17:39:02 +0000","from_user":"kakuyas","id_str":"41190446663344128","metadata":{"result_type":"recent"},"to_user_id":107076877,"text":"@Dayspool \u6df1\u591c\uff12\uff19\u6642\u304f\u3089\u3044\u307e\u3067\u306f\u6bce\u65e5\u55b6\u696d\u3057\u3066\u308b\u306e\u3067\u3001twitter\u3001\u30e1\u30c3\u30bb\u3001PS3\u306a\u3069\u3067\u3088\u3093\u3067\u3051\u308c\u3002\u3053\u3063\u3061\u304b\u3089\u58f0\u304b\u3051\u308b\u3053\u3068\u3082\u3042\u308b\u304b\u3082\u3060\u304c\uff57","id":41190446663344128,"from_user_id":58509646,"to_user":"Dayspool","geo":null,"iso_language_code":"ja","to_user_id_str":"107076877","source":"&lt;a href=&quot;http://cheebow.info/chemt/archives/2007/04/twitterwindowst.html&quot; rel=&quot;nofollow&quot;&gt;Twit for Windows&lt;/a&gt;"},{"from_user_id_str":"149128527","profile_image_url":"http://a2.twimg.com/profile_images/1254922702/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:00 +0000","from_user":"uni13yoki","id_str":"41190437087748096","metadata":{"result_type":"recent"},"to_user_id":119468594,"text":"@kuro_wr84 \u304a\u308c\u3068\u304a\u524d\u3067Twitter\u3067\u4f1a\u8a71\u3057\u305f\u3089\u3001\u5927\u5909\u306a\u3053\u3068\u306b\u306a\u308b\u306a","id":41190437087748096,"from_user_id":149128527,"to_user":"kuro_wr84","geo":null,"iso_language_code":"ja","to_user_id_str":"119468594","source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"18670595","profile_image_url":"http://a2.twimg.com/profile_images/1250674062/ProfilePhoto_normal.png","created_at":"Fri, 25 Feb 2011 17:38:59 +0000","from_user":"nyuuuuun","id_str":"41190436450222080","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3078\u30fc\u3053\u3093\u306a\u306b\u3088\u304f\u4f3c\u308b\u3053\u3068\u3082\u3042\u308b\u3093\u3060\u30fc\nhttp://twitter.com/Re_44/status/35943233016168448\nhttp://twitter.com/3510_misaka/status/36122114821988352","id":41190436450222080,"from_user_id":18670595,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"96267603","profile_image_url":"http://a3.twimg.com/profile_images/1245253473/DSiLL3_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:59 +0000","from_user":"arivis","id_str":"41190433119940608","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://twitter.com/#!/arivis/status/40636755380142080 \u306a\u3093\u3064\u3046\u304b\u3053\u308c\u3067\u8d64\u3063\u3066\u306e\u3082\u3061\u3087\u3063\u3068\u3042\u308c\u3063\u3059\u306d\u3002\u305d\u3057\u3066\u4e88\u671f\u3057\u3066\u3044\u305f\u304b\u306e\u3088\u3046\u3060","id":41190433119940608,"from_user_id":96267603,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"148097776","profile_image_url":"http://a3.twimg.com/profile_images/1166904064/broken-heart_normal.png","created_at":"Fri, 25 Feb 2011 17:38:56 +0000","from_user":"ReajuBreaker_A","id_str":"41190422135058432","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u672c\u57a2\u30d5\u30a9\u30ed\u30fc\u3088\u308d\u3057\u304f\u3067\u3059\u2192 http://twitter.com/ReajuBreaker \uff08\uff20\u3060\u3068\u30ea\u30d7\u30e9\u30a4\u304c\u57cb\u307e\u308b\u305f\u3081\u3001URL\u306b\u3057\u3066\u3042\u308a\u307e\u3059\uff09","id":41190422135058432,"from_user_id":148097776,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.twitter.com/ReajuBreaker&quot; rel=&quot;nofollow&quot;&gt;\u73fe\u5145\u6bba\u3057\u306e\u7121\u4eba\u9023\u545f\uff1c\u30aa\u30fc\u30c8\u30c4\u30a4\u30fc\u30c8\uff1e&lt;/a&gt;"},{"from_user_id_str":"59711654","profile_image_url":"http://a2.twimg.com/profile_images/416212928/flowers-06-1_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:56 +0000","from_user":"agamo45","id_str":"41190421522546688","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @ebizo66: \u30ea\u30d3\u30a2\u30fb\u30c8\u30ea\u30dd\u30ea\u306eTw\uff1a\u6551\u6025\u8eca\u304c\u6765\u305f\u304c\u3001\u8ca0\u50b7\u8005\u3092\u8eca\u5185\u3067\u6bba\u5bb3\u3057\u3066\u3044\u305f\u3001\u3068\u3002\uff08\u6ec5\u8336\u82e6\u8336\u3060\uff01\uff09http://ow.ly/43pQ2 #libjp","id":41190421522546688,"from_user_id":59711654,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.hootsuite.com&quot; rel=&quot;nofollow&quot;&gt;HootSuite&lt;/a&gt;"},{"from_user_id_str":"145311373","profile_image_url":"http://a3.twimg.com/profile_images/1187802576/a_gam_02_normal.png","created_at":"Fri, 25 Feb 2011 17:38:55 +0000","from_user":"nogic1008","id_str":"41190418141937664","metadata":{"result_type":"recent"},"to_user_id":88117317,"text":"@runasoru \u307e\u3042\u5acc\u306a\u3089\u6df1\u591c\u5e2f\u306bTwitter\u898b\u306a\u304d\u3083\u3044\u3044\u3060\u3051\u3067\u3059\u304b\u3089\u306d\u30fc \u30103/19BDM\u30aa\u30d5http://twvt.us/bdoff_kansai\u3011","id":41190418141937664,"from_user_id":145311373,"to_user":"runasoru","geo":null,"iso_language_code":"ja","to_user_id_str":"88117317","source":"&lt;a href=&quot;http://sourceforge.jp/projects/tween/wiki/FrontPage&quot; rel=&quot;nofollow&quot;&gt;Tween&lt;/a&gt;"},{"from_user_id_str":"195851300","profile_image_url":"http://a2.twimg.com/profile_images/1124572815/be7b4c0a06cb60e8_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:49 +0000","from_user":"LoveLAscrewDoll","id_str":"41190391147540480","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @jp_mjp: SCREW TV SHOW Vol.6\u306e\u653e\u9001\u304c\u7121\u4e8b\u306b\u7d42\u4e86\u3044\u305f\u3057\u307e\u3057\u305f\u3002\u3054\u89a7\u9802\u304d\u3042\u308a\u304c\u3068\u3046\u3054\u3056\u3044\u307e\u3057\u305f\uff01\u6b21\u56de\u653e\u9001\u306f3\u670818\u65e5(\u91d1)\u3067\u3059\u3002\u8996\u8074\u8005\u30d7\u30ec\u30bc\u30f3\u30c8\u306e\u8a73\u7d30\u306f\u5f8c\u65e5MJP\u3067\u304a\u77e5\u3089\u305b\u3044\u305f\u3057\u307e\u3059\u3002\u305d\u306e\u969b\u306b\u306f\u3001\u3053\u306eTwitter\u3067\u3082\u304a\u77e5\u3089\u305b\u3044\u305f\u3057\u307e\u3059\u306e\u3067\u3001\u304a\u697d\u3057\u307f\u306b\uff01#SCREWTV","id":41190391147540480,"from_user_id":195851300,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://z.twipple.jp/&quot; rel=&quot;nofollow&quot;&gt;\u3064\u3044\u3063\u3077\u308b/twipple&lt;/a&gt;"},{"from_user_id_str":"178045354","profile_image_url":"http://a0.twimg.com/profile_images/1214479381/154722_10100141954893059_808622_55276626_7445050_n_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:48 +0000","from_user":"ChuriSta_gt","id_str":"41190389549510656","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3053\u3053\u4e00\u9031\u9593Twitter\u304c\u3084\u305f\u3089\u697d\u3057\u3044\u306e\u3067\u3059\u3051\u3069\u30fc\u30fc\u30fc\uff01\u306b\u3072\u3072\u3063\u7b11","id":41190389549510656,"from_user_id":178045354,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twipple.jp/&quot; rel=&quot;nofollow&quot;&gt;\u3064\u3044\u3063\u3077\u308b for iPhone&lt;/a&gt;"},{"from_user_id_str":"50592111","profile_image_url":"http://a0.twimg.com/profile_images/1252176582/lFjpi_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:48 +0000","from_user":"crowNeko","id_str":"41190387271864320","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30a8\u30ed\u30b2\u30d7\u30ec\u30a4\u3057\u306a\u304c\u3089\u307e\u3069\u30de\u30aeTL\u3092\u898b\u306a\u3044\u3088\u3046\u306b\u534a\u76ee\u306b\u306a\u308a\u306a\u304c\u3089Twitter\u3057\u3066\u308b\u6df1\u591c2\u6642\u534a\u3002","id":41190387271864320,"from_user_id":50592111,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://stone.com/Twittelator&quot; rel=&quot;nofollow&quot;&gt;Twittelator&lt;/a&gt;"},{"from_user_id_str":"7141467","profile_image_url":"http://a3.twimg.com/profile_images/1198540741/icon12912579345276_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:40 +0000","from_user":"hina_geshi","id_str":"41190355961380864","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u7d50\u5c40\u30cd\u30bf\u30d0\u30ec\u3059\u3093\u306a\u3063\u3066\u8a00\u3046\u65b9\u304c\u30a2\u30ec\u3060\u3088\u306d\u3001\u3057\u306a\u3044\u308f\u3051\u7121\u3044\u3058\u3083\u306a\u3044\u8133\u5185\u5782\u308c\u6d41\u3057\u304cTwitter\u306a\u3093\u3060\u304b\u3089\u3055","id":41190355961380864,"from_user_id":7141467,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://projects.playwell.jp/go/Saezuri&quot; rel=&quot;nofollow&quot;&gt;Saezuri&lt;/a&gt;"},{"from_user_id_str":"149608984","profile_image_url":"http://a0.twimg.com/profile_images/1205950885/090702_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:39 +0000","from_user":"Mr_Tsubaki","id_str":"41190349447774208","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u307e\u3069\u304b\u306fTwitter\u5408\u308f\u305b\u3066\uff11\u6642\u9593\u306f\u697d\u3057\u3044","id":41190349447774208,"from_user_id":149608984,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://z.twipple.jp/&quot; rel=&quot;nofollow&quot;&gt;\u3064\u3044\u3063\u3077\u308b/twipple&lt;/a&gt;"},{"from_user_id_str":"122271550","profile_image_url":"http://a0.twimg.com/profile_images/961936499/neoneko_bot5jpg_____normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:39 +0000","from_user":"neoneko_bot5","id_str":"41190348726345728","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u30c6\u30b9\u30c8\uff1a23\u3011\u4eca\u65e5\u304b\u3089\u5ba3\u4f1d\u958b\u59cb\u2606\u306d\u304a\u306d\u3053\u306eTwitter \u3067 EasyBottex\u3000\u3067\u304d\u308b\u307e\u3067\uff01\u2192http://neoneko.blog31.fc2.com/","id":41190348726345728,"from_user_id":122271550,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www20.atpages.jp/neoneko/&quot; rel=&quot;nofollow&quot;&gt;neoneko_bot5&lt;/a&gt;"},{"from_user_id_str":"127069188","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_6_normal.png","created_at":"Fri, 25 Feb 2011 17:38:37 +0000","from_user":"MYCHEBOT","id_str":"41190340908163074","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30eb\u30d5\u3055\u3093\u304c\u914d\u4fe1\u3092\u7d42\u4e86\u3057\u307e\u3057\u305f\uff01/ http://777labo.com/mychecker/view/745.php / \u30c8\u30d4\u30c3\u30af:XSplit\u30c6\u30b9\u30c8\u3000twitter\u2192http://twitter.com/rukh01","id":41190340908163074,"from_user_id":127069188,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://777labo.com/mychecker/&quot; rel=&quot;nofollow&quot;&gt;MYCHEBOT&lt;/a&gt;"},{"from_user_id_str":"107626142","profile_image_url":"http://a1.twimg.com/profile_images/1104968421/SuperMaika1_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:34 +0000","from_user":"MaikaPaPa","id_str":"41190328614666240","metadata":{"result_type":"recent"},"to_user_id":null,"text":"75\u5e74\u524d\u306e\u4eca\u65e52\u670826\u65e5\u672a\u660e\u3001\u82e5\u304d\u9752\u5e74\u5c06\u6821\u3089\u304c\u653f\u6cbb\u8150\u6557\u3068\u8fb2\u6751\u306e\u56f0\u7aae\u306b\u5bfe\u3057\u3066\u6c7a\u8d77\u3057\u307e\u3057\u305f\u3002\u3082\u3061\u308d\u3093\u5f53\u6642\u306fTwitter\u3082FB\u3082\u3001\u307e\u305f\u5f53\u7136\u306a\u304c\u3089Internet\u3082\u3042\u308a\u307e\u305b\u3093\u3067\u3057\u305f\u3002\u4e00\u65b9\u3001\u30c1\u30e5\u30cb\u30b8\u30a2\u3001\u30a8\u30b8\u30d7\u30c8\u3001\u4e2d\u6771\u306b\u5e83\u304c\u308b\u53cd\u653f\u5e9c\u30c7\u30e2\u3068\u5f37\u6a29\u4f53\u5236\u306e\u5d29\u58ca\u3002\u73fe\u5728\u306e\u65e5\u672c\u3067\u306f\u8003\u3048\u3089\u308c\u306a\u3044\u3053\u3068\u3067\u3059\u3002","id":41190328614666240,"from_user_id":107626142,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"11111695","profile_image_url":"http://a1.twimg.com/sticky/default_profile_images/default_profile_0_normal.png","created_at":"Fri, 25 Feb 2011 17:38:28 +0000","from_user":"kumatchipooh","id_str":"41190306145775617","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @inosenaoki: \u306a\u308b\u307b\u3069\u306d\u3002 RT @dansrmz @inosenaoki \u3053\u3061\u3089\u304c\u30bd\u30d5\u30c8\u30d0\u30f3\u30af\u526f\u793e\u9577\u306e\u677e\u672c\u5fb9\u4e09\u3055\u3093\u306e\u3001Twitter\u306b\u95a2\u3059\u308b\u8ad6\u8003\u3067\u3059\u3002 \u25b6 &quot;Twitter\u306e2\u30c1\u30e3\u30f3\u30cd\u30eb\u5316\u306f\u9632\u6b62\u51fa\u6765\u308b\u304b&quot; http://t.co/Mwzb8Zf","id":41190306145775617,"from_user_id":11111695,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"212161909","profile_image_url":"http://a1.twimg.com/profile_images/1252895790/natm01_normal.gif","created_at":"Fri, 25 Feb 2011 17:38:28 +0000","from_user":"n34hitman","id_str":"41190303830511616","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Twitter\u30fb\u30d6\u30ed\u30b0\u30a2\u30d5\u30a3\u30ea\u30a8\u30a4\u30c8\u81ea\u52d5\u6295.... http://goo.gl/a4RHB 4054","id":41190303830511616,"from_user_id":212161909,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twibow.net/&quot; rel=&quot;nofollow&quot;&gt;Twibow&lt;/a&gt;"},{"from_user_id_str":"105945593","profile_image_url":"http://a2.twimg.com/sticky/default_profile_images/default_profile_5_normal.png","created_at":"Fri, 25 Feb 2011 17:38:24 +0000","from_user":"nakano_bot","id_str":"41190285710983168","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3053\u306ebot\u306f\u4e0d\u52d5\u7523\u4f1a\u793e\u69d8\u5411\u3051\u306e\u4e0d\u52d5\u7523\u30dd\u30fc\u30bf\u30eb\u30b5\u30a4\u30c8\u3078\u306e\u4e00\u62ec\u8ee2\u9001\uff0bTwitter\u7121\u6599\u8ee2\u9001\u30b5\u30fc\u30d3\u30b9\u306b\u3088\u308a\u3064\u3076\u3084\u304d\u307e\u3059\u3002\u3054\u5229\u7528\u306b\u306a\u308a\u305f\u3044\u5834\u5408\u306f http://bit.ly/demey0 \u306b\u304a\u6c17\u8efd\u306b\u304a\u554f\u3044\u5408\u308f\u305b\u4e0b\u3055\u3044\u3002","id":41190285710983168,"from_user_id":105945593,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.teramax.jp/aboutus.html&quot; rel=&quot;nofollow&quot;&gt;tmxbot&lt;/a&gt;"},{"from_user_id_str":"170904226","profile_image_url":"http://a2.twimg.com/profile_images/1249020397/1789kb_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:21 +0000","from_user":"1789kb","id_str":"41190274428305408","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3068\u308a\u3042\u3048\u305a\u4eca\u56de\u521d\u3081\u3066\u30ea\u30a2\u30eb\u30bf\u30a4\u30e0\u3067\u898b\u3066\u308f\u304b\u3063\u305f\u306e\u306f\u3001QB\u306f\u5168\u8eab\u304c\u30a2\u30f3\u30d1\u30f3\u30bf\u30a4\u30d7\u3060\u3068\u3044\u3046\u3053\u3068\u3068\u3001\u307e\u3069\u30de\u30ae\u7d42\u4e86\u5f8c\u306eTwitter\u306e\u3056\u308f\u3064\u304d\u304c\u3059\u3054\u3044\u3068\u3044\u3046\u3053\u3068","id":41190274428305408,"from_user_id":170904226,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.echofon.com/&quot; rel=&quot;nofollow&quot;&gt;Echofon&lt;/a&gt;"},{"from_user_id_str":"166169644","profile_image_url":"http://a1.twimg.com/profile_images/1217017679/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:18 +0000","from_user":"Okkkkkkkkkkun","id_str":"41190262420017152","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3063\u3066Twitter\u3067\u3064\u3076\u3084\u304f\u81ea\u5206\u3082\u76f8\u5f53\u5c0f\u3055\u3044\u306a\u3002","id":41190262420017152,"from_user_id":166169644,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"196623456","profile_image_url":"http://a3.twimg.com/profile_images/1219076661/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:06 +0000","from_user":"NoMoneyClub","id_str":"41190213342601216","metadata":{"result_type":"recent"},"to_user_id":195462431,"text":"@yosal15 \nTwitter\u3084\u3063\u3066\u308b\u3089\u3057\u3044\u3002\u3051\u3069\u3001\u898b\u3064\u304b\u3089\u306a\u3044\u3002","id":41190213342601216,"from_user_id":196623456,"to_user":"yosal15","geo":null,"iso_language_code":"ja","to_user_id_str":"195462431","source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"126984048","profile_image_url":"http://a3.twimg.com/profile_images/1254579571/zipyaru-20090829-23-0012_normal.png","created_at":"Fri, 25 Feb 2011 17:38:02 +0000","from_user":"minaduki_naduki","id_str":"41190196418584576","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u203b\u30e1\u30fc\u30eb\u3067\u5973\u306e\u5b50\u53e3\u8aac\u304f\u306e\u306b\u5fd9\u3057\u3044\u3093\u3060\u305d\u3046\u3067\u3059\u3000\u307e\u3058\u3058\u3054\u308d RT @yowano_k: \u5fd9\u3057\u304f\u3066\u3082Twitter\u306b\u9854\u3092\u51fa\u3057\u305f\u304f\u306a\u308b\u50d5\u30a7\u2026\u2026","id":41190196418584576,"from_user_id":126984048,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://seesmic.com/seesmic_desktop/sd2&quot; rel=&quot;nofollow&quot;&gt;Seesmic Desktop&lt;/a&gt;"},{"from_user_id_str":"200568705","profile_image_url":"http://a3.twimg.com/profile_images/1242179765/101230_1355_01_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:01 +0000","from_user":"hammerstrap","id_str":"41190190428979200","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6628\u65e5\u91d1\u66dc\u65e5\u306f\u732e\u8840\u306b\u5f80\u304f\u3002\u4eca\u306e\u50d5\u306e\u4eba\u9593\u3068\u3057\u3066\u306e\u4fa1\u5024\u306f\u3001\u7cbe\u3005\u3053\u306e\u7a0b\u5ea6\u3002\u8179\u304c\u6e1b\u3063\u305f\u3002\u5374\u8aac\u3002twitter\u306e\u767e\u56db\u5341\u6587\u5b57\u306b\u82db\u3005\u3068\u3057\u3066\u3001\u4e00\u3064\u306e\u4eee\u8aac\u306b\u4fe1\u6191\u6027\u3092\u5f97\u308b\u3002\u6226\u6642\u4e0b\u306e\u7d19\u306e\u7d71\u5236\u3068\u3001\u4e2d\u5cf6\u6566\u306e\u6587\u7ae0\u306e\u95a2\u4fc2\u6027\u3002\u73fe\u5728\u30a6\u30a7\u30d6\u30ed\u30b0\u306b\u3001\u7e8f\u3081\u3066\u3044\u308b\u6700\u4e2d\u3002\u8fd1\u65e5\u516c\u958b\u4e88\u5b9a\u3002","id":41190190428979200,"from_user_id":200568705,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"164970427","profile_image_url":"http://a0.twimg.com/profile_images/1227176662/9192b021ef85ce9902c28955f86e604b_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:59 +0000","from_user":"syuigetsuIT","id_str":"41190184041197569","metadata":{"result_type":"recent"},"to_user_id":141926331,"text":"@iliad_tga \u30a4\u30ea\u30a2\u30b9\u3055\u3093\u304c\u305d\u306e\u8fba\u7406\u89e3\u306e\u3042\u308b\u3053\u3068\u306f\u5206\u304b\u3063\u3066\u307e\u3059\uff57\u3000\u30cd\u30bf\u30d0\u30ec\u4e91\u3005\u306ftwitter\u306e\u6c7a\u5b9a\u7684\u306a\u6b20\u70b9\u3060\u3068\u601d\u3044\u307e\u3059\u306d\u3047\u3002","id":41190184041197569,"from_user_id":164970427,"to_user":"iliad_tga","geo":null,"iso_language_code":"ja","to_user_id_str":"141926331","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"94526795","profile_image_url":"http://a0.twimg.com/profile_images/679411954/akb48_in_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:56 +0000","from_user":"akb48_in","id_str":"41190171248431104","metadata":{"result_type":"recent"},"to_user_id":null,"text":"AKB48\u67cf\u6728\u7531\u7d00 \u304a\u75b2\u308c\u69d8\u3002: \n\u3053\u3093\u3070\u3093\u306f(^O^)\uff0f\u266a\n\u3000\n\u3000\n\u3000\n\u4eca\u65e5\u306e\u516c\u6f14\u697d\u3057\u304b\u3063\u305f\u301c\n\u3000\n\u3000\n\u4e45\u3057\u3076\u308a\u3067\u7dca\u5f35\u3057\u305f\u3051\u3069\u3001\u306f\u3058\u3051\u307e\u304f\u3063\u305f\u305c\u3043\uff01\uff01\n\u3000\n\u3000\n\u3000\nMC\u306f\u565b\u307f\u307e\u304f\u308a\u306e\u30c6\u30f3\u30d1\u308a\u307e\u304f... http://bit.ly/ie8bEa akb48 twitter","id":41190171248431104,"from_user_id":94526795,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"222270374","profile_image_url":"http://a3.twimg.com/profile_images/1250946143/P1040062_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:53 +0000","from_user":"chrxpac","id_str":"41190158455943168","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u5b9a\u671f\u3011Twitter\u306f\uff8a\uff9f\uff7f\uff7a\uff9d\u304b\u3089\u3057\u304b\u3067\u304d\u306a\u3044\u306e\u3067\uff98\uff8c\uff9f\u8fd4\u3057\u304c\u9045\u304f\u306a\u308a\u307e\u3059(\u00b4\u30fb\u03c9\u30fb\uff40)\u3054\u4e86\u627f\u4e0b\u3055\u3044!!","id":41190158455943168,"from_user_id":222270374,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twittbot.net/&quot; rel=&quot;nofollow&quot;&gt;twittbot.net&lt;/a&gt;"},{"from_user_id_str":"64009258","profile_image_url":"http://a2.twimg.com/profile_images/1154025023/Mixi___normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:52 +0000","from_user":"Tatsuyuko","id_str":"41190153447944192","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4f01\u696d\u304c\u5c31\u6d3b\u751f\u306bFacebook\u3092\u4f7f\u3063\u3066\u7533\u8acb\u305b\u3088\u3068\u3044\u3044\u3001\u4f01\u696d\u304cFacebook\u3092\u4f7f\u3048\u3068\u4f01\u696d\u304c\u8a00\u3063\u3066\u304d\u305f\u308a\u3059\u308c\u3070\u305d\u308c\u3069\u3053\u308d\u3058\u3083\u306a\u3044\u304b\u3068\u3002\u5c11\u306a\u304f\u3068\u3082\u5c31\u6d3b\u3067Twitter\u306e\u8a00\u52d5\u3084\u30d5\u30a9\u30ed\u30ef\u30fc\u3092\u8abf\u67fb\u3059\u308b\u4f01\u696d\u306f\u304b\u306a\u308a\u591a\u3044\u3067\u3059 RT @Isshee: \u4f01\u696d\u3067\u3082\u540c\u3058\u3067\u3057\u3087 RT","id":41190153447944192,"from_user_id":64009258,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://sourceforge.jp/projects/tween/wiki/FrontPage&quot; rel=&quot;nofollow&quot;&gt;Tween&lt;/a&gt;"},{"from_user_id_str":"105145175","profile_image_url":"http://static.twitter.com/images/default_profile_normal.png","created_at":"Fri, 25 Feb 2011 17:37:49 +0000","from_user":"snao813","id_str":"41190141703753728","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @yumisaiki: \u795e\u69d8\u306f\u672c\u5f53\u306b\u4eba\u9593\u3092\u3059\u3070\u3089\u3057\u3044\u30d0\u30e9\u30f3\u30b9\u3067\u914d\u7f6e\u3057\u3066\u304a\u3089\u308c\u308b\u3002\u795d\u5cf6\u307f\u305f\u3044\u306a\u5c0f\u3055\u3044\u3068\u3053\u308d\u306b\u306a\u3093\u3067\u3053\u3093\u306a\u306b\u7acb\u6d3e\u306a\u4eba\u304c\u305f\u304f\u3055\u3093\u3044\u308b\u3093\u3060\u308d\u3046\u3002\u795e\u69d8\u3042\u308a\u304c\u3068\u3046\u3002\u672c\u5f53\u306b\u3042\u308a\u304c\u3068\u3046\u3002\u4eba\u9593\u3063\u3066\u3059\u3070\u3089\u3057\u3044\u3068\u601d\u3048\u305f\u3002twitter\u3082\u3042\u308a\u304c\u3068\u3046\u3002\u3000#kaminoseki","id":41190141703753728,"from_user_id":105145175,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://seesmic.com/seesmic_desktop/sd2&quot; rel=&quot;nofollow&quot;&gt;Seesmic Desktop&lt;/a&gt;"},{"from_user_id_str":"203667204","profile_image_url":"http://a2.twimg.com/profile_images/1254664000/eve_blackcat_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:46 +0000","from_user":"eve_blackcat","id_str":"41190129292943361","metadata":{"result_type":"recent"},"to_user_id":146894340,"text":"@kuroiso02 \u3057\u308a\u3068\u308a\u3068\u304b\uff1f\n\u2026\u3067\u3082Twitter\u3060\u3068\u7d42\u308f\u3089\u306a\u304f\u306a\u308b\u30b1\u30c9\u2026","id":41190129292943361,"from_user_id":203667204,"to_user":"kuroiso02","geo":null,"iso_language_code":"ja","to_user_id_str":"146894340","source":"&lt;a href=&quot;http://twipple.jp/&quot; rel=&quot;nofollow&quot;&gt;\u3064\u3044\u3063\u3077\u308b for iPhone&lt;/a&gt;"},{"from_user_id_str":"6528403","profile_image_url":"http://a0.twimg.com/profile_images/1240591244/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:45 +0000","from_user":"sortiee","id_str":"41190125924917248","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30a2\u30cb\u30e1\u5b9f\u6cc1\u306ftwitter\u306e\u764c","id":41190125924917248,"from_user_id":6528403,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://sites.google.com/site/peraperaprv/Home&quot; rel=&quot;nofollow&quot;&gt;P3:PeraPeraPrv&lt;/a&gt;"},{"from_user_id_str":"186058304","profile_image_url":"http://a0.twimg.com/profile_images/1250454564/IMG_0210_normal.JPG","created_at":"Fri, 25 Feb 2011 17:37:37 +0000","from_user":"00o8o00","id_str":"41190090386448384","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @fuefukioyasumi: \u3082\u3046\u3044\u3044\u3002\u300c\u671d\u751f\u300d\u306a\u3093\u304b\u3044\u3044\u3002BBC\u3082CNN\u3082\u82f1\u8a9e\u653e\u9001\u3060\u3002\u307f\u3093\u306a\u3001\u30c6\u30ec\u30d3\u3092\u3076\u3061\u3063\u3068\u5207\u3063\u3066Twitter\u3092\u898b\u3088\u3046\u3002\u3053\u3053\u306b\u300c\u751f\u304d\u305f\u60c5\u5831\u300d\u304c\u6d41\u308c\u3066\u3044\u308b\u3002\u300c\u751f\u304d\u305f\u53eb\u3073\u300d\u304c\u3042\u308b\u3002\u3053\u3053\u304b\u3089\u3067\u3082\u6b74\u53f2\u306e\u8ee2\u63db\u70b9\u3092\u611f\u3058\u308b\u4e8b\u304c\u3067\u304d\u308b\u306e\u3060\u3002 @gjmorley #libjp","id":41190090386448384,"from_user_id":186058304,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"49219631","profile_image_url":"http://a2.twimg.com/profile_images/1231873117/__2-colornow__2__normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:33 +0000","from_user":"irisgazer","id_str":"41190073227550720","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3067\u3059\u3088\u306d\u3047 RT @minamitaiheiyou: \u6545\u306b\u30cd\u30bf\u30d0\u30ec\u3092\u3059\u308b\u306e\u3082\u81ea\u7531\u3002\u30cd\u30bf\u3070\u308c\u3057\u305f\u4eba\u3092\u30c7\u30a3\u30b9\u308b\u306e\u3082\u81ea\u7531\u3002\u3042\u3068\u306f\u5404\u3005\u306e\u88c1\u91cf\u3067\u4e57\u308a\u5207\u3063\u3066\u304f\u3060\u3055\u3044\u3088\u3081\u3093\u3069\u304f\u3055\u3044\u306a RT @kihirokiro: Twitter\u3067\u30cd\u30bf\u30d0\u30ec\u4e91\u3005\u3044\u3063\u3066\u3082\u5143\u3005Twitter\u3063\u3066\u300c\u500b\u4eba\u306e\u72ec\u308a\u8a00\u300d\u3060\u308d","id":41190073227550720,"from_user_id":49219631,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://sourceforge.jp/projects/tween/wiki/FrontPage&quot; rel=&quot;nofollow&quot;&gt;Tween&lt;/a&gt;"},{"from_user_id_str":"98560114","profile_image_url":"http://a0.twimg.com/profile_images/1252332545/IMGP8170_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:32 +0000","from_user":"qess0093","id_str":"41190070706905088","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30b7\u30e5\u30fc\u30c6\u30a3\u304f\u305d\u3046\u305c\u3048\uff57 RT @syu_thi_bot: \u3044\u3064\u307e\u3067Twitter\u3084\u3063\u3066\u308b\u3093\u3060\u3044\uff1f\u3044\u3044\u52a0\u6e1b\u73fe\u5b9f\u306b\u623b\u308a\u306a\u3088\u3002\u3053\u3053\u306f\u30ad\u30df\u305f\u3061\u4e09\u6b21\u5143\u306e\u4eba\u9593\u304c\u3044\u308b\u3079\u304d\u5834\u6240\u3058\u3083\u306a\u3044\u3093\u3060\u3088\u3002\u305d\u3093\u306a\u306e\u57fa\u672c\u3060\u308d\uff01\uff01","id":41190070706905088,"from_user_id":98560114,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://sourceforge.jp/projects/tween/wiki/FrontPage&quot; rel=&quot;nofollow&quot;&gt;Tween&lt;/a&gt;"},{"from_user_id_str":"197459334","profile_image_url":"http://a3.twimg.com/profile_images/1210698414/shiratorishoko_normal.png","created_at":"Fri, 25 Feb 2011 17:37:31 +0000","from_user":"SyokoShiratori","id_str":"41190064243478528","metadata":{"result_type":"recent"},"to_user_id":null,"text":"+0.50kg \u540c\u3058\u304f\u30c0\u30a4\u30a8\u30c3\u30c8\u4e2d\u3067\u3059\u3002\u3088\u304f\u3053\u306e\u30b5\u30a4\u30c8\u3067\u4f53\u91cd\u5831\u544a\u3057\u3066\u307e\u3059\u266a http://bit.ly/fhN2fM RT @msophiah \u3046\u3046\u3046\u30fb\u30fb\u30fb\u304a\u8179\u3059\u3044\u305f\u301c\u30fb\u30fb\u30fb\u6211\u6162\u3001\u6211\u6162\u3001\u6211\u6162\u3002\u30c0\u30a4\u30a8\u30c3\u30c8\u3001\u30c0\u30a4\u30a8\u30c3\u30c8\u3001\u30c0\u30a4\u30a8\u30c3\u30c8\u3002","id":41190064243478528,"from_user_id":197459334,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://mob-mc.com&quot; rel=&quot;nofollow&quot;&gt;\uff08\u4eee\u79f0\uff09\u30c4\u30a4\u30af\u30ea\u30c3\u30af twiclick&lt;/a&gt;"},{"from_user_id_str":"180410237","profile_image_url":"http://a3.twimg.com/profile_images/1254473979/icon_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:30 +0000","from_user":"ka_ph","id_str":"41190062184079360","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u5b9a\u671fpost\u3011\u30d5\u30a7\u30eb\u30c7\u30a3\u30ca\u30f3\u30c8bot( http://twitter.com/ferdinand_bot )\u4f5c\u308a\u307e\u3057\u305f\u3002\u304a\u5b50\u69d8\u306e\u540d\u524d\u304a\u501f\u308a\u3055\u305b\u3066\u304f\u308c\u308b\u65b9\u3044\u307e\u3057\u305f\u3089@ka_ph\u307e\u3067\u304a\u9858\u3044\u3057\u307e\u3059\u3002","id":41190062184079360,"from_user_id":180410237,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twittbot.net/&quot; rel=&quot;nofollow&quot;&gt;twittbot.net&lt;/a&gt;"},{"from_user_id_str":"52283906","profile_image_url":"http://a3.twimg.com/profile_images/387644016/10100654519_s_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:26 +0000","from_user":"rolling_bean","id_str":"41190043313913856","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3081\u307e\u3044\u304c\u3057\u307e\u3059\u306d\u301cRT @yurikalin:\u30b3\u30a4\u30c4\u30e9\u5168\u54e1\u3044\u306a\u304f\u306a\u3063\u305f\u3089\u3001\u660e\u308b\u304f\u306a\u308b\u3060\u308d\u3046\u306a\u3041\uff5e\u266a\uff1e\u65e5\u672c\u306e\u30d3\u30b8\u30e7\u30f3 RT roll \u65e5\u7d4c\uff06CSIS\u30b7\u30f3\u30dd\u30b8\u30a6\u30e0\u300c\u5b89\u4fdd\u6539\u5b9a50\u5468\u5e74\u3001\u3069\u3046\u306a\u308b\u65e5\u7c73\u95a2\u4fc2\u300d http://bit.ly/dES8PY\u3000http://bit.ly/ihg0GT","id":41190043313913856,"from_user_id":52283906,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://tabtter.jp&quot; rel=&quot;nofollow&quot;&gt;\u30bf\u30d6\u30c3\u30bf\u30fc&lt;/a&gt;"},{"from_user_id_str":"351896","profile_image_url":"http://a3.twimg.com/profile_images/1179865336/icon12911887173020_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:26 +0000","from_user":"cicada","id_str":"41190043292925952","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4e2d\u5b66\u53d7\u9a13\u7a0b\u5ea6\u306e\u7b97\u6570\u306e\u554f\u984c\u3092\u51fa\u3059BOT http://twitter.com/arithmetic_bot \u6c17\u306b\u306f\u306a\u308b\u304c\u3001\u3061\u3083\u3093\u3068\u898b\u308b\u65e5\u304c\u6765\u308b\u3060\u308d\u3046\u304b\u30fb\u30fb\u3000#tearai\uff1a\u30ed\u30b3\u30e9\u30dc\u5bae\u5d0e\u770c http://locolabo.com/mz/ #mzlf","id":41190043292925952,"from_user_id":351896,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://locolabo.com/mz/&quot; rel=&quot;nofollow&quot;&gt;\u30ed\u30b3\u30e9\u30dc\u5bae\u5d0e\u770c&lt;/a&gt;"},{"from_user_id_str":"744554","profile_image_url":"http://a1.twimg.com/profile_images/1088753125/11868894_normal.gif","created_at":"Fri, 25 Feb 2011 17:37:20 +0000","from_user":"Febreze","id_str":"41190019020505088","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30cd\u30bf\u30d0\u30ec\u3042\u307e\u308a\u6c17\u306b\u3057\u306a\u3044\u30bf\u30a4\u30d7\u3060\u3051\u3069\u306a\u3093\u304b\u3053\u3046Twitter\u958b\u304f\u3060\u3051\u3067\u30ac\u30f3\u30ac\u30f3\u30cd\u30bf\u30d0\u30ec\u5165\u3063\u3066\u304f\u308b\u306e\u306f\u306a\u3093\u3068\u3082\u8a00\u3048\u306a\u3044\u306a\u3002","id":41190019020505088,"from_user_id":744554,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"203371794","profile_image_url":"http://a1.twimg.com/profile_images/1226537594/___normal.png","created_at":"Fri, 25 Feb 2011 17:37:16 +0000","from_user":"himeko24","id_str":"41190004139114496","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6b21\u3044\u3063\u3066\u307f\u3088\u30fc\u3000\u306f\u3044\u3053\u308c\u3000 \u6fc0\u5b89\u26052010\u5e74\u590f\u65b0\u30c7\u30b6\u30a4\u30f3\u2605\u30bb\u30af\u30b7\u30fc\u306a\u9023\u4f53\u5f0f\u7121\u5730\u6c34\u7740 \u80f8\u30d1\u30c3\u30c9\u4ed8\u304dQ122 http://bit.ly/h72C4i","id":41190004139114496,"from_user_id":203371794,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.google.co.jp&quot; rel=&quot;nofollow&quot;&gt;himeko24&lt;/a&gt;"},{"from_user_id_str":"119988932","profile_image_url":"http://a3.twimg.com/profile_images/1214344633/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:16 +0000","from_user":"7na_love_6sa","id_str":"41190002000007169","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30d6\u30ed\u30b0\u66f4\u65b0\u3057\u307e\u3057\u305f\uff01Twitter\uff06mixi\u304b\u3089\u3082\u30b3\u30e1\u30f3\u30c8\u5b9c\u3057\u304f\u306d\u266a\n\u300c\u30cd\u30a4\u30eb\u30c1\u30a7\u30f3\u30b8\u266a\u300d http://amba.to/hy0Do2","id":41190002000007169,"from_user_id":119988932,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"217408835","profile_image_url":"http://a1.twimg.com/profile_images/1215428655/____4.0157_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:12 +0000","from_user":"nikubenki1123","id_str":"41189985424125952","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @x68k: \u57fa\u672c\u7684\u306bTwitter\u4e0a\u3067\u306f&quot;\u597d\u304d\u306b\u3084\u308c\u3070\u3044\u3044&quot;\u3060\u3051\u3069\u3001\u540d\u524d\u3082\u30a2\u30a4\u30b3\u30f3\u3082\u30a2\u30f3\u30bf\u3058\u3083\u306a\u3044\u305f\u304f\u3055\u3093\u306e\u4eba\u305f\u3061\u306e\u9b42\u304c\u3053\u3082\u3063\u305f\u3082\u306e\u306a\u306e\u3060\u304b\u3089\u3001\u305d\u308c\u3060\u3051\u306f&quot;\u80cc\u8ca0\u3048&quot;\u3068\u601d\u3046\uff1e\u30ad\u30e3\u30e9\u30af\u30bf\u30fc\u30a2\u30ab\u30a6\u30f3\u30c8","id":41189985424125952,"from_user_id":217408835,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://tweetlogix.com&quot; rel=&quot;nofollow&quot;&gt;Tweetlogix&lt;/a&gt;"},{"from_user_id_str":"139137996","profile_image_url":"http://a0.twimg.com/profile_images/1087408006/cut_work_18_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:12 +0000","from_user":"fujiokayouko","id_str":"41189984354566144","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u591c\u4e2d\u306bTwitter\u3092\u306a\u3093\u3068\u306a\u304f\u8997\u3044\u305f\u3089\u3082\u306e\u3059\u3054\u3044\u307e\u3069\u30de\u30aeTL\u3067","id":41189984354566144,"from_user_id":139137996,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://mobile.twitter.com&quot; rel=&quot;nofollow&quot;&gt;Mobile Web&lt;/a&gt;"},{"from_user_id_str":"61221002","profile_image_url":"http://a3.twimg.com/profile_images/554916301/_1259757374_61_normal.png","created_at":"Fri, 25 Feb 2011 17:37:08 +0000","from_user":"hiromk63","id_str":"41189970613903360","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @kenji_kohashi \u7121\u4e8b\u6620\u753b\u88fd\u4f5c\u306e\u5831\u544a\u306f\u3067\u304d\u305f\u3051\u3069\u4eca\u3060\u7de8\u96c6\u306f\u7d9a\u3044\u3066\u307e\u3059w \u305d\u3093\u306a\u3068\u3053\u3067 \u6620\u753b\u300cDON'T STOP!\u300d\u306eTwitter \u30a2\u30ab\u30a6\u30f3\u30c8 @DONTSTOPMOVIE \u3082\u958b\u59cb\u3001\u3082\u3057\u826f\u304b\u3063\u305f\u3089\u30d5\u30a9\u30ed\u30fc\u3057\u3066\u304f\u3060\u3055\u3044\uff01\u50d5\u3082\u542b\u3081\u6620\u753b\u88fd\u4f5c\u95a2\u4fc2\u8005\u304c\u6c17\u9577\u306b\u3064\u3076\u3084\u304d\u307e\u3059","id":41189970613903360,"from_user_id":61221002,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.hootsuite.com&quot; rel=&quot;nofollow&quot;&gt;HootSuite&lt;/a&gt;"},{"from_user_id_str":"147393812","profile_image_url":"http://a1.twimg.com/profile_images/1114001122/hana_10_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:07 +0000","from_user":"tubasa_uki","id_str":"41189965924667392","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\uff10\uff10\uff17\u3082\u3073\u3063\u304f\u308a\u3000\u5927\u56fd\u306e\u5927\u7d71\u9818\u9078\u304b\u3089\u3000\u5cf6\u56fd\u306e\u5730\u65b9\u9078\u306e\u9078\u6319\u307e\u3067\u306b\u3082\u3000\u6697\u8e8d\u3057\u3066\u3044\u308b\uff3e\uff3e\u3000\u3053\u306eTwitter \u30b9\u30ad\u30e3\u30f3\u30c0\u30eb\u3084\u60aa\u8cea\u306a\u4e8b\u4ef6\u306b\u3082\u7d61\u3080\u304c\u3000Twitter\u304b\u3089\u767a\u4fe1\u3055\u308c\u305f\u3000\u5e73\u548c\u3078\u306e\u8ca2\u732e\u306f\u3000\u307e\u3055\u306b\u30ce\u30fc\u3079\u30eb\u5e73\u548c\u8cde\u3082\u306e http://bit.ly/esjWDG #dotubo_ss","id":41189965924667392,"from_user_id":147393812,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twittbot.net/&quot; rel=&quot;nofollow&quot;&gt;twittbot.net&lt;/a&gt;"},{"from_user_id_str":"96081746","profile_image_url":"http://a0.twimg.com/profile_images/1244505419/illust832_normal.png","created_at":"Fri, 25 Feb 2011 17:37:07 +0000","from_user":"kazukt","id_str":"41189963131387904","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3046\u308b\u304a\u307c\u7d75\u3001\u4ed6\u306e\u4eba\u306e\u3082\u898b\u3066\u3044\u305f\u3089\u3084\u305f\u3089\u30de\u30f3\u30ac\u306e\u30ad\u30e3\u30e9\u30af\u30bf\u30fc\u3067\u3080\u3061\u3083\u304f\u3061\u3083\u4e0a\u624b\u3044\u4eba\u304c\uff01\u2026\u3068\u3001\u30d7\u30ed\u30d5\u30a3\u30fc\u30eb\u898b\u305f\u3089\u3001\u306a\u3093\u3068\u3054\u672c\u4eba\u304c\u66f8\u3044\u3066\u3044\u3089\u3063\u3057\u3083\u3063\u305f\u3002Twitter\u3063\u3066\u30b9\u30b4\u30a4\u308f\u3002","id":41189963131387904,"from_user_id":96081746,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://janetter.net/&quot; rel=&quot;nofollow&quot;&gt;Janetter&lt;/a&gt;"},{"from_user_id_str":"86306230","profile_image_url":"http://a1.twimg.com/profile_images/593004766/j2j_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:03 +0000","from_user":"excite_j2j","id_str":"41189949927596032","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u79c1\u306f\u3001\u65e9\u7a32\u7530\u5927\u5b66\u30aa\u30fc\u30d7\u30f3\u30ab\u30ec\u30c3\u30b8\u306e\u5b66\u751f\u306e\u8003\u3048\u3066\u3044\u308b\u3001\u5352\u696d\u751fSoudai /\u65e9\u7a32\u7530\u30ab\u30fc\u30c9\u4f1a\u54e1/ Soudai\u5b66\u751f\u89aa/\u3001\u8ab0\u304b\u304c\u30aa\u30fc\u30d7\u30f3\u30ab\u30ec\u30c3\u30b8\u65e9\u7a32\u7530\u5927\u5b662000\u5186\u306e\u5165\u5834\u6599\u306e\u30e1\u30f3\u30d0\u30fc\u3092\u7d39\u4ecb\u3057\u3066\u304f\u308c\u305f\u65b9\u304c\u305a\u3063\u3068\u5b89\u4e0a\u304c\u308a\u3060\u3002 (\u5143\u767a\u8a00 http://bit.ly/esxiwT )","id":41189949927596032,"from_user_id":86306230,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://d.hatena.ne.jp/fn7&quot; rel=&quot;nofollow&quot;&gt;\u65e5\u672c\u8a9e\u65e5\u672c\u8a9e\u7ffb\u8a33\u30b8\u30a7\u30cd\u30ec\u30fc\u30bf&lt;/a&gt;"},{"from_user_id_str":"120927161","profile_image_url":"http://a0.twimg.com/profile_images/1230006483/20110131_13022_26776_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:00 +0000","from_user":"FRISKFOSSILFANG","id_str":"41189933855158272","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @syu_thi_bot: \u3044\u3064\u307e\u3067Twitter\u3084\u3063\u3066\u308b\u3093\u3060\u3044\uff1f\u3044\u3044\u52a0\u6e1b\u73fe\u5b9f\u306b\u623b\u308a\u306a\u3088\u3002\u3053\u3053\u306f\u30ad\u30df\u305f\u3061\u4e09\u6b21\u5143\u306e\u4eba\u9593\u304c\u3044\u308b\u3079\u304d\u5834\u6240\u3058\u3083\u306a\u3044\u3093\u3060\u3088\u3002\u305d\u3093\u306a\u306e\u57fa\u672c\u3060\u308d\uff01\uff01","id":41189933855158272,"from_user_id":120927161,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twittbot.net/&quot; rel=&quot;nofollow&quot;&gt;twittbot.net&lt;/a&gt;"},{"from_user_id_str":"228973151","profile_image_url":"http://a1.twimg.com/sticky/default_profile_images/default_profile_0_normal.png","created_at":"Fri, 25 Feb 2011 17:36:59 +0000","from_user":"daisuke1589","id_str":"41189931887890432","metadata":{"result_type":"recent"},"to_user_id":null,"text":"twitter\u3063\u3066\u52dd\u624b\u306b\u30d5\u30a9\u30ed\u30fc\u3057\u3066\u3082\u3044\u3044\u3093\u3060\u3063\u3051\uff1f","id":41189931887890432,"from_user_id":228973151,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"54314110","profile_image_url":"http://a2.twimg.com/profile_images/1193541240/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:57 +0000","from_user":"Alohazuki","id_str":"41189922668953600","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Twitter\u306e\u5e83\u5cf6\u5f01\u3082\u3042\u3063\u305f\u3093\u3060\u306d\u3002","id":41189922668953600,"from_user_id":54314110,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.flight.co.jp/iPhone/TweetMe/&quot; rel=&quot;nofollow&quot;&gt;TweetMe for iPhone&lt;/a&gt;"},{"from_user_id_str":"72594681","profile_image_url":"http://a3.twimg.com/profile_images/1227240916/____normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:56 +0000","from_user":"uri4ichi","id_str":"41189916922744832","metadata":{"result_type":"recent"},"to_user_id":226852303,"text":"@7_fuka Twitter\u304b\u3076\u308c\u306f\u3001\u3059\u3050\u306bD\u306b\u8d70\u308b\u306e\u3067\u3002\u306a\u3093\u3060\u304b\u5fae\u7b11\u307e\u3057\u3044\u306e\u3067\u3059( \u2579\u25e1\u2579)","id":41189916922744832,"from_user_id":72594681,"to_user":"7_fuka","geo":null,"iso_language_code":"ja","to_user_id_str":"226852303","source":"&lt;a href=&quot;http://sites.google.com/site/yorufukurou/&quot; rel=&quot;nofollow&quot;&gt;YoruFukurou&lt;/a&gt;"},{"from_user_id_str":"168393854","profile_image_url":"http://a3.twimg.com/profile_images/1253554518/GuNp3xVS_normal","created_at":"Fri, 25 Feb 2011 17:36:55 +0000","from_user":"makonyanhime","id_str":"41189913701515264","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6589\u85e4\u3055\u3093\u3082\u30c0\u30e1\u3060...\u4eca\u591c\u306fTwitter\u5909\u3060\u306a\u3041(;_;)","id":41189913701515264,"from_user_id":168393854,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://mobile.twitter.com&quot; rel=&quot;nofollow&quot;&gt;Twitter for Android&lt;/a&gt;"},{"from_user_id_str":"122636787","profile_image_url":"http://a2.twimg.com/profile_images/1189607563/DSC01987_normal.JPG","created_at":"Fri, 25 Feb 2011 17:36:54 +0000","from_user":"enpy1217","id_str":"41189908500594688","metadata":{"result_type":"recent"},"to_user_id":null,"text":"twitter\u4e45\u3057\u3076\u308a\u306b\u958b\u3044\u305f\u3002\u3068\u3066\u3082\u591a\u5fd9\u3060\u3063\u305f\u3002\u75b2\u308c\u305f\u3002\u304a\u98a8\u5442\u306b\u3082\u5165\u308c\u306a\u304b\u3063\u305f\u3002\u30ad\u30bf\u30cd\u2026","id":41189908500594688,"from_user_id":122636787,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.flight.co.jp/iPhone/TweetMe/&quot; rel=&quot;nofollow&quot;&gt;TweetMe for iPhone&lt;/a&gt;"},{"from_user_id_str":"81663694","profile_image_url":"http://a3.twimg.com/profile_images/1177576126/__normal.png","created_at":"Fri, 25 Feb 2011 17:36:51 +0000","from_user":"progmiya","id_str":"41189895494049792","metadata":{"result_type":"recent"},"to_user_id":94050844,"text":"@hirasai_skyhigh \u6674\u308c\u541b\u3002\u30cd\u30bf\u30d0\u30ec\u306f\u898b\u305f\u304f\u306a\u3044\u3051\u3069\u30012ch\u3082twitter\u3082\u3084\u308a\u305f\u3044\u306e\u304c\u4eba\u3068\u8a00\u3046\u3082\u306e\u3088","id":41189895494049792,"from_user_id":81663694,"to_user":"hirasai_skyhigh","geo":null,"iso_language_code":"ja","to_user_id_str":"94050844","source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"159237469","profile_image_url":"http://a3.twimg.com/profile_images/1140433484/______2_normal.png","created_at":"Fri, 25 Feb 2011 17:36:50 +0000","from_user":"hikari_juku","id_str":"41189892096532480","metadata":{"result_type":"recent"},"to_user_id":135634241,"text":"@sssukimasuky \n\u4f55\u304b\u3042\u3063\u305f\u98a8\u3067\u3059\u306d\uff08\u7b11\uff09\u3000\u78ba\u304b\u306bTwitter\u306f\u6c17\u8efd\u3067\u3059\u3057\u306d\u3002\u30e1\u30fc\u30eb\u306b\u306a\u308b\u3068\u30d5\u30c3\u30c8\u30ef\u30fc\u30af\u304c\u91cd\u304f\u306a\u308b\u5834\u5408\u3082\u3042\u308b\u304b\u3082\u3057\u308c\u307e\u305b\u3093\u306d\u3002\u305d\u3046\u8003\u3048\u308b\u3068\u3059\u3054\u3044\u6642\u4ee3\u3060\u3002","id":41189892096532480,"from_user_id":159237469,"to_user":"sssukimasuky","geo":null,"iso_language_code":"ja","to_user_id_str":"135634241","source":"&lt;a href=&quot;http://www.hootsuite.com&quot; rel=&quot;nofollow&quot;&gt;HootSuite&lt;/a&gt;"},{"from_user_id_str":"141915990","profile_image_url":"http://a0.twimg.com/profile_images/1248969898/icon679566266564378764images_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:48 +0000","from_user":"adashino_","id_str":"41189886878949376","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @fuefukioyasumi: \u3082\u3046\u3044\u3044\u3002\u300c\u671d\u751f\u300d\u306a\u3093\u304b\u3044\u3044\u3002BBC\u3082CNN\u3082\u82f1\u8a9e\u653e\u9001\u3060\u3002\u307f\u3093\u306a\u3001\u30c6\u30ec\u30d3\u3092\u3076\u3061\u3063\u3068\u5207\u3063\u3066Twitter\u3092\u898b\u3088\u3046\u3002\u3053\u3053\u306b\u300c\u751f\u304d\u305f\u60c5\u5831\u300d\u304c\u6d41\u308c\u3066\u3044\u308b\u3002\u300c\u751f\u304d\u305f\u53eb\u3073\u300d\u304c\u3042\u308b\u3002\u3053\u3053\u304b\u3089\u3067\u3082\u6b74\u53f2\u306e\u8ee2\u63db\u70b9\u3092\u611f\u3058\u308b\u4e8b\u304c\u3067\u304d\u308b\u306e\u3060\u3002 @gjmorley #libjp","id":41189886878949376,"from_user_id":141915990,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"111308629","profile_image_url":"http://a1.twimg.com/profile_images/1137421845/mmooton_normal.png","created_at":"Fri, 25 Feb 2011 17:36:46 +0000","from_user":"mmooton","id_str":"41189877940748288","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @minponjp: \u3010\u3064\u3076\u3084\u304f\u3060\u3051\u306710000\u5186\u5546\u54c1\u5238GET\u3011&lt;&lt;visa\u30ae\u30d5\u30c8\u30ab\u30fc\u30c910000\u5186\u5206\u3092\u6bce\u6708\u62bd\u9078\u3067\u30d7\u30ec\u30bc\u30f3\u30c8&gt;&gt; \u21d2\u8a73\u3057\u304f\u306f\u4e0b\u306e\uff35\uff32\uff2c\u3088\u308a\u2193\u2193\u2193\u2193\u2193 http://minpon.jp/user_data/twitter_campaign.php","id":41189877940748288,"from_user_id":111308629,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twittbot.net/&quot; rel=&quot;nofollow&quot;&gt;twittbot.net&lt;/a&gt;"},{"from_user_id_str":"140945098","profile_image_url":"http://a0.twimg.com/profile_images/1198948281/b7664c71-87bc-4187-9d46-a61ab8d41b96_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:46 +0000","from_user":"waruimayuko","id_str":"41189877122867200","metadata":{"result_type":"recent"},"to_user_id":113371008,"text":"@toumeisyoujyo \u3042\u3053\u3061\u3083\u3093Twitter\u3084\u3063\u3066\u305f\u306e\u306d\u3002\u307e\u3060\u304a\u5e2d\u3042\u308b\u305d\u3046\u306a\u306e\u3067\u662f\u975e\uff01","id":41189877122867200,"from_user_id":140945098,"to_user":"toumeisyoujyo","geo":null,"iso_language_code":"ja","to_user_id_str":"113371008","source":"&lt;a href=&quot;http://twimi.jp/?r=via&quot; rel=&quot;nofollow&quot;&gt;twimi\u2606new&lt;/a&gt;"},{"from_user_id_str":"167512527","profile_image_url":"http://a1.twimg.com/profile_images/1172286365/newspaper_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:45 +0000","from_user":"KoranKaget","id_str":"41189871775252480","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://bit.ly/93Eeud RT @motocentrism \u30d6\u30ed\u30b0\u8a18\u4e8b\u66f8\u304d\u307e\u3057\u305f\u30fc\uff1a MotoGP\u3000\u30d6\u30c3\u30af\u30e1\u30fc\u30ab\u30fc\u306b\u898b\u308b\u5404\u30e9\u30a4\u30c0\u30fc\u306e\u4e0b\u99ac\u8a55 - http://goo.gl/xVe6... http://bit.ly/hDYxyx @motogpudpate","id":41189871775252480,"from_user_id":167512527,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"160251772","profile_image_url":"http://a3.twimg.com/profile_images/1150692471/_____normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:45 +0000","from_user":"keikochaki","id_str":"41189870781075456","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u300c\u305a\u3063\u3068twitter\u3084\u3063\u3066\u308b\u3088\u306d\u300d\u3068\u6012\u3089\u308c\u3066\u3057\u307e\u3063\u305f(\u82e6\u7b11)","id":41189870781075456,"from_user_id":160251772,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twtr.jp&quot; rel=&quot;nofollow&quot;&gt;Keitai Web&lt;/a&gt;"},{"from_user_id_str":"211565766","profile_image_url":"http://a2.twimg.com/sticky/default_profile_images/default_profile_5_normal.png","created_at":"Fri, 25 Feb 2011 17:36:42 +0000","from_user":"sayap1yo","id_str":"41189858236043264","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u304a\u98df\u4e8b\u4f1a\u884c\u304d\u305f\u304b\u3063\u305f\u3051\u3069\n\u53cb\u9054\u3068\u904a\u3093\u3067\u307e\u3093\u305f\ue056\ue326\n\nTwitter\u898b\u3066\u307e\u3057\u305f\u3051\u3069\n\u3064\u3076\u3084\u304f\u30bf\u30a4\u30df\u30f3\u30b0\n\u5931\u3063\u3066\u305f\u3060\u3051\u3067\u3059( \u00b4 \u25bd ` )\uff89\u7b11","id":41189858236043264,"from_user_id":211565766,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.nibirutech.com&quot; rel=&quot;nofollow&quot;&gt;TwitBird&lt;/a&gt;"},{"from_user_id_str":"19603191","profile_image_url":"http://a1.twimg.com/profile_images/1254077264/116_normal.gif","created_at":"Fri, 25 Feb 2011 17:36:40 +0000","from_user":"Purple_Flash","id_str":"41189851873157120","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @syu_thi_bot: \u3044\u3064\u307e\u3067Twitter\u3084\u3063\u3066\u308b\u3093\u3060\u3044\uff1f\u3044\u3044\u52a0\u6e1b\u73fe\u5b9f\u306b\u623b\u308a\u306a\u3088\u3002\u3053\u3053\u306f\u30ad\u30df\u305f\u3061\u4e09\u6b21\u5143\u306e\u4eba\u9593\u304c\u3044\u308b\u3079\u304d\u5834\u6240\u3058\u3083\u306a\u3044\u3093\u3060\u3088\u3002\u305d\u3093\u306a\u306e\u57fa\u672c\u3060\u308d\uff01\uff01","id":41189851873157120,"from_user_id":19603191,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twittbot.net/&quot; rel=&quot;nofollow&quot;&gt;twittbot.net&lt;/a&gt;"},{"from_user_id_str":"215930291","profile_image_url":"http://a0.twimg.com/profile_images/1247906106/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:30 +0000","from_user":"minori_millie","id_str":"41189810055938048","metadata":{"result_type":"recent"},"to_user_id":212972774,"text":"@c_c_chika \u7b11\u3063\u3066\u305d\u3046\u3060\u306a\u3063\u3066\u601d\u3063\u3066\u305f(o^^o)\u30c1\u30ab\u306e\u7b11\u3044\u58f0\u304c\u805e\u3053\u3048\u3066\u304d\u305f\u3082\u3093\u3002mail\u306bTwitter\u3067\u5927\u5fd9\u3057\u3084\u3002","id":41189810055938048,"from_user_id":215930291,"to_user":"c_c_chika","geo":null,"iso_language_code":"ja","to_user_id_str":"212972774","source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"197459334","profile_image_url":"http://a3.twimg.com/profile_images/1210698414/shiratorishoko_normal.png","created_at":"Fri, 25 Feb 2011 17:36:30 +0000","from_user":"SyokoShiratori","id_str":"41189809586311168","metadata":{"result_type":"recent"},"to_user_id":null,"text":"+0.90kg \u30c0\u30a4\u30a8\u30c3\u30c8\u5fdc\u63f4\u3057\u3066\u307e\u3059\u3002(*^^*)\u30c0\u30a4\u30a8\u30c3\u30c8\u4f53\u91cd\u5831\u544a\u306e\u3064\u3076\u3084\u304d\u3067\u3059\u3002 http://bit.ly/fhN2fM RT @hayayumi \u3053\u3093\u306a\u6642\u9593\u306b\u3084\u304d\u306b\u304f\u30fc\u266b\u30c0\u30a4\u30a8\u30c3\u30c8\u671f\u9593\u306a\u306e\u306b\u306d....","id":41189809586311168,"from_user_id":197459334,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://mob-mc.com&quot; rel=&quot;nofollow&quot;&gt;\uff08\u4eee\u79f0\uff09\u30c4\u30a4\u30af\u30ea\u30c3\u30af twiclick&lt;/a&gt;"},{"from_user_id_str":"12337665","profile_image_url":"http://a0.twimg.com/profile_images/1146194926/pixiv-icon_normal.png","created_at":"Fri, 25 Feb 2011 17:36:27 +0000","from_user":"t_a_k_i","id_str":"41189797364121600","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Google\u30ea\u30fc\u30c0\u30fc\u3067\u30b5\u30a4\u30c8\u306e\u66f4\u65b0\u30c1\u30a7\u30c3\u30af\u3059\u308b\u3088\u308a\u3001Twitter\u30a2\u30ab\u30a6\u30f3\u30c8\u3092\u30d5\u30a9\u30ed\u30fc\u3057\u3066\u66f4\u65b0\u3092\u77e5\u308b\u307b\u3046\u304c\u4fbf\u5229\u3060\u306a\u3053\u308c","id":41189797364121600,"from_user_id":12337665,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://sites.google.com/site/yorufukurou/&quot; rel=&quot;nofollow&quot;&gt;YoruFukurou&lt;/a&gt;"},{"from_user_id_str":"104862453","profile_image_url":"http://a3.twimg.com/profile_images/1248609864/Image014_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:25 +0000","from_user":"yuz_ume","id_str":"41189787943714816","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @fuefukioyasumi: \u3082\u3046\u3044\u3044\u3002\u300c\u671d\u751f\u300d\u306a\u3093\u304b\u3044\u3044\u3002BBC\u3082CNN\u3082\u82f1\u8a9e\u653e\u9001\u3060\u3002\u307f\u3093\u306a\u3001\u30c6\u30ec\u30d3\u3092\u3076\u3061\u3063\u3068\u5207\u3063\u3066Twitter\u3092\u898b\u3088\u3046\u3002\u3053\u3053\u306b\u300c\u751f\u304d\u305f\u60c5\u5831\u300d\u304c\u6d41\u308c\u3066\u3044\u308b\u3002\u300c\u751f\u304d\u305f\u53eb\u3073\u300d\u304c\u3042\u308b\u3002\u3053\u3053\u304b\u3089\u3067\u3082\u6b74\u53f2\u306e\u8ee2\u63db\u70b9\u3092\u611f\u3058\u308b\u4e8b\u304c\u3067\u304d\u308b\u306e\u3060\u3002 @gjmorley #libjp","id":41189787943714816,"from_user_id":104862453,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"213846746","profile_image_url":"http://a1.twimg.com/profile_images/1242263342/haruhi1_normal.png","created_at":"Fri, 25 Feb 2011 17:36:23 +0000","from_user":"sloth888jpgame","id_str":"41189778409922560","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u643a\u5e2f\u96fb\u8a71\u7528\u306eTwitter\u3092\u5229\u7528\u3057\u305f\u30b2\u30fc\u30e0\u3092\u77e5\u3063\u3066\u3044\u308b\u4eba\u306f\u3001\u7d39\u4ecb\u3057\u3066\u304f\u3060\u3055\u3044\u3002 #TwitterGame","id":41189778409922560,"from_user_id":213846746,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twittbot.net/&quot; rel=&quot;nofollow&quot;&gt;twittbot.net&lt;/a&gt;"},{"from_user_id_str":"17484724","profile_image_url":"http://a2.twimg.com/profile_images/1138677235/iconue_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:22 +0000","from_user":"tsutcho","id_str":"41189777831231490","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30a2\u30aa\u30b7\u30de\u3055\u3093twitter\u306b\u7acb\u3064\u30fb\u30fb\u30fb\u3060\u3068\u30fb\u30fb\u30fb\uff1f\uff12\u756a\u76ee\u306e\u30d5\u30a9\u30ed\u30ef\u30fc\u306e\u5ea7\u3092\u3044\u305f\u3060\u3044\u3066\u304a\u3053\u3046","id":41189777831231490,"from_user_id":17484724,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"220041064","profile_image_url":"http://a1.twimg.com/sticky/default_profile_images/default_profile_0_normal.png","created_at":"Fri, 25 Feb 2011 17:36:21 +0000","from_user":"sloth888jp_bot5","id_str":"41189772521254914","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6642\u3005\u3001TwiAll\uff08\u30c4\u30a4\u30aa\u30fc\u30eb\uff09\u3067Twitter\u306e\u81ea\u52d5\u30d5\u30a9\u30ed\u30fc\u30fb\u30d5\u30a9\u30ed\u30fc\u8fd4\u3057\u3092\u3057\u3066\u3044\u307e\u3059\u3002","id":41189772521254914,"from_user_id":220041064,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twittbot.net/&quot; rel=&quot;nofollow&quot;&gt;twittbot.net&lt;/a&gt;"},{"from_user_id_str":"177693537","profile_image_url":"http://a0.twimg.com/profile_images/1240130924/20110207213206_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:21 +0000","from_user":"Na_Okinawa","id_str":"41189769912397824","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @ebizo66: \u30ea\u30d3\u30a2\u30fb\u30c8\u30ea\u30dd\u30ea\u306eTw\uff1a\u6551\u6025\u8eca\u304c\u6765\u305f\u304c\u3001\u8ca0\u50b7\u8005\u3092\u8eca\u5185\u3067\u6bba\u5bb3\u3057\u3066\u3044\u305f\u3001\u3068\u3002\uff08\u6ec5\u8336\u82e6\u8336\u3060\uff01\uff09http://ow.ly/43pQ2 #libjp","id":41189769912397824,"from_user_id":177693537,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.hootsuite.com&quot; rel=&quot;nofollow&quot;&gt;HootSuite&lt;/a&gt;"},{"from_user_id_str":"147006592","profile_image_url":"http://a2.twimg.com/profile_images/1251306448/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:19 +0000","from_user":"takasu_rika","id_str":"41189763532865536","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @kihirokiro: Twitter\u3067\u30cd\u30bf\u30d0\u30ec\u4e91\u3005\u3044\u3063\u3066\u3082\u5143\u3005Twitter\u3063\u3066\u300c\u500b\u4eba\u306e\u72ec\u308a\u8a00\u300d\u3060\u308d","id":41189763532865536,"from_user_id":147006592,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"100239985","profile_image_url":"http://a1.twimg.com/profile_images/733461294/CIMG0207_normal.JPG","created_at":"Fri, 25 Feb 2011 17:36:19 +0000","from_user":"strangebarjun","id_str":"41189762182152192","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Twitter\u3092\u59cb\u3081\u3066\u3001\u305d\u308d\u305d\u308d\u4e00\u5e74\u306b\u306a\u308a\u307e\u3059\u3002\u632f\u308a\u8fd4\u308b\u3068\u3001\u307c\u304f\u306e\u4eba\u9593\u6027\u3092\u305d\u3063\u304f\u308a\u53cd\u6620\u3059\u308b\u304c\u5982\u304f\u3001\u534a\u7aef\u3067\u3059\u306d\u3002\u60c5\u5831\u53ce\u96c6\u30c4\u30fc\u30eb\u3001\u60c5\u5831\u767a\u4fe1\u30c4\u30fc\u30eb\u3001\u30b3\u30df\u30e5\u30cb\u30b1\u30fc\u30b7\u30e7\u30f3\u30c4\u30fc\u30eb\u3001\u3069\u308c\u3082\u6a5f\u80fd\u3057\u5207\u308c\u3066\u3044\u306a\u3044\u306a\u3042\u3001\u3068\u3002\u305d\u3057\u3066\u3042\u308b\u306e\u306f\u300c\u3069\u3053\u304b\u3089\u3082\u76f8\u624b\u306b\u3055\u308c\u3066\u3044\u306a\u3044\u300d\u3068\u3044\u3046\u3001\u65e2\u77e5\u306e\u73fe\u5b9f\u3067\u3059\u3002","id":41189762182152192,"from_user_id":100239985,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.echofon.com/&quot; rel=&quot;nofollow&quot;&gt;Echofon&lt;/a&gt;"},{"from_user_id_str":"126390384","profile_image_url":"http://a2.twimg.com/profile_images/1176065038/nemunemu_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:18 +0000","from_user":"gesukapper","id_str":"41189757476286464","metadata":{"result_type":"recent"},"to_user_id":80935865,"text":"@tatsugorou \u306a\u3093\u304b\u4e16\u306e\u4e2d\u306b\u306f\u611a\u75f4\u3082\u4e0b\u30cd\u30bf\u3082\u8a00\u3044\u653e\u984c\u306etwitter\u3068\u3044\u3046\u3082\u306e\u304c\u3042\u308b\u305d\u3046\u3067\u3059\u3002","id":41189757476286464,"from_user_id":126390384,"to_user":"tatsugorou","geo":null,"iso_language_code":"ja","to_user_id_str":"80935865","source":"&lt;a href=&quot;http://janetter.net/&quot; rel=&quot;nofollow&quot;&gt;Janetter&lt;/a&gt;"},{"from_user_id_str":"196059029","profile_image_url":"http://a1.twimg.com/profile_images/1208831726/ruka2_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:17 +0000","from_user":"luka_m_bot","id_str":"41189756666777600","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u308f\u305f\u3057\u3082twitter\u306f\u3058\u3081\u307e\u3057\u305f","id":41189756666777600,"from_user_id":196059029,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www24.atpages.jp/aoi2/bot.php&quot; rel=&quot;nofollow&quot;&gt;\u5de1\u308b\u97f3&lt;/a&gt;"},{"from_user_id_str":"88135613","profile_image_url":"http://a3.twimg.com/profile_images/1088552877/P9280150_normal.JPG","created_at":"Fri, 25 Feb 2011 17:36:14 +0000","from_user":"Roko38","id_str":"41189740321587200","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\uff46\uff42\u306b\u30ed\u30b0\u30a4\u30f3\u3059\u308b\u6a5f\u4f1a\u304c\u65e5\u306b\u65e5\u306b\u5897\u3048\u3066\u304d\u305f\uff3e\uff3e \u6163\u308c\u3066\u304f\u308b\u3068\u3042\u3063\u3061\u306e\u304c\u9762\u767d\u3044\uff06\u4f7f\u3044\u52dd\u624b\u304c\u3044\u3044\u3088\u3046\u306a\u6c17\u304c\u3059\u308b\u3002\u8907\u5408\u7684\u306b\u8272\u3005\u51fa\u6765\u307e\u3059\u3088\u306d\u2026\u3063\u3066\u3001\u601d\u3063\u305f\u3053\u3068\u3092\u545f\u304f\u306e\u306fTwitter\u3060\u3063\u305f\u308a\u3067\u3059\u304c\u2026(^_^; \u305d\u3057\u3066\u81ea\u5206\u306e\u5834\u5408\u306f\u30c4\u30a4\u3068\u9023\u52d5\u3057\u3065\u3089\u3044\u72b6\u6cc1\u3060\u3063\u305f\u308a\u3067\u2026\u3002","id":41189740321587200,"from_user_id":88135613,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"110825211","profile_image_url":"http://a2.twimg.com/profile_images/1108977866/o_t_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:12 +0000","from_user":"kou_nanjyo","id_str":"41189731941363712","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @x68k: \u57fa\u672c\u7684\u306bTwitter\u4e0a\u3067\u306f&quot;\u597d\u304d\u306b\u3084\u308c\u3070\u3044\u3044&quot;\u3060\u3051\u3069\u3001\u540d\u524d\u3082\u30a2\u30a4\u30b3\u30f3\u3082\u30a2\u30f3\u30bf\u3058\u3083\u306a\u3044\u305f\u304f\u3055\u3093\u306e\u4eba\u305f\u3061\u306e\u9b42\u304c\u3053\u3082\u3063\u305f\u3082\u306e\u306a\u306e\u3060\u304b\u3089\u3001\u305d\u308c\u3060\u3051\u306f&quot;\u80cc\u8ca0\u3048&quot;\u3068\u601d\u3046\uff1e\u30ad\u30e3\u30e9\u30af\u30bf\u30fc\u30a2\u30ab\u30a6\u30f3\u30c8","id":41189731941363712,"from_user_id":110825211,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://tweetlogix.com&quot; rel=&quot;nofollow&quot;&gt;Tweetlogix&lt;/a&gt;"},{"from_user_id_str":"2095960","profile_image_url":"http://a2.twimg.com/profile_images/1248999075/majiresu2_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:10 +0000","from_user":"guldeen","id_str":"41189726945947648","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3042\u308a\u3083\u307e\u3041\u3002\u25bchttp://bit.ly/et4vVa \uff3b\u89d2\u5ddd\u66f8\u5e97\uff3d\u300c\u30b6\u30fb\u30b9\u30cb\u30fc\u30ab\u30fc\u300d\u4f11\u520a\u3078\u3000\u300c\u6dbc\u5bae\u30cf\u30eb\u30d2\u300d\u751f\u3093\u3060\u30e9\u30ce\u30d9\u96d1\u8a8c18\u5e74\u3067\u5e55 via http://twitter.com/lkj777","id":41189726945947648,"from_user_id":2095960,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"164121549","profile_image_url":"http://a1.twimg.com/profile_images/1251758789/m_108-07ae3_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:09 +0000","from_user":"hachi_touhi","id_str":"41189719299727360","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30cd\u30bf\u30d0\u30ec\u6c17\u306b\u3057\u3066\u305f\u3089Twitter\u3084\u3063\u3066\u3089\u308c\u306a\u3044ww","id":41189719299727360,"from_user_id":164121549,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twicca.r246.jp/&quot; rel=&quot;nofollow&quot;&gt;twicca&lt;/a&gt;"},{"from_user_id_str":"194494659","profile_image_url":"http://a3.twimg.com/profile_images/1249717822/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:08 +0000","from_user":"tomonattomo","id_str":"41189715415801856","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3046\u308f\u3001\u660e\u65e5\u671d\u304b\u3089\u30d0\u30a4\u30c8\u3084\u306e\u306b\u306a\u3093\u3060\u3053\u306e\u306d\u3075\u304b\u3057\u3002\u3042\u3001\u591c\u66f4\u304b\u3057\u3002\u30d1\u30d4\u30eb\u30b9\u3068BUMP\u3001\u3048\u307f\u3068Twitter\u306eDM\u3057\u3059\u304e\u305f\u306a\u2026","id":41189715415801856,"from_user_id":194494659,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://mixi.jp/promotion.pl?id=voice_twitter&quot; rel=&quot;nofollow&quot;&gt; mixi \u30dc\u30a4\u30b9 &lt;/a&gt;"},{"from_user_id_str":"97224364","profile_image_url":"http://a3.twimg.com/profile_images/1150074355/fb8bcca60d340862c053a756377bfae8_normal.jpeg","created_at":"Fri, 25 Feb 2011 17:36:06 +0000","from_user":"xxxheat","id_str":"41189709174677504","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Twitter\u5b8c\u5168\u306b\u30d0\u30b0\u3063\u3066\u308borz","id":41189709174677504,"from_user_id":97224364,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"}],"max_id":41190705623732224,"since_id":38643906774044672,"refresh_url":"?since_id=41190705623732224&q=twitter","next_page":"?page=2&max_id=41190705623732224&rpp=100&lang=ja&q=twitter","results_per_page":100,"page":1,"completed_in":0.093336,"warning":"adjusted since_id to 38643906774044672 (), requested since_id was older than allowed -- since_id removed for pagination.","since_id_str":"38643906774044672","max_id_str":"41190705623732224","query":"twitter"}
benchmarks/json-data/jp50.jsondeleted−1
@@ -1 +0,0 @@
1−{"results":[{"from_user_id_str":"2458313","profile_image_url":"http://a2.twimg.com/profile_images/1203653060/fure091226_normal.png","created_at":"Thu, 27 Jan 2011 20:30:04 +0000","from_user":"19princess","id_str":"30724239224995840","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6d77\u6674\u300c\u672c\u65e5\u306e\u6771\u4eac\u306e\u304a\u5929\u6c17\u306f\u6674\u6642\u3005\u66c7\u3067\u3057\u3087\u3046\u3002\u6700\u9ad8\u6c17\u6e29\u306f8\u5ea6\u3001\u6700\u4f4e\u6c17\u6e29\u306f1\u5ea6\u3067\u3059\u3002\u3042\u306a\u305f\u306e\u4eca\u65e5\u306e\u4eba\u751f\u306b\u3068\u3073\u3063\u304d\u308a\u306e\u304a\u5929\u6c17\u3092\u2665\u300d","id":30724239224995840,"from_user_id":2458313,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://babyprincess.sakura.ne.jp/about/&quot; rel=&quot;nofollow&quot;&gt;\u5929\u4f7f\u5bb6\u306e\u88cf\u5c71&lt;/a&gt;"},{"from_user_id_str":"66578965","profile_image_url":"http://a0.twimg.com/profile_images/1183763267/fossetta_normal.png","created_at":"Thu, 27 Jan 2011 20:00:04 +0000","from_user":"Fossetta_Tokyo","id_str":"30716689779785729","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u304a\u306f\u3088\u3046\u3054\u3056\u3044\u307e\u3059!!\u6771\u4eac\u90fd\u3001\u672c\u65e5\u306e\u304a\u5929\u6c17\u306f\u6674\u6642\u3005\u66c7\u3002\u6700\u9ad8\u6c17\u6e298\u5ea6\u3001\u6700\u4f4e\u6c17\u6e291\u5ea6\u3002\u6771\u4eac\u5730\u65b9\u3067\u306f\u3001\u7a7a\u6c17\u306e\u4e7e\u71e5\u3057\u305f\u72b6\u614b\u304c\u7d9a\u3044\u3066\u3044\u307e\u3059\u3002\u706b\u306e\u53d6\u308a\u6271\u3044\u306b\u6ce8\u610f\u3057\u3066\u4e0b\u3055\u3044\u3002\u4f0a\u8c46\u8af8\u5cf6\u3068\u5c0f\u7b20\u539f\u8af8\u5cf6\u306b\u306f\u3001\u5f37\u98a8\u3001\u6ce2\u6d6a\u3001\u4e7e\u71e5\u3001\u971c\u306e\u6ce8\u610f\u5831\u3092\u767a\u8868\u4e2d\u3067\u3059\u3002","id":30716689779785729,"from_user_id":66578965,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://bit.ly/Fossetta&quot; rel=&quot;nofollow&quot;&gt;\u30d5\u30a9\u30bb\u30c3\u30bf ver.3.1.1&lt;/a&gt;"},{"from_user_id_str":"104041146","profile_image_url":"http://a2.twimg.com/profile_images/863965118/001jwatokyo_normal.jpg","created_at":"Thu, 27 Jan 2011 19:44:33 +0000","from_user":"jwa_tokyo","id_str":"30712787537756160","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6c17\u8c61\u5e81\u304b\u3089\u6771\u4eac\u306e\u5929\u6c17\u4e88\u5831\u304c\u767a\u8868\u3055\u308c\u307e\u3057\u305f\u3000\u305d\u306e\u5929\u6c17\u4e88\u5831\u3092\u3053\u3053\u3067\u3064\u3076\u3084\u3053\u3046\u304b\u306a\u3041\uff5e\uff1f\u3000\u8003\u3048\u4e2d\u3000\u307e\u3066\u6b21\u53f7\uff08\u7b11","id":30712787537756160,"from_user_id":104041146,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.docodemo.jp/twil/&quot; rel=&quot;nofollow&quot;&gt;Twil2 (Tweet Anytime, Anywhere by Mail)&lt;/a&gt;"},{"from_user_id_str":"144500192","profile_image_url":"http://a3.twimg.com/a/1294874399/images/default_profile_3_normal.png","created_at":"Thu, 27 Jan 2011 18:59:33 +0000","from_user":"kyo4to4","id_str":"30701462774358016","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u90fd \u516b\u4e08\u5cf6 - \u4eca\u65e5\u306e\u5929\u6c17\u306f\u30fb\u30fb\u30fb\u66c7\u306e\u3061\u6674\u3067\u3059\u306e\uff01","id":30701462774358016,"from_user_id":144500192,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/kyo4to4&quot; rel=&quot;nofollow&quot;&gt;lost-sheep-bot&lt;/a&gt;"},{"from_user_id_str":"165724582","profile_image_url":"http://a0.twimg.com/profile_images/1222842347/163087_1256281064506_1753997852_484926_2761052_n_normal.jpg","created_at":"Thu, 27 Jan 2011 17:39:06 +0000","from_user":"Rifqi_19931020","id_str":"30681213748387840","metadata":{"result_type":"recent"},"to_user_id":113796067,"text":"@CHLionRagbaby \u30b1\u30f3\u3061\u3083\u3093\u3001\u671d\u4eca\u307e\u3067\u306e\u81ea\u5206\u306e\u30db\u30fc\u30e0\u30a8\u30ea\u30a2\u304b\u3089\u307e\u3060\u975e\u5e38\u306b\u5bd2\u3044\u3068\u96e8\u304c\u964d\u3063\u3066\u3044\u305f..\u3069\u306e\u3088\u3046\u306b\u73fe\u5728\u306e\u6771\u4eac\u306e\u5929\u6c17\uff1f","id":30681213748387840,"from_user_id":165724582,"to_user":"CHLionRagbaby","geo":null,"iso_language_code":"ja","to_user_id_str":"113796067","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"120911929","profile_image_url":"http://a0.twimg.com/profile_images/772435076/20100312___capture2_normal.png","created_at":"Thu, 27 Jan 2011 17:28:30 +0000","from_user":"Cirno_fan","id_str":"30678546020040705","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u65e5\u306e\u6771\u4eac\u306e\u5929\u6c17\u306f\u3001\u66c7\u6642\u3005\u6674\u3067\u6700\u9ad8\u6c17\u6e29\u306f8\u2103\uff01 \u6700\u4f4e\u6c17\u6e29\u306f2\u2103\u3060\u3063\u305f\u3088\uff01 RT @mimi22999 \uff08\uff65\u2200\uff65\uff09\uff4c\u3001\u865a\u5f31\u306a\u8005\u306b\u3068\u3063\u3066\u3001\u6717\u3089\u304b\u306a\u9854\u306f\u4e0a\u5929\u6c17\u3068\u540c\u3058\u304f\u3089\u3044\u3046\u308c\u3057\u3044\u3082\u306e\u3060\u3002\u30d5\u30e9\u30f3\u30af\u30ea\u30f3 #tenki #bot","id":30678546020040705,"from_user_id":120911929,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://blog.livedoor.jp/fairycirno/archives/34686.html&quot; rel=&quot;nofollow&quot;&gt;\u5e7b\u60f3\u90f7 \u9727\u306e\u6e56&lt;/a&gt;"},{"from_user_id_str":"65976527","profile_image_url":"http://a0.twimg.com/profile_images/452810990/little_italies_____normal.jpg","created_at":"Thu, 27 Jan 2011 17:00:03 +0000","from_user":"heta_weather01","id_str":"30671388754845696","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u30d8\u30bf\u5929\u3011Tere hommikust.\u30a8\u30b9\u30c8\u30cb\u30a2\u3067\u3059\u3002\u4eca\u65e5\u306e\u6771\u4eac\u306e\u5929\u6c17\u306f\u6674\u6642\u3005\u66c7\u3067\u660e\u65e5\u306f\u66c7\u308a\u3067\u3059\u3002\u3061\u306a\u307f\u306b\u50d5\u306e\u3068\u3053\u308d\u3067\u306f\u66c7\u308a\u3067\u6c17\u6e29-7\u2103\u3067\u3059\u3002\u3061\u306a\u307f\u306b\u30b9\u30ab\u30a4\u30d7\u306e\u958b\u767a\u672c\u90e8\u306f\u50d5\u306e\u5bb6\u306b\u3042\u308b\u3093\u3067\u3059\u3002","id":30671388754845696,"from_user_id":65976527,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www15.atpages.jp/~kageyanma/&quot; rel=&quot;nofollow&quot;&gt;\u5730\u7403\u306e\u4e2d&lt;/a&gt;"},{"from_user_id_str":"7278433","profile_image_url":"http://a3.twimg.com/profile_images/1218965303/michael-1_normal.png","created_at":"Thu, 27 Jan 2011 16:50:16 +0000","from_user":"shimohiko","id_str":"30668926035689472","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3042\u308a\u3002\n\u3010\u7f8e\u4eba\u5929\u6c17/\u6771\u4eac\u3011\u7f8e\u4eba\u5929\u6c17\u30ad\u30e3\u30b9\u30bf\u30fc\u306e&quot;\u3055\u3042\u3084\u3093\u3055\u3093&quot;\u306b\u3088\u308b\u3068\u300c1/29(\u571f)\u306f\u304f\u3082\u308a\u3067\u3001\u964d\u6c34\u78ba\u738740%\u3001\u6700\u9ad8\u6c17\u6e29\u306f6\u2103\u3067\u6700\u4f4e\u6c17\u6e29\u306f1\u2103\u3067\u3059\u300d\u7f8e\u4eba\u5929\u6c17\u21d2http://bit.ly/djB8th http://twitpic.com/3twnl0 #bt_tenki","id":30668926035689472,"from_user_id":7278433,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://bijintenki.jp&quot; rel=&quot;nofollow&quot;&gt;bijintenki.jp&lt;/a&gt;"},{"from_user_id_str":"61770","profile_image_url":"http://a3.twimg.com/profile_images/1206955079/tw172a_normal.png","created_at":"Thu, 27 Jan 2011 16:40:52 +0000","from_user":"rsky","id_str":"30666561853333504","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3075\u3068\u591c\u7a7a\u3092\u898b\u4e0a\u3052\u3066\u30aa\u30ea\u30aa\u30f3\u304c\u898b\u3048\u306a\u304f\u3066\u300c\u6771\u4eac\u306b\u306f\u7a7a\u304c\u306a\u3044\u300d\u3068\u667a\u6075\u5b50\u306e\u3088\u3046\u306a\u3053\u3068\u3092\u601d\u3063\u305f\u308f\u3051\u3060\u304c\u3001\u305f\u3076\u3093\u534a\u5206\u3050\u3089\u3044\u306f\u5929\u6c17\u306e\u305b\u3044\u3067\u3059","id":30666561853333504,"from_user_id":61770,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.hootsuite.com&quot; rel=&quot;nofollow&quot;&gt;HootSuite&lt;/a&gt;"},{"from_user_id_str":"103259265","profile_image_url":"http://a0.twimg.com/profile_images/767857973/anime_icon_normal.gif","created_at":"Thu, 27 Jan 2011 16:37:42 +0000","from_user":"liveshowonly","id_str":"30665765698928640","metadata":{"result_type":"recent"},"to_user_id":null,"text":"iPhone\u5929\u6c17\u3002\u6771\u4eac4\u2103\u3063\u3066\u7d50\u69cb\u5bd2\u304f\u306a\u3044\u3058\u3083\u3093\u3002\uff08\u78ba\u304b\u306b\u3082\u306e\u51c4\u304f\u5bd2\u3044\u8a33\u3067\u306f\u7121\u3044\uff09\u3002\u798f\u5ca1\u5e02\u306f1\u2103\u3060\u3002\u52dd\u3061\u3060\u305c\u3002Rock'n'roll","id":30665765698928640,"from_user_id":103259265,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"165242761","profile_image_url":"http://a1.twimg.com/profile_images/1147334744/SN3E00600001_normal.jpg","created_at":"Thu, 27 Jan 2011 16:37:35 +0000","from_user":"deuxavril0502","id_str":"30665736556912640","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6b8b\u5ff5\u3001\u79c1\u306f\u6c96\u7e04\u3067\u3059(&gt;_&lt;)\u3067\u3082\u304a\u5929\u6c17\u826f\u3055\u305d\u3046\u3067\u826f\u304b\u3063\u305f\u306d\u3002\u3053\u3061\u3089\u306f\u96e8\u3088\uff5eRT @rinandy2010: \u305d\u3046\u3067\u3059\u3063\u266a\u51fa\u5f35\u3067(^^)\u304a\u306d\u3048\u3055\u307e\u306f\u6771\u4eac\u3067\u3059\u304b\uff1f\u3081\u3063\u3061\u3083\u5929\u6c17\u826f\u304f\u3066\u3073\u3063\u304f\u308a\u3067\u3059\u3002\u624b\u888b\u3068\u304b\u5168\u7136\u3044\u3089\u306a\u3044\u3067\u3059\u306d\u30fc RT @deuxavril0502 \u6771\u4eac\u306a\u306e\u30fc\uff1f","id":30665736556912640,"from_user_id":165242761,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.echofon.com/&quot; rel=&quot;nofollow&quot;&gt;Echofon&lt;/a&gt;"},{"from_user_id_str":"163900288","profile_image_url":"http://a1.twimg.com/profile_images/1210224823/icon12945064955238_normal.jpg","created_at":"Thu, 27 Jan 2011 16:24:37 +0000","from_user":"nyao_yurichan","id_str":"30662472734089216","metadata":{"result_type":"recent"},"to_user_id":100985873,"text":"@ray_ko302 \u767a\u898b\u3042\u308a\u304c\u3068\u3067\u3059\u3045\u3002\u3053\u3061\u3089\u3067\u3082\u3088\u308d\u3057\u304f\u306d\u3002\u6771\u4eac\u306f\u4eca\u65e5\u3082\u4e7e\u71e5\u3067\u5927\u5909\u3088\u3002\u305d\u3063\u3061\u3068\u771f\u9006\u306e\u5929\u6c17\u3060\u306d\u3002\u30a2\u30a4\u30b9\u30d0\u30fc\u30f3\u304d\u3092\u3064\u3051\u3066\u3088\u306d\u3002","id":30662472734089216,"from_user_id":163900288,"to_user":"ray_ko302","geo":null,"iso_language_code":"ja","to_user_id_str":"100985873","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"49227098","profile_image_url":"http://a3.twimg.com/profile_images/965007882/____normal.jpg","created_at":"Thu, 27 Jan 2011 15:52:26 +0000","from_user":"dosannko6","id_str":"30654371016478720","metadata":{"result_type":"recent"},"to_user_id":108570870,"text":"@peke_hajiP \u4ffa\u304c\u6771\u4eac \u6765\u3066\u6700\u521d\u306b\u9a5a\u3044\u305f\u306e\u304c\u3001\u5929\u6c17\u4e88\u5831\u3067\u82b1\u7c89\u60c5\u5831\u304c\u6d41\u308c\u308b\u3053\u3068\u3067\u3001\u6700\u521d\u306b\u8a66\u3057\u305f\u306e\u304c \u30b4\u30ad\u69d8 \u53ec\u559a\u306e\u5100\u5f0f\u3067\u3059\u304a\uff1f","id":30654371016478720,"from_user_id":49227098,"to_user":"peke_hajip","geo":null,"iso_language_code":"ja","to_user_id_str":"108570870","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"71148934","profile_image_url":"http://a0.twimg.com/profile_images/1209223630/image_normal.jpg","created_at":"Thu, 27 Jan 2011 15:46:49 +0000","from_user":"123keiko","id_str":"30652958311981058","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u9727\u5cf6\u306e\u964d\u7070\u306e\u30cb\u30e5\u30fc\u30b9\u3092\u898b\u3066\u601d\u3044\u51fa\u3057\u307e\u3057\u305f\u3002\u4e0a\u4eac\u3057\u305f\u59cb\u3081\u306e\u9803\u3001\u6771\u4eac\u306f1\u5e74\u4e2d\u3001\u7070\u304c\u964d\u3089\u306a\u3044\u304b\u3089\u7a7a\u6c17\u304c\u6f84\u3093\u3067\u3066\u904e\u3054\u3057\u3084\u3059\u3044\u306a\u3041\u3001\u3068\u601d\u3063\u305f\u306a\u3041\u3001\u3063\u3066\u3002\n\u5b9f\u5bb6\u306f\u51ac\u306e\u5b63\u7bc0\u98a8\u3067\u685c\u5cf6\u306e\u7070\u304c\u964d\u308b\u5730\u533a\u3067\u3057\u305f\u3002\u9e7f\u5150\u5cf6\u306e\u5929\u6c17\u4e88\u5831\u3067\u306f\u3001\u6bce\u65e5\u3001\u685c\u5cf6\u4e0a\u7a7a\u306e\u98a8\u5411\u304d\u4e88\u5831\u304c\u3067\u307e\u3059\u3002\u3053\u308c\u304b\u3089\u306f\u9727\u5cf6\u3082\u304b\u306a\uff1f","id":30652958311981058,"from_user_id":71148934,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"91124773","profile_image_url":"http://a3.twimg.com/profile_images/1139308356/prof101007_3-1_normal.jpg","created_at":"Thu, 27 Jan 2011 15:43:35 +0000","from_user":"sanposuruhito","id_str":"30652146277945345","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u5bb5\u306e\u90fd\u5fc3\u306f\u3001\u8eab\u3082\u5f15\u304d\u7de0\u307e\u308b\u3068\u3044\u3046\u3088\u308a\u306f\u51cd\u3048\u308b\u7a0b\u306e\u51b7\u6c17\u3092\u611f\u3058\u308b\u5bd2\u3044\u591c\u3067\u3059\u3002\u660e\u65e5\u65e5\u4e2d\u306e\u6771\u4eac\u306e\u5929\u6c17\u306f\u3001\u5915\u65b9\u306b\u591a\u5c11\u96f2\u304c\u51fa\u308b\u5834\u6240\u304c\u3042\u308a\u305d\u3046\u306a\u3082\u306e\u306e\u6982\u306d\u6674\u308c\u7a7a\u304c\u5e83\u304c\u308a\u7d9a\u3051\u305d\u3046\u3067\u3059\u3002\u6700\u9ad8\u6c17\u6e29\u306f\u30015-6\u5ea6\u4f4d\u3068\u306a\u308a\u305d\u3046\u3067\u3059\u3002#weather_tokyo","id":30652146277945345,"from_user_id":91124773,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://projects.playwell.jp/go/Saezuri&quot; rel=&quot;nofollow&quot;&gt;Saezuri&lt;/a&gt;"},{"from_user_id_str":"104712480","profile_image_url":"http://a3.twimg.com/profile_images/1204016928/icon5087697006727791368kuro2_normal.jpg","created_at":"Thu, 27 Jan 2011 15:31:51 +0000","from_user":"asongfor_xx","id_str":"30649192296751104","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u7f8e\u4eba\u5929\u6c17\u304b\u3089tweet\u3059\u308b\u3068\u3053\u3093\u306a\u611f\u3058\u306a\u3093\u3060\u306a\u3002 RT asongfor_xx: \u3010\u7f8e\u4eba\u5929\u6c17/\u6771\u4eac\u3011\u7f8e\u4eba\u5929\u6c17\u30ad\u30e3\u30b9\u30bf\u30fc\u306e&quot;\u304b\u306a\u3053\u3055\u3093&quot;\u306b\u3088\u308b\u3068\u300c1/28(\u91d1)\u306f\u6674\u6642\u3005\u304f\u3082\u308a\u3067\u3001\u964d\u6c34\u78ba\u73870%\u3001\u6700\u9ad8\u6c17\u6e29\u306f8\u2103\u3067\u6700\u4f4e\u6c17\u6e29\u306f1\u2103\u3067\u3059\u300d\u7f8e\u4eba\u5929\u6c17\u21d2http://bit.ly/djB8th","id":30649192296751104,"from_user_id":104712480,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twipple.jp/&quot; rel=&quot;nofollow&quot;&gt;\u3064\u3044\u3063\u3077\u308b for iPhone&lt;/a&gt;"},{"from_user_id_str":"165965113","profile_image_url":"http://a0.twimg.com/profile_images/1200885316/shogomeguro_normal.jpg","created_at":"Thu, 27 Jan 2011 15:24:35 +0000","from_user":"shogomeguro","id_str":"30647362477105152","metadata":{"result_type":"recent"},"to_user_id":null,"text":"2011.1.26 \u793e\u7a93\u304b\u3089\u3002\u4e0d\u601d\u8b70\u306a\u5929\u6c17\u3067\u3053\u306e\u5f8c\u96ea\u304c\u3061\u3089\u3064\u3044\u305f\u3093\u3060\u3088\u306d\u3002\u6771\u4eac\u306e\u521d\u96ea\u3067\u3057\u305f\u3002 http://instagr.am/p/BO_xn/","id":30647362477105152,"from_user_id":165965113,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://instagr.am&quot; rel=&quot;nofollow&quot;&gt;instagram&lt;/a&gt;"},{"from_user_id_str":"166018520","profile_image_url":"http://a0.twimg.com/profile_images/1207460953/100-40030_normal.jpg","created_at":"Thu, 27 Jan 2011 15:18:17 +0000","from_user":"115nayume","id_str":"30645776254238722","metadata":{"result_type":"recent"},"to_user_id":118384679,"text":"@dancinpea09 \u6771\u4eac\u3001\u660e\u65e5\u3082\u5929\u6c17\u826f\u3044\u307f\u305f\u3044\u3067\u3001\u3088\u304b\u3063\u305f\u3067\u3059\u306d\u30fc\u266a \u30ca\u30a4\u30b9\u30c8\u30ea\u30c3\u30d7\uff01\u304a\u3084\u3059\u307f\u306a\u3055\u3044\u3002 http://twitpic.com/3tvun3","id":30645776254238722,"from_user_id":166018520,"to_user":"dancinpea09","geo":null,"iso_language_code":"ja","to_user_id_str":"118384679","source":"&lt;a href=&quot;http://tweetli.st/&quot; rel=&quot;nofollow&quot;&gt;TweetList!&lt;/a&gt;"},{"from_user_id_str":"202937674","profile_image_url":"http://a1.twimg.com/profile_images/1218797578/______2_normal.jpg","created_at":"Thu, 27 Jan 2011 15:11:48 +0000","from_user":"ryuusisan","id_str":"30644146498699264","metadata":{"result_type":"recent"},"to_user_id":203058384,"text":"@manaasutakshi \u6771\u4eac\u306f\u964d\u3063\u3066\u306a\u3044\u3093\u3067\u3059\u304b\u30fb\u30fb\u30fb\u5929\u6c17\u4e88\u5831\u306b\u3088\u308b\u3068\u660e\u65e5\u3082\u6771\u4eac\u306f\u964d\u3089\u306a\u3044\u305d\u3046\u3067\u3059\u306d\uff01\uff01\u79c1\u306e\u4f4f\u3093\u3067\u3044\u308b\u3068\u3053\u308d\u306f\u5fae\u5999\u306b\u964d\u308a\u305d\u3046\u3067\u51fa\u52e4\u6642\u306b\u964d\u3063\u3066\u305f\u3089\u3061\u3087\u3063\u3068\u5acc\u3060\u306a\u3041\u3000\u306a\u3093\u3066\u601d\u3044\u307e\u3059","id":30644146498699264,"from_user_id":202937674,"to_user":"manaasutakshi","geo":null,"iso_language_code":"ja","to_user_id_str":"203058384","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"3222182","profile_image_url":"http://a0.twimg.com/profile_images/1199090957/ProfilePhoto_normal.png","created_at":"Thu, 27 Jan 2011 15:09:35 +0000","from_user":"44mune","id_str":"30643589545459713","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u7f8e\u4eba\u5929\u6c17/\u6771\u4eac\u3011\u7f8e\u4eba\u5929\u6c17\u30ad\u30e3\u30b9\u30bf\u30fc\u306e&quot;\u306e\u308a\u3055\u3093&quot;\u306b\u3088\u308b\u3068\u300c1/28(\u91d1)\u306f\u304f\u3082\u308a\u306e\u3061\u6674\u3067\u3001\u964d\u6c34\u78ba\u738710%\u3001\u6700\u9ad8\u6c17\u6e29\u306f9\u2103\u3067\u6700\u4f4e\u6c17\u6e29\u306f2\u2103\u3067\u3059\u300d http://twitpic.com/3tvruh","id":30643589545459713,"from_user_id":3222182,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://bijintenki.jp&quot; rel=&quot;nofollow&quot;&gt;bijintenki.jp&lt;/a&gt;"},{"from_user_id_str":"154341982","profile_image_url":"http://a0.twimg.com/profile_images/1155496864/_____normal.jpg","created_at":"Thu, 27 Jan 2011 15:02:39 +0000","from_user":"slave_420_bot","id_str":"30641845490946049","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u30f3\u3068\u3053\u899a\u3048\u3066\u308b\u306e\u306f\u300c\u672d\u5e4c\u300d\u300c\u4ed9\u53f0\u300d\u300c\u6771\u4eac\u300d\u300c\u5927\u962a\u300d\u300c\u540d\u53e4\u5c4b\u300d\u300c\u798f\u5ca1\u300d\u306e\u4eca\u65e5\u3068\u660e\u65e5\u306e\u5929\u6c17\u3060\u306a\u3002\u5929\u6c17\u304c\u77e5\u308a\u305f\u3044\u6642\u306f\u300c\u5834\u6240\u300d\u3068\u300c\u4eca\u65e5\u306e\u5929\u6c17\u300d\u304b\u300c\u660e\u65e5\u306e\u5929\u6c17\u300d\u3092\u304a\u7533\u3057\u4ed8\u3051\u304f\u3060\u3055\u3044\u3001\u304a\u5b22\u69d8\uff1f","id":30641845490946049,"from_user_id":154341982,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://bot.syoyu.net/&quot; rel=&quot;nofollow&quot;&gt;\u7adc\u30f6\u5cf0\u90b8\u306e\u3069\u3053\u304b&lt;/a&gt;"},{"from_user_id_str":"72042678","profile_image_url":"http://a3.twimg.com/profile_images/1198771027/larxene_normal.jpg","created_at":"Thu, 27 Jan 2011 15:01:57 +0000","from_user":"larxene_bot","id_str":"30641668772339712","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u65e5\u306e\u5929\u6c17\u306f \u672d\u5e4c\u304c\u6674\u308c \u4ed9\u53f0\u304c\u66c7\u6642\u3005\u96ea \u6771\u4eac\u304c\u6674\u306e\u3061\u66c7 \u540d\u53e4\u5c4b\u304c\u6674\u6642\u3005\u66c7 \u5927\u962a\u304c\u6674\u6642\u3005\u66c7 \u798f\u5ca1\u304c\u6674\u308c \u3089\u3057\u3044\u308f\u3088 \u6ce8\u610f\u3057\u306a\u3055\u3044","id":30641668772339712,"from_user_id":72042678,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www4.kiwi-us.com/~yuuna/larxene_bot_manual/index.html&quot; rel=&quot;nofollow&quot;&gt;\u5fd8\u5374\u306e\u57ce \u5730\u4e0a\u306e12\u968e&lt;/a&gt;"},{"from_user_id_str":"101331893","profile_image_url":"http://a1.twimg.com/sticky/default_profile_images/default_profile_0_normal.png","created_at":"Thu, 27 Jan 2011 15:01:34 +0000","from_user":"yoshiftan","id_str":"30641572240424961","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306e\u5929\u6c17\u4e88\u5831\u3092\u898b\u3066\u3073\u3063\u304f\u308a\uff01\u6691\u305d\u3046\u3060\u306a\u3053\u308a\u3083\u3002","id":30641572240424961,"from_user_id":101331893,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"Keitai Mail"},{"from_user_id_str":"65207550","profile_image_url":"http://a3.twimg.com/profile_images/448731969/_________R_normal.jpg","created_at":"Thu, 27 Jan 2011 15:01:33 +0000","from_user":"kabuyo","id_str":"30641566469066752","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u5929\u6c17\u4e88\u5831\u3067\u306f\u6771\u4eac\u3067\u306f\u4e7e\u71e5\u6ce8\u610f\u5831\u304c\u7d9a\u3044\u3066\u3044\u308b\u3089\u3057\u3044\u306e\u306b\u3001\u306a\u305c\u79c1\u304c\u5e72\u3057\u305f\u6d17\u6fef\u7269\u306f\u96e8\u306b\u6fe1\u308c\u3066\u3057\u307e\u3063\u305f\u306e\u3060\u308d\u3046\u304b\u2025\u3000\u3088\u3063\u307d\u3069\u904b\u304c\u60aa\u3044\u3089\u3057\u3044\u2025","id":30641566469066752,"from_user_id":65207550,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"80309352","profile_image_url":"http://a1.twimg.com/profile_images/1223620418/image_normal.jpg","created_at":"Thu, 27 Jan 2011 14:54:30 +0000","from_user":"mikutyan","id_str":"30639792026812416","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306e\u660e\u65e5\u306e\u5929\u6c17\u6559\u3048\u3066","id":30639792026812416,"from_user_id":80309352,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"80309352","profile_image_url":"http://a1.twimg.com/profile_images/1223620418/image_normal.jpg","created_at":"Thu, 27 Jan 2011 14:53:06 +0000","from_user":"mikutyan","id_str":"30639439847890944","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u660e\u65e5\u306e\u6771\u4eac\u306e\u5929\u6c17\u306a\u3093\u3060\u308d\u3046 \u96e8\u964d\u3063\u305f\u3089\u56f0\u308b\u3002","id":30639439847890944,"from_user_id":80309352,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"120911929","profile_image_url":"http://a0.twimg.com/profile_images/772435076/20100312___capture2_normal.png","created_at":"Thu, 27 Jan 2011 14:47:19 +0000","from_user":"Cirno_fan","id_str":"30637984684449792","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3042\u305f\u3044\u30c1\u30eb\u30ce\uff01\u30dc\u30c3\u30c8\u3060\u3051\u3069\u5929\u6c17\u4e88\u5831\u3082\u3067\u304d\u308b\u3088\uff01\u300c\u6771\u4eac\u306e\u4eca\u65e5\u306e\u5929\u6c17\u6559\u3048\u3066\u300d\u307f\u305f\u3044\u306bTL\u767a\u8a00\u3057\u3066\u304f\u308c\u308c\u3070\u8abf\u3079\u3066\u3042\u3052\u308b\uff01 #followme #followmejp #followmevip #tenki","id":30637984684449792,"from_user_id":120911929,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://blog.livedoor.jp/fairycirno/archives/34686.html&quot; rel=&quot;nofollow&quot;&gt;\u5e7b\u60f3\u90f7 \u9727\u306e\u6e56&lt;/a&gt;"},{"from_user_id_str":"33858777","profile_image_url":"http://a0.twimg.com/profile_images/352864695/muga_normal.jpg","created_at":"Thu, 27 Jan 2011 14:46:12 +0000","from_user":"collonist","id_str":"30637702105796610","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u3063\u3066\u51ac\u306f\u57fa\u672c\u7684\u306b\u6674\u308c\u3066\u308b\u304b\u3089\u3001\u5929\u6c17\u4e88\u5831\u898b\u306a\u304f\u3066\u3082\u5168\u7136\u554f\u984c\u306a\u3044\u3002\u5c71\u5f62\u3060\u3068\u660e\u65e5\u306f\u3069\u3093\u3060\u3051\u96ea\u304c\u964d\u308b\u306e\u304b\u3001\u3069\u3093\u3060\u3051\u5bd2\u3044\u306e\u304b\u628a\u63e1\u3057\u3066\u3068\u304d\u305f\u3044\u306e\u3067\u3001\u5929\u6c17\u4e88\u5831\u306f\u5fc5\u305a\u30c1\u30a7\u30c3\u30af\u3057\u3066\u305f\u306e\u3060\u304c\u3002","id":30637702105796610,"from_user_id":33858777,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.hootsuite.com&quot; rel=&quot;nofollow&quot;&gt;HootSuite&lt;/a&gt;"},{"from_user_id_str":"79336228","profile_image_url":"http://a0.twimg.com/profile_images/1130029876/zmanmu_normal.png","created_at":"Thu, 27 Jan 2011 14:30:23 +0000","from_user":"atsuki777","id_str":"30633725041573890","metadata":{"result_type":"recent"},"to_user_id":null,"text":"MXTV\u306e\u5929\u6c17\u4e88\u5831\u521d\u3081\u3066\u898b\u305f\u3051\u3069\u6771\u4eac\u753a\u7530\u516b\u738b\u5b50\u3063\u3066\u5730\u57df\u8868\u793a\u304c\u2026w\u516b\u738b\u5b50\u3068\u753a\u7530\u306f\u6771\u4eac\u3058\u3083\u306a\u3044\u306e\u304bwww","id":30633725041573890,"from_user_id":79336228,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.echofon.com/&quot; rel=&quot;nofollow&quot;&gt;Echofon&lt;/a&gt;"},{"from_user_id_str":"90576097","profile_image_url":"http://a0.twimg.com/profile_images/1203320254/nanami1_normal.png","created_at":"Thu, 27 Jan 2011 14:28:26 +0000","from_user":"dycroft","id_str":"30633234245099521","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306e\u660e\u65e5\u306e\u304a\u5929\u6c17\u3067\u3059","id":30633234245099521,"from_user_id":90576097,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://sourceforge.jp/projects/tween/wiki/FrontPage&quot; rel=&quot;nofollow&quot;&gt;Tween&lt;/a&gt;"},{"from_user_id_str":"147215268","profile_image_url":"http://a2.twimg.com/profile_images/1198555202/ichika-7.4.0-3P_normal.gif","created_at":"Thu, 27 Jan 2011 14:28:23 +0000","from_user":"kiaran5032","id_str":"30633222211637248","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306e\u660e\u65e5\u306e\u304a\u5929\u6c17\u3067\u3059\u3002\u6674\u308c\u6642\u3005\u304f\u3082\u308a #MX","id":30633222211637248,"from_user_id":147215268,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://sourceforge.jp/projects/tween/wiki/FrontPage&quot; rel=&quot;nofollow&quot;&gt;Tween&lt;/a&gt;"},{"from_user_id_str":"1741599","profile_image_url":"http://a0.twimg.com/profile_images/1205744888/950637_normal.jpg","created_at":"Thu, 27 Jan 2011 14:28:21 +0000","from_user":"dasaitama","id_str":"30633212535382016","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306e\u3001\u660e\u65e5\u306e\u304a\u5929\u6c17\u3067\u3059","id":30633212535382016,"from_user_id":1741599,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://sourceforge.jp/projects/tween/wiki/FrontPage&quot; rel=&quot;nofollow&quot;&gt;Tween&lt;/a&gt;"},{"from_user_id_str":"34140879","profile_image_url":"http://a3.twimg.com/profile_images/1186413535/__6_normal.jpg","created_at":"Thu, 27 Jan 2011 14:28:17 +0000","from_user":"ryuji_chaos","id_str":"30633197016449024","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306e\u660e\u65e5\u306e\u304a\u5929\u6c17\u3067\u3059\u3002","id":30633197016449024,"from_user_id":34140879,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"1400","profile_image_url":"http://a0.twimg.com/profile_images/1198556839/westerndog_20090104_320x320_normal.jpg","created_at":"Thu, 27 Jan 2011 14:28:16 +0000","from_user":"westerndog","id_str":"30633191232503808","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306e\u660e\u65e5\u306e\u304a\u5929\u6c17\u3067\u3059","id":30633191232503808,"from_user_id":1400,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://sourceforge.jp/projects/tween/wiki/FrontPage&quot; rel=&quot;nofollow&quot;&gt;Tween&lt;/a&gt;"},{"from_user_id_str":"89239832","profile_image_url":"http://a3.twimg.com/profile_images/519522846/noriko_normal.jpg","created_at":"Thu, 27 Jan 2011 14:15:01 +0000","from_user":"Noriko_Fujimoto","id_str":"30629857234788352","metadata":{"result_type":"recent"},"to_user_id":115645219,"text":"@nossa430402 \u5bcc\u5c71\u306f\u3059\u3054\u3044\u96ea\u307f\u305f\u3044\u3067\u3059\u306d\uff5e\uff08\u5bd2\u3063\uff09\u3000\u6771\u4eac\u306f\u305d\u306e\u5206\u6bce\u65e5\u826f\u3044\u5929\u6c17\u3067\u3059\u3002\u5bd2\u3044\u3051\u3069\u30fb\u30fb\u30fb\u3002","id":30629857234788352,"from_user_id":89239832,"to_user":"nossa430402","geo":null,"iso_language_code":"ja","to_user_id_str":"115645219","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"107265539","profile_image_url":"http://a0.twimg.com/sticky/default_profile_images/default_profile_3_normal.png","created_at":"Thu, 27 Jan 2011 14:01:10 +0000","from_user":"kurumasuki330","id_str":"30626371826884608","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u9031\u571f\u66dc\u65e5\u3001\u8eca\u3067\u6771\u4eac\u304b\u3089\u6771\u540d\u3001\u7c73\u539f\u7d4c\u7531\u3067\u91d1\u6ca2\u306e\u5b9f\u5bb6\u3078\u3002\u305d\u3057\u3066\u3001\u6708\u66dc\u65e5\u306b\u6771\u4eac\u3078\u5e30\u308b\u30b9\u30b1\u30b8\u30e5\u30fc\u30eb\u3002\u5929\u6c17\u4e88\u5831\u3060\u3068\u4eca\u9031\u672b\u3001\u5317\u9678\u5730\u65b9\u306f\u5927\u96ea\uff01\u5e30\u308c\u308b\u304b\u81ea\u4fe1\u304c\u306a\u304f\u306a\u3063\u3066\u304d\u305f\u3002\u307e\u305f\u3001\u305d\u306e\u6642\u5b9f\u6cc1\u4e2d\u7d99\u3057\u307e\u3059\u3002","id":30626371826884608,"from_user_id":107265539,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twtr.jp&quot; rel=&quot;nofollow&quot;&gt;Keitai Web&lt;/a&gt;"},{"from_user_id_str":"155313166","profile_image_url":"http://a3.twimg.com/profile_images/1167554721/73931_1408370184003_1674923704_920888_5686998_n_normal.jpg","created_at":"Thu, 27 Jan 2011 14:00:50 +0000","from_user":"takuya_aoki","id_str":"30626287127105536","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306f\u3081\u3063\u3061\u3083\u3044\u3044\u5929\u6c17\u3067\u904e\u3054\u3057\u3084\u3059\u3044\u3051\u3069\u30c9\u30e9\u30a4\u30a2\u30a4\u306b\u306f\u3061\u3087\u3063\u3068\u304d\u3064\u3044\u306a\u30fb\u30fb\u30fb\u76ee\u85ac\u304c\u624b\u653e\u305b\u306a\u3044","id":30626287127105536,"from_user_id":155313166,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"179984398","profile_image_url":"http://a1.twimg.com/profile_images/1182382310/g4350_normal.jpg","created_at":"Thu, 27 Jan 2011 13:52:50 +0000","from_user":"aiilabo","id_str":"30624271902449664","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30d6\u30ed\u30b0\u66f4\u65b0 \u25c6\u611f\u60c5\u3092\u307f\u3064\u3081\u308b\u65b9\u6cd5 - \u3053\u3053\u6570\u65e5\u3001\u6642\u6298\u96e8\u304c\u30d1\u30e9\u30d1\u30e9\u3000\u5fae\u5999\u306a\u5929\u6c17\u306e\u6771\u4eac\u304b\u3089\u3042\u308b\u304c\u307e\u307e\u3067\u3059\u3002 \n\n \u4eca\u65e5\u306f\u3001\u6628\u65e5\u306e\u300c\u30de\u30a4\u30ca\u30b9\u611f\u60c5\u306f\u60aa\u3067\u3059\u304b\uff1f\n.. \u27aa http://am6.jp/e3e9tS","id":30624271902449664,"from_user_id":179984398,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://feedtweet.am6.jp/&quot; rel=&quot;nofollow&quot;&gt;\u261e feedtweet.jp \u261c&lt;/a&gt;"},{"from_user_id_str":"185992391","profile_image_url":"http://a2.twimg.com/profile_images/1192695844/otenki_normal.png","created_at":"Thu, 27 Jan 2011 13:00:37 +0000","from_user":"otenki_luci_bot","id_str":"30611130938298368","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u767a\u58f2\u65e5\u304b\u2026\u2026\u541b\u305f\u3061\u306b\u3068\u3063\u3066\u306f\u591a\u5206\u300190\u65e5\u5f8c\u306e\u3053\u3068\u3060\u3002\u3055\u3066\u660e\u65e5\u306e\u6771\u4eac\u90fd\u306e\u5929\u6c17\u306f\u6674\u306e\u3061\u66c7\u3001\u6700\u9ad8\u6c17\u6e29\u306f8\u5ea6\u3060\u305d\u3046\u3060\u3002\u3055\u3059\u304c\u306b\u4f55\u304b\u7740\u305f\u65b9\u304c\u3044\u3044\u305e\u3001\u30a4\u30fc\u30ce\u30c3\u30af\u3002","id":30611130938298368,"from_user_id":185992391,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/otenki_luci_bot&quot; rel=&quot;nofollow&quot;&gt;\u304a\u3066\u3093\u304d\u308b\u3057\u3075\u3047\u308b&lt;/a&gt;"},{"from_user_id_str":"65976527","profile_image_url":"http://a0.twimg.com/profile_images/452810990/little_italies_____normal.jpg","created_at":"Thu, 27 Jan 2011 13:00:04 +0000","from_user":"heta_weather01","id_str":"30610995843964928","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u30d8\u30bf\u5929\u3011Jo napot.\u30cf\u30f3\u30ac\u30ea\u30fc\u3067\u3059\u3002\u6771\u4eac\u306e\u5929\u6c17\u306f\u6674\u306e\u3061\u66c7\u3067\u660e\u65e5\u306f\u6674\u6642\u3005\u66c7\u3001\u79c1\u306e\u3068\u3053\u308d\u3067\u306f\u66c7\u308a\u3067-2\u2103\u3067\u3059\u3002\u3048\u3001\u3053\u306e\u30d5\u30e9\u30a4\u30d1\u30f3\u3067\u3059\u304b\uff1f\u2026\u3061\u3087\u3063\u3068\u500b\u4eba\u7684\u306b\u6bb4\u308a\u305f\u3044\u4eba\u304c\u3044\u308b\u3093\u3067\u3059\u266a","id":30610995843964928,"from_user_id":65976527,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www15.atpages.jp/~kageyanma/&quot; rel=&quot;nofollow&quot;&gt;\u5730\u7403\u306e\u4e2d&lt;/a&gt;"},{"from_user_id_str":"109740077","profile_image_url":"http://a0.twimg.com/profile_images/1212763349/1d3d3821-6b3a-449f-a636-05b95ce3d5d8_normal.png","created_at":"Thu, 27 Jan 2011 12:59:41 +0000","from_user":"snow_arai","id_str":"30610896141156354","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306f\u3001\u30ab\u30e9\u30ab\u30e9\u9023\u7d9a\u3000\uff13\u4f4d\u30bf\u30a4 - \u65e9\u8d77\u304d\u2606\u304a\u5929\u6c17\u2606ONAIR\u65e5\u8a18\uff1a\u65e5\u7d4c\u30a6\u30fc\u30de\u30f3\u30aa\u30f3\u30e9\u30a4\u30f3 http://j.mp/hxP3Di","id":30610896141156354,"from_user_id":109740077,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"53407951","profile_image_url":"http://a1.twimg.com/profile_images/397960795/airman_normal.jpg","created_at":"Thu, 27 Jan 2011 12:57:32 +0000","from_user":"Airman2009","id_str":"30610355541508096","metadata":{"result_type":"recent"},"to_user_id":null,"text":". @04mmy22 @qsk1 \u98a8\u3068\u96f2\u30fb\u30fb\u30fb\u98db\u884c\u6a5f\u306e\u5927\u5c0f\u554f\u308f\u305a\u3001\u3053\u308c\u3070\u304b\u308a\u306f\u3069\u3046\u3057\u3088\u3046\u3082\u7121\u3044\u3067\u3059\u3088\u306d\u3002 \u6700\u8fd1\u306e\u5357\u6771\u4eac\u306e\u5929\u6c17\u306f\u5909\u3067\u3059\u306d\u3002\u3002\u3002","id":30610355541508096,"from_user_id":53407951,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://sourceforge.jp/projects/tween/wiki/FrontPage&quot; rel=&quot;nofollow&quot;&gt;Tween&lt;/a&gt;"},{"from_user_id_str":"111826019","profile_image_url":"http://a1.twimg.com/profile_images/1121742732/DVC00052_normal.jpg","created_at":"Thu, 27 Jan 2011 12:51:12 +0000","from_user":"nijiks","id_str":"30608762859421696","metadata":{"result_type":"recent"},"to_user_id":100014282,"text":"@sanaeru \u79c1\u3053\u3093\u306a\u5929\u6c17\u306e\u4e2d\uff64\u4e8c\u6cca\u4e09\u65e5\u3067\u660e\u65e5\u304b\u3089\u6771\u4eac\u884c\u304f\u3093\u3067\u3059\u3051\u3069\u2026\uff61\u65e5\u66dc\u65e5\u98db\u884c\u6a5f\u98db\u3076\u304b\u3057\u3089\u2026\uff1f","id":30608762859421696,"from_user_id":111826019,"to_user":"sanaeru","geo":null,"iso_language_code":"ja","to_user_id_str":"100014282","source":"&lt;a href=&quot;http://z.twipple.jp/&quot; rel=&quot;nofollow&quot;&gt;\u3064\u3044\u3063\u3077\u308b/twipple&lt;/a&gt;"},{"from_user_id_str":"164951488","profile_image_url":"http://a3.twimg.com/profile_images/799082230/twitter_normal.jpg","created_at":"Thu, 27 Jan 2011 12:47:49 +0000","from_user":"minorif_jp","id_str":"30607912309096448","metadata":{"result_type":"recent"},"to_user_id":105078670,"text":"@ecco_HIRADO \u5e73\u6238\u725b\u3063\u3066\u5143\u306f\u30aa\u30e9\u30f3\u30c0\u304b\u3089\u304d\u305f\u725b\u306a\u3093\u3060\u306d\u3002\u304a\u3044\u3057\u305d\u3046\u2026\u3002\u5e73\u6238\u306f\u3088\u304b\u6240\u305f\u3043\u3002\u3042\u305f\u3044\u3052\u3047\u3093\u5b9f\u5bb6\u3093\u65b9\u306f\u30c0\u30d6\u30eb\u706b\u5c71\u3084\u9ce5\u30a4\u30f3\u30d5\u30eb\u3067\u5927\u5909\u3084\u3063\u3069\u3002\u6771\u4eac\u3093\u826f\u304b\u3068\u3053\u306f\u5929\u6c17\u306e\u5fc3\u914d\u305b\u305a\u66ae\u3089\u305b\u308b\u3068\u3053\u3058\u3083\u3063\u3069\u3093\u3002","id":30607912309096448,"from_user_id":164951488,"to_user":"ecco_HIRADO","geo":null,"iso_language_code":"ja","to_user_id_str":"105078670","source":"&lt;a href=&quot;http://z.twipple.jp/&quot; rel=&quot;nofollow&quot;&gt;\u3064\u3044\u3063\u3077\u308b/twipple&lt;/a&gt;"},{"from_user_id_str":"10456803","profile_image_url":"http://a1.twimg.com/profile_images/145280215/vot_icon_normal.png","created_at":"Thu, 27 Jan 2011 12:43:37 +0000","from_user":"vot_","id_str":"30606853377363968","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3086\u3063\u304f\u308a\u5929\u6c17\u4e88\u5831\u3067\u3059\u3002\u6771\u4eac\u90fd,\u5927\u5cf6\u5730\u65b9\u300228\u65e5\uff08\u91d1\u66dc\u65e5\u306e\u5929\u6c17\u306f\u6674\u308c\u306e\u3061\u66c7\u308a\u3001\u6700\u9ad8\u6c17\u6e29\u306f7\u5ea6 \u6700\u4f4e\u6c17\u6e29\u306f1\u5ea6\u3067\u3057\u3087\u3046\u3002","id":30606853377363968,"from_user_id":10456803,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://voiceoftwitter.com&quot; rel=&quot;nofollow&quot;&gt;\uff56\uff4f\uff49\uff43\uff45 \uff4f\uff46 \uff54\uff57\uff49\uff54\uff54\uff45\uff52&lt;/a&gt;"},{"from_user_id_str":"23900716","profile_image_url":"http://a3.twimg.com/profile_images/1092646332/twitter_icon_normal.png","created_at":"Thu, 27 Jan 2011 12:38:00 +0000","from_user":"keiyama","id_str":"30605442639990784","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u7f8e\u4eba\u5929\u6c17/\u6771\u4eac\u3011\u7f8e\u4eba\u5929\u6c17\u30ad\u30e3\u30b9\u30bf\u30fc\u306e&quot;\u30c8\u30e2\u30b3\u3055\u3093&quot;\u306b\u3088\u308b\u3068\u300c1/27(\u6728)\u306f\u304f\u3082\u308a\u306e\u3061\u6674\u3067\u3001\u964d\u6c34\u78ba\u738710%\u3001\u6700\u9ad8\u6c17\u6e29\u306f9\u2103\u3067\u6700\u4f4e\u6c17\u6e29\u306f2\u2103\u3067\u3059\u300d\u7f8e\u4eba\u5929\u6c17\u21d2http://bit.ly/djB8th http://twitpic.com/3tuekm #bt_tenki","id":30605442639990784,"from_user_id":23900716,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://bijintenki.jp&quot; rel=&quot;nofollow&quot;&gt;bijintenki.jp&lt;/a&gt;"},{"from_user_id_str":"32018516","profile_image_url":"http://a0.twimg.com/profile_images/1089472069/237_normal.jpg","created_at":"Thu, 27 Jan 2011 12:36:28 +0000","from_user":"DigJandG","id_str":"30605057460281344","metadata":{"result_type":"recent"},"to_user_id":196050661,"text":"@kosumoworld55 \u5929\u6c17\u4e88\u5831\u3092\u898b\u3066\u3044\u3064\u3082\u601d\u3046\u3093\u3060\u3002\u4f55\u3067\u6a2a\u6d5c\u3042\u305f\u308a\u306f\u3044\u3064\u3082\u597d\u3044\u5929\u6c17\u306a\u3093\u3060\u3002\u6771\u4eac\u3082\u3002\u3061\u306a\u307f\u306b\u516c\u9b5a\u306f\u3042\u3093\u307e\u308a\u597d\u304d\u3067\u306f\u3042\u308a\u307e\u305b\u3093\u3002\u306a\u3093\u304b\u81ed\u304f\u3063\u3066\u3002\u3067\u3082\u3001\u7435\u7436\u6e56\u3067\u516c\u9b5a\u3063\u3066\u3042\u307e\u308a\u805e\u304b\u306a\u3044\u69d8\u306a\u30fb\u30fb\u30fb\u3002\u4ffa\u304c\u91e3\u308a\u3092\u3057\u306a\u3044\u304b\u3089\u304b\u306a\uff1f","id":30605057460281344,"from_user_id":32018516,"to_user":"kosumoworld55","geo":null,"iso_language_code":"ja","to_user_id_str":"196050661","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"90935348","profile_image_url":"http://a1.twimg.com/sticky/default_profile_images/default_profile_0_normal.png","created_at":"Thu, 27 Jan 2011 12:34:34 +0000","from_user":"sorakeiko","id_str":"30604575937396737","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u95a2\u6771\u5730\u65b9\u306e\u660e\u65e5\u306e\u5929\u6c17\u2015\u7d9a\u304d\u3002\u660e\u65e5\u671d\u6700\u4f4e\u6c17\u6e29\u30fb\u8ed2\u4e26\u307f\u6c37\u70b9\u4e0b\u30fb\u5b87\u90fd\u5bae\u3001\u6c34\u6238\u30de\u30a4\u30ca\u30b95\u5ea6\u30fb\u6771\u4eac\u3001\u6a2a\u6d5c1\u5ea6\u3002\u6700\u9ad8\u6c17\u6e29\u30fb\u4eca\u65e5\u3088\u308a3\u5ea6\u524d\u5f8c\u4f4e\u304f5\uff5e8\u5ea6\u30fb\u6771\u4eac\u3001\u5343\u84498\u5ea6\u3002\u5411\u3053\u3046\u4e00\u9031\u9593\u30fb\u4e7e\u71e5\u3057\u305f\u6674\u308c\u7d9a\u304f\u30fb\uff08\u571f\uff09\u4f0a\u8c46\u8af8\u5cf6\u306b\u51b7\u305f\u3044\u96e8\u3084\u96ea\u304c\u898b\u3089\u308c\u305d\u3046\u3060\u304c\u3001\u95a2\u6771\u306e\u4e7e\u3044\u305f\u72b6\u614b\u7d9a\u304f\u3002","id":30604575937396737,"from_user_id":90935348,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"6113557","profile_image_url":"http://a3.twimg.com/profile_images/1227080026/profile_red_herencia_normal.png","created_at":"Thu, 27 Jan 2011 12:33:57 +0000","from_user":"fmoto7","id_str":"30604423327653888","metadata":{"result_type":"recent"},"to_user_id":null,"text":"&quot;\u6771\u4eac\u6c34\u904b\u7528\u30bb\u30f3\u30bf\u30fc\u306f\u3001\u524d\u534a\u6226\u304c\u7d42\u308f\u3063\u305f\u3068\u3053\u308d\u3067\u4e00\u6c17\u306b\u6c34\u5727\u9ad8\u3081\u3001\u5f8c\u534a\u6226\u59cb\u307e\u308b\u3068\u6c34\u5727\u4e0b\u3052\u3001\u7d42\u308f\u308b\u3068\u307e\u305f\u3059\u3050\u4e0a\u3052\u308b\u3002\u30c6\u30ec\u30d3\u306e\u8996\u8074\u3001\u305d\u306e\u65e5\u306e\u5929\u6c17\u306a\u3069\u30e9\u30a4...&quot; http://tumblr.com/xjy1cwiwrm","id":30604423327653888,"from_user_id":6113557,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.tumblr.com/&quot; rel=&quot;nofollow&quot;&gt;Tumblr&lt;/a&gt;"},{"from_user_id_str":"118092912","profile_image_url":"http://a3.twimg.com/profile_images/1225330653/____normal.PNG","created_at":"Thu, 27 Jan 2011 12:29:13 +0000","from_user":"saechuchun","id_str":"30603231042207744","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3067\u3082\u5730\u9707\u306e\u8a71\u984c\u306e\u3068\u304d\u306e\u300c\u3082\u3057\u6771\u4eac\u3067\u76f4\u4e0b\u578b\u5730\u9707\u304c\u8d77\u304d\u305f\u3089\u300d\u3068\u304b\u5929\u6c17\u4e88\u5831\u306e\u3068\u304d\u306f\u897f\u3067\u96e8\u3060\u308d\u3046\u3068\u300c\u6771\u4eac\u3067\u306f\u301c\u65e5\u9593\u4e7e\u71e5\u3057\u3066\u307e\u3059\u306d\u30fc\u300d\u3068\u304b\u305d\u3046\u3044\u3046\u30ad\u30fc\u5c40\u306e\u95a2\u6771\u4e2d\u5fc3\u4e3b\u7fa9\u306f\u597d\u304d\u3067\u306f\u306a\u3044","id":30603231042207744,"from_user_id":118092912,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twtr.jp&quot; rel=&quot;nofollow&quot;&gt;Keitai Web&lt;/a&gt;"}],"max_id":30724239224995840,"since_id":28179956995457024,"refresh_url":"?since_id=30724239224995840&q=%E6%9D%B1%E4%BA%AC%E3%80%80%E5%A4%A9%E6%B0%97","next_page":"?page=2&max_id=30724239224995840&rpp=50&lang=ja&q=%E6%9D%B1%E4%BA%AC%E3%80%80%E5%A4%A9%E6%B0%97","results_per_page":50,"page":1,"completed_in":0.170202,"warning":"adjusted since_id to 28179956995457024 (), requested since_id was older than allowed -- since_id removed for pagination.","since_id_str":"28179956995457024","max_id_str":"30724239224995840","query":"%E6%9D%B1%E4%BA%AC%E3%80%80%E5%A4%A9%E6%B0%97"}
benchmarks/json-data/numbers.jsondeleted−1
@@ -1 +0,0 @@
1−[1.15, 1.3224999999999998, 1.5208749999999998, 1.7490062499999994, 2.0113571874999994, 2.313060765624999, 2.6600198804687487, 3.0590228625390607, 3.5178762919199196, 4.045557735707907, 4.652391396064092, 5.350250105473706, 6.152787621294761, 7.075705764488975, 8.137061629162321, 9.357620873536668, 10.761264004567169, 12.375453605252241, 14.231771646040077, 16.36653739294609, 18.821518001888, 21.644745702171196, 24.891457557496874, 28.625176191121405, 32.918952619789614, 37.856795512758055, 43.535314839671756, 50.06561206562252, 57.57545387546589, 66.21177195678577, 76.14353775030362, 87.56506841284916, 100.69982867477653, 115.804802975993, 133.17552342239193, 153.15185193575073, 176.1246297261133, 202.5433241850303, 232.9248228127848, 267.86354623470254, 308.04307816990786, 354.24953989539404, 407.3869708797031, 468.49501651165855, 538.7692689884072, 619.5846593366683, 712.5223582371685, 819.4007119727437, 942.3108187686552, 1083.6574415839534, 1246.2060578215462, 1433.136966494778, 1648.1075114689947, 1895.323638189344, 2179.622183917745, 2506.565511505407, 2882.5503382312177, 3314.9328889659, 3812.172822310785, 4383.998745657402, 5041.598557506012, 5797.838341131914, 6667.5140923017, 7667.641206146955, 8817.787387068996, 10140.455495129345, 11661.523819398746, 13410.752392308557, 15422.365251154839, 17735.720038828065, 20396.078044652273, 23455.489751350113, 26973.813214052625, 31019.885196160518, 35672.867975584595, 41023.79817192228, 47177.36789771062, 54253.97308236721, 62392.06904472228, 71750.87940143062, 82513.5113116452, 94890.53800839197, 109124.11870965076, 125492.73651609836, 144316.6469935131, 165964.14404254008, 190858.76564892105, 219487.5804962592, 252410.71757069806, 290272.32520630275, 333813.17398724816, 383885.1500853353, 441467.9225981356, 507688.1109878559, 583841.3276360342, 671417.5267814393, 772130.1557986551, 887949.6791684533, 1021142.1310437213, 1174313.4507002793, 1350460.4683053212, 1553029.5385511192, 1785983.969333787, 2053881.564733855, 2361963.7994439327, 2716258.369360523, 3123697.124764601, 3592251.6934792907, 4131089.447501184, 4750752.864626361, 5463365.794320315, 6282870.663468362, 7225301.262988616, 8309096.452436907, 9555460.920302443, 10988780.058347808, 12637097.067099977, 14532661.627164973, 16712560.871239718, 19219445.001925673, 22102361.752214525, 25417716.0150467, 29230373.417303704, 33614929.42989926, 38657168.84438414, 44455744.17104176, 51124105.79669802, 58792721.66620272, 67611629.91613312, 77753374.40355308, 89416380.56408603, 102828837.64869894, 118253163.29600377, 135991137.79040432, 156389808.45896497, 179848279.7278097, 206825521.68698114, 237849349.94002828, 273526752.4310325, 314555765.2956874, 361739130.09004045, 415999999.60354644, 478399999.5440784, 550159999.4756901, 632683999.3970436, 727586599.3066001, 836724589.20259, 962233277.5829784, 1106568269.2204251, 1272553509.6034887, 1463436536.044012, 1682952016.4506137, 1935394818.9182055, 2225704041.755936, 2559559648.019326, 2943493595.222225, 3385017634.5055585, 3892770279.681392, 4476685821.6336, 5148188694.87864, 5920416999.1104355, 6808479548.977001, 7829751481.32355, 9004214203.522081, 10354846334.050394, 11908073284.157951, 13694284276.781643, 15748426918.29889, 18110690956.04372, 20827294599.450275, 23951388789.367817, 27544097107.772987, 31675711673.938934, 36427068425.02977, 41891128688.78423, 48174797992.10186, 55401017690.91714, 63711170344.5547, 73267845896.2379, 84258022780.67358, 96896726197.77461, 111431235127.4408, 128145920396.5569, 147367808456.04044, 169472979724.44647, 194893926683.11343, 224128015685.58044, 257747218038.41748, 296409300744.1801, 340870695855.80707, 392001300234.1781, 450801495269.3048, 518421719559.70044, 596184977493.6555, 685612724117.7037, 788454632735.3593, 906722827645.6631, 1042731251792.5125, 1199140939561.3892, 1379012080495.5974, 1585863892569.937, 1823743476455.4275, 2097304997923.7415, 2411900747612.3022, 2773685859754.1475, 3189738738717.2695, 3668199549524.8594, 4218429481953.5884, 4851193904246.626, 5578872989883.619, 6415703938366.162, 7378059529121.086, 8484768458489.248, 9757483727262.635, 11221106286352.03, 12904272229304.832, 14839913063700.555, 17065900023255.637, 19625785026743.98, 22569652780755.58, 25955100697868.91, 29848365802549.246, 34325620672931.63, 39474463773871.375, 45395633339952.07, 52204978340944.88, 60035725092086.61, 69041083855899.59, 79397246434284.53, 91306833399427.2, 105002858409341.27, 120753287170742.45, 138866280246353.81, 159696222283306.88, 183650655625802.88, 211198253969673.3, 242877992065124.28, 279309690874892.9, 321206144506126.8, 369387066182045.8, 424795126109352.6, 488514395025755.5, 561791554279618.75, 646060287421561.5, 742969330534795.8, 854414730115015.0, 982576939632267.1, 1129963480577107.2, 1299458002663673.2, 1494376703063224.0, 1718533208522707.5, 1976313189801113.5, 2272760168271280.5, 2613674193511972.0, 3005725322538767.5, 3456584120919582.5, 3975071739057519.5, 4571332499916147.0, 5257032374903569.0, 6045587231139104.0, 6952425315809969.0, 7995289113181464.0, 9194582480158682.0, 1.0573769852182484e+16, 1.2159835330009856e+16, 1.3983810629511332e+16, 1.6081382223938032e+16, 1.8493589557528736e+16, 2.1267627991158044e+16, 2.4457772189831748e+16, 2.8126438018306508e+16, 3.234540372105248e+16, 3.719721427921035e+16, 4.27767964210919e+16, 4.919331588425568e+16, 5.657231326689403e+16, 6.505816025692813e+16, 7.481688429546734e+16, 8.603941693978744e+16, 9.894532948075555e+16, 1.1378712890286886e+17, 1.3085519823829918e+17, 1.5048347797404406e+17, 1.7305599967015066e+17, 1.9901439962067325e+17, 2.288665595637742e+17, 2.6319654349834032e+17, 3.026760250230913e+17, 3.48077428776555e+17, 4.002890430930382e+17, 4.603323995569939e+17, 5.29382259490543e+17, 6.087895984141244e+17, 7.00108038176243e+17, 8.051242439026793e+17, 9.258928804880812e+17, 1.0647768125612933e+18, 1.224493334445487e+18, 1.4081673346123103e+18, 1.6193924348041567e+18, 1.8623013000247798e+18, 2.1416464950284966e+18, 2.462893469282771e+18, 2.8323274896751867e+18, 3.257176613126464e+18, 3.7457531050954337e+18, 4.3076160708597484e+18, 4.95375848148871e+18, 5.696822253712016e+18, 6.551345591768818e+18, 7.53404743053414e+18, 8.66415454511426e+18, 9.963777726881399e+18, 1.1458344385913608e+19, 1.3177096043800648e+19, 1.5153660450370744e+19, 1.7426709517926355e+19, 2.0040715945615307e+19, 2.30468233374576e+19, 2.650384683807624e+19, 3.047942386378767e+19, 3.505133744335582e+19, 4.030903805985919e+19, 4.635539376883806e+19, 5.330870283416377e+19, 6.130500825928833e+19, 7.0500759498181575e+19, 8.10758734229088e+19, 9.323725443634512e+19, 1.0722284260179688e+20, 1.233062689920664e+20, 1.4180220934087634e+20, 1.6307254074200778e+20, 1.8753342185330894e+20, 2.1566343513130526e+20, 2.4801295040100103e+20, 2.8521489296115116e+20, 3.2799712690532385e+20, 3.7719669594112236e+20, 4.337762003322907e+20, 4.988426303821342e+20, 5.7366902493945437e+20, 6.597193786803724e+20, 7.586772854824282e+20, 8.724788783047925e+20, 1.0033507100505113e+21, 1.1538533165580878e+21, 1.326931314041801e+21, 1.5259710111480708e+21, 1.7548666628202813e+21, 2.0180966622433234e+21, 2.3208111615798217e+21, 2.668932835816795e+21, 3.0692727611893135e+21, 3.529663675367711e+21, 4.059113226672867e+21, 4.667980210673796e+21, 5.368177242274866e+21, 6.173403828616095e+21, 7.099414402908508e+21, 8.164326563344784e+21, 9.388975547846502e+21, 1.0797321880023475e+22, 1.2416920162026996e+22, 1.4279458186331043e+22, 1.64213769142807e+22, 1.8884583451422802e+22, 2.171727096913622e+22, 2.497486161450665e+22, 2.872109085668265e+22, 3.3029254485185042e+22, 3.798364265796279e+22, 4.368118905665721e+22, 5.0233367415155795e+22, 5.7768372527429155e+22, 6.643362840654352e+22, 7.639867266752504e+22, 8.78584735676538e+22, 1.0103724460280185e+23, 1.1619283129322213e+23, 1.3362175598720545e+23, 1.5366501938528623e+23, 1.7671477229307915e+23, 2.0322198813704103e+23, 2.3370528635759717e+23, 2.687610793112367e+23, 3.090752412079222e+23, 3.554365273891105e+23, 4.0875200649747705e+23, 4.700648074720986e+23, 5.405745285929133e+23, 6.216607078818502e+23, 7.149098140641278e+23, 8.221462861737468e+23, 9.454682290998088e+23, 1.0872884634647801e+24, 1.250381732984497e+24, 1.4379389929321714e+24, 1.653629841871997e+24, 1.9016743181527962e+24, 2.1869254658757156e+24, 2.5149642857570727e+24, 2.8922089286206334e+24, 3.326040267913728e+24, 3.824946308100787e+24, 4.3986882543159046e+24, 5.05849149246329e+24, 5.817265216332783e+24, 6.6898549987827e+24, 7.693333248600105e+24, 8.84733323589012e+24, 1.0174433221273637e+25, 1.1700598204464681e+25, 1.3455687935134384e+25, 1.547404112540454e+25, 1.779514729421522e+25, 2.04644193883475e+25, 2.353408229659962e+25, 2.7064194641089563e+25, 3.1123823837253e+25, 3.5792397412840944e+25, 4.116125702476708e+25, 4.733544557848214e+25, 5.443576241525446e+25, 6.260112677754262e+25, 7.199129579417401e+25, 8.27899901633001e+25, 9.52084886877951e+25, 1.0948976199096437e+26, 1.25913226289609e+26, 1.4480021023305035e+26, 1.665202417680079e+26, 1.9149827803320907e+26, 2.202230197381904e+26, 2.5325647269891895e+26, 2.9124494360375676e+26, 3.349316851443203e+26, 3.8517143791596826e+26, 4.429471536033635e+26, 5.09389226643868e+26, 5.857976106404481e+26, 6.736672522365153e+26, 7.747173400719924e+26, 8.909249410827912e+26, 1.0245636822452099e+27, 1.1782482345819913e+27, 1.35498546976929e+27, 1.5582332902346833e+27, 1.7919682837698857e+27, 2.0607635263353683e+27, 2.3698780552856732e+27, 2.725359763578524e+27, 3.1341637281153025e+27, 3.6042882873325974e+27, 4.1449315304324867e+27, 4.7666712599973594e+27, 5.481671948996963e+27, 6.303922741346507e+27, 7.249511152548482e+27, 8.336937825430755e+27, 9.587478499245366e+27, 1.102560027413217e+28, 1.2679440315251995e+28, 1.4581356362539794e+28, 1.6768559816920761e+28, 1.9283843789458875e+28, 2.2176420357877703e+28, 2.5502883411559357e+28, 2.932831592329326e+28, 3.3727563311787245e+28, 3.8786697808555327e+28, 4.460470247983863e+28, 5.129540785181441e+28, 5.8989719029586575e+28, 6.783817688402455e+28, 7.801390341662823e+28, 8.971598892912247e+28, 1.0317338726849081e+29, 1.1864939535876443e+29, 1.3644680466257909e+29, 1.5691382536196593e+29, 1.8045089916626083e+29, 2.0751853404119993e+29, 2.3864631414737988e+29, 2.7444326126948684e+29, 3.1560975045990984e+29, 3.629512130288963e+29, 4.173938949832307e+29, 4.800029792307153e+29, 5.520034261153225e+29, 6.348039400326208e+29, 7.300245310375139e+29, 8.39528210693141e+29, 9.65457442297112e+29, 1.1102760586416787e+30, 1.2768174674379305e+30, 1.46834008755362e+30, 1.6885911006866628e+30, 1.941879765789662e+30, 2.2331617306581113e+30, 2.568135990256828e+30, 2.9533563887953516e+30, 3.396359847114654e+30, 3.905813824181852e+30, 4.491685897809129e+30, 5.165438782480498e+30, 5.940254599852573e+30, 6.831292789830458e+30, 7.855986708305026e+30, 9.034384714550779e+30, 1.0389542421733396e+31, 1.1947973784993405e+31, 1.3740169852742412e+31, 1.5801195330653773e+31, 1.817137463025184e+31, 2.0897080824789613e+31, 2.4031642948508052e+31, 2.7636389390784257e+31, 3.1781847799401893e+31, 3.6549124969312175e+31, 4.2031493714709e+31, 4.833621777191535e+31, 5.558665043770264e+31, 6.392464800335803e+31, 7.3513345203861735e+31, 8.454034698444098e+31, 9.722139903210713e+31, 1.1180460888692319e+32, 1.2857530021996165e+32, 1.478615952529559e+32, 1.7004083454089925e+32, 1.9554695972203414e+32, 2.2487900368033926e+32, 2.586108542323901e+32, 2.974024823672486e+32, 3.420128547223359e+32, 3.933147829306862e+32, 4.523120003702891e+32, 5.2015880042583246e+32, 5.981826204897073e+32, 6.879100135631634e+32, 7.910965155976377e+32, 9.097609929372833e+32, 1.0462251418778757e+33, 1.2031589131595571e+33, 1.3836327501334904e+33, 1.591177662653514e+33, 1.8298543120515409e+33, 2.104332458859272e+33, 2.4199823276881623e+33, 2.7829796768413863e+33, 3.200426628367594e+33, 3.6804906226227334e+33, 4.232564216016143e+33, 4.867448848418564e+33, 5.597566175681348e+33, 6.437201102033549e+33, 7.402781267338582e+33, 8.513198457439368e+33, 9.790178226055273e+33, 1.1258704959963564e+34, 1.2947510703958096e+34, 1.488963730955181e+34, 1.712308290598458e+34, 1.9691545341882266e+34, 2.2645277143164603e+34, 2.604206871463929e+34, 2.994837902183518e+34, 3.4440635875110457e+34, 3.960673125637702e+34, 4.554774094483357e+34, 5.237990208655861e+34, 6.023688739954239e+34, 6.927242050947375e+34, 7.96632835858948e+34, 9.161277612377902e+34, 1.0535469254234585e+35, 1.2115789642369772e+35, 1.3933158088725236e+35, 1.6023131802034022e+35, 1.8426601572339122e+35, 2.119059180818999e+35, 2.4369180579418488e+35, 2.8024557666331258e+35, 3.2228241316280944e+35, 3.706247751372308e+35, 4.262184914078154e+35, 4.901512651189877e+35, 5.636739548868358e+35, 6.482250481198611e+35, 7.454588053378403e+35, 8.572776261385162e+35, 9.858692700592935e+35, 1.1337496605681875e+36, 1.3038121096534156e+36, 1.499383926101428e+36, 1.7242915150166418e+36, 1.982935242269138e+36, 2.2803755286095084e+36]
benchmarks/json-data/twitter1.jsondeleted−1
@@ -1 +0,0 @@
1−{"results":[{"from_user_id_str":"80430860","profile_image_url":"http://a2.twimg.com/profile_images/536455139/icon32_normal.png","created_at":"Wed, 26 Jan 2011 07:07:02 +0000","from_user":"kazu_yamamoto","id_str":"30159761706061824","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell Server Pages \u3063\u3066\u3001\u307e\u3060\u7d9a\u3044\u3066\u3044\u305f\u306e\u304b\uff01","id":30159761706061824,"from_user_id":80430860,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"}],"max_id":30159761706061824,"since_id":0,"refresh_url":"?since_id=30159761706061824&q=haskell","next_page":"?page=2&max_id=30159761706061824&rpp=1&q=haskell","results_per_page":1,"page":1,"completed_in":0.012606,"since_id_str":"0","max_id_str":"30159761706061824","query":"haskell"}
benchmarks/json-data/twitter10.jsondeleted−1
@@ -1 +0,0 @@
1−{"results":[{"from_user_id_str":"207858021","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Wed, 26 Jan 2011 04:30:38 +0000","from_user":"pboudarga","id_str":"30120402839666689","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I'm at Rolla Sushi Grill (27737 Bouquet Canyon Road, #106, Btw Haskell Canyon and Rosedell Drive, Saugus) http://4sq.com/gqqdhs","id":30120402839666689,"from_user_id":207858021,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://foursquare.com&quot; rel=&quot;nofollow&quot;&gt;foursquare&lt;/a&gt;"},{"from_user_id_str":"69988683","profile_image_url":"http://a0.twimg.com/profile_images/1211955817/avatar_7888_normal.gif","created_at":"Wed, 26 Jan 2011 04:25:23 +0000","from_user":"YNK33","id_str":"30119083059978240","metadata":{"result_type":"recent"},"to_user_id":null,"text":"hsndfile 0.5.0: Free and open source Haskell bindings for libsndfile http://bit.ly/gHaBWG Mac Os","id":30119083059978240,"from_user_id":69988683,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"81492","profile_image_url":"http://a1.twimg.com/profile_images/423894208/Picture_7_normal.jpg","created_at":"Wed, 26 Jan 2011 04:24:28 +0000","from_user":"satzz","id_str":"30118851488251904","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Emacs\u306e\u30e2\u30fc\u30c9\u8868\u793a\u304c\u4eca(Ruby Controller Outputz RoR Flymake REl hs)\u3068\u306a\u3063\u3066\u3066\u3088\u304f\u308f\u304b\u3089\u306a\u3044\u3093\u3060\u3051\u3069\u6700\u5f8c\u306eREl\u3068\u304bhs\u3063\u3066\u4f55\u3060\u308d\u3046\u2026haskell\u3068\u304b2\u5e74\u4ee5\u4e0a\u66f8\u3044\u3066\u306a\u3044\u3051\u3069\u2026","id":30118851488251904,"from_user_id":81492,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.hootsuite.com&quot; rel=&quot;nofollow&quot;&gt;HootSuite&lt;/a&gt;"},{"from_user_id_str":"9518356","profile_image_url":"http://a2.twimg.com/profile_images/119165723/ocaml-icon_normal.png","created_at":"Wed, 26 Jan 2011 04:19:19 +0000","from_user":"planet_ocaml","id_str":"30117557788741632","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I so miss #haskell type classes in #ocaml - i want to do something like refinement. Also why does ocaml not have... http://bit.ly/geYRwt","id":30117557788741632,"from_user_id":9518356,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"218059","profile_image_url":"http://a1.twimg.com/profile_images/1053837723/twitter-icon9_normal.jpg","created_at":"Wed, 26 Jan 2011 04:16:32 +0000","from_user":"aprikip","id_str":"30116854940835840","metadata":{"result_type":"recent"},"to_user_id":null,"text":"yatex-mode\u3084haskell-mode\u306e\u3053\u3068\u3067\u3059\u306d\u3001\u308f\u304b\u308a\u307e\u3059\u3002","id":30116854940835840,"from_user_id":218059,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://sites.google.com/site/yorufukurou/&quot; rel=&quot;nofollow&quot;&gt;YoruFukurou&lt;/a&gt;"},{"from_user_id_str":"216363","profile_image_url":"http://a1.twimg.com/profile_images/72454310/Tim-Avatar_normal.png","created_at":"Wed, 26 Jan 2011 04:15:30 +0000","from_user":"dysinger","id_str":"30116594684264448","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell in Hawaii tonight for me... #fun","id":30116594684264448,"from_user_id":216363,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.nambu.com/&quot; rel=&quot;nofollow&quot;&gt;Nambu&lt;/a&gt;"},{"from_user_id_str":"1774820","profile_image_url":"http://a2.twimg.com/profile_images/61169291/dan_desert_thumb_normal.jpg","created_at":"Wed, 26 Jan 2011 04:13:36 +0000","from_user":"DanMil","id_str":"30116117682851840","metadata":{"result_type":"recent"},"to_user_id":1594784,"text":"@ojrac @chewedwire @tomheon Haskell isn't a language, it's a belief system. A seductive one...","id":30116117682851840,"from_user_id":1774820,"to_user":"ojrac","geo":null,"iso_language_code":"en","to_user_id_str":"1594784","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"659256","profile_image_url":"http://a0.twimg.com/profile_images/746976711/angular-final_normal.jpg","created_at":"Wed, 26 Jan 2011 04:11:06 +0000","from_user":"djspiewak","id_str":"30115488931520512","metadata":{"result_type":"recent"},"to_user_id":null,"text":"One of the very nice things about Haskell as opposed to SML is the reduced proliferation of identifiers (e.g. andb, orb, etc). #typeclasses","id":30115488931520512,"from_user_id":659256,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://itunes.apple.com/us/app/twitter/id409789998?mt=12&quot; rel=&quot;nofollow&quot;&gt;Twitter for Mac&lt;/a&gt;"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Wed, 26 Jan 2011 04:06:12 +0000","from_user":"listwarenet","id_str":"30114255890026496","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-cafe/84752-re-haskell-cafe-gpl-license-of-h-matrix-and-prelude-numeric.html Re: Haskell-c","id":30114255890026496,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"&lt;a href=&quot;http://1e10.org/cloud/&quot; rel=&quot;nofollow&quot;&gt;1e10&lt;/a&gt;"},{"from_user_id_str":"1594784","profile_image_url":"http://a2.twimg.com/profile_images/378515773/square-profile_normal.jpg","created_at":"Wed, 26 Jan 2011 04:01:29 +0000","from_user":"ojrac","id_str":"30113067333324800","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @tomheon: @ojrac @chewedwire Don't worry, learning Haskell will not give you any clear idea what monad means.","id":30113067333324800,"from_user_id":1594784,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"}],"max_id":30120402839666689,"since_id":0,"refresh_url":"?since_id=30120402839666689&q=haskell","next_page":"?page=2&max_id=30120402839666689&rpp=10&q=haskell","results_per_page":10,"page":1,"completed_in":0.012714,"since_id_str":"0","max_id_str":"30120402839666689","query":"haskell"}
benchmarks/json-data/twitter100.jsondeleted−1
@@ -1 +0,0 @@
1−{"results":[{"from_user_id_str":"3646730","profile_image_url":"http://a3.twimg.com/profile_images/404973767/avatar_normal.jpg","created_at":"Wed, 26 Jan 2011 04:35:07 +0000","from_user":"nicolaslara","id_str":"30121530767708160","metadata":{"result_type":"recent"},"to_user_id":18616016,"text":"@josej30 Python y Clojure. Obviamente son diferentes, y cada uno tiene sus ventajas y desventajas. De Haskell faltar\u00eda pattern matching","id":30121530767708160,"from_user_id":3646730,"to_user":"josej30","geo":null,"iso_language_code":"es","to_user_id_str":"18616016","source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"207858021","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Wed, 26 Jan 2011 04:30:38 +0000","from_user":"pboudarga","id_str":"30120402839666689","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I'm at Rolla Sushi Grill (27737 Bouquet Canyon Road, #106, Btw Haskell Canyon and Rosedell Drive, Saugus) http://4sq.com/gqqdhs","id":30120402839666689,"from_user_id":207858021,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://foursquare.com&quot; rel=&quot;nofollow&quot;&gt;foursquare&lt;/a&gt;"},{"from_user_id_str":"69988683","profile_image_url":"http://a0.twimg.com/profile_images/1211955817/avatar_7888_normal.gif","created_at":"Wed, 26 Jan 2011 04:25:23 +0000","from_user":"YNK33","id_str":"30119083059978240","metadata":{"result_type":"recent"},"to_user_id":null,"text":"hsndfile 0.5.0: Free and open source Haskell bindings for libsndfile http://bit.ly/gHaBWG Mac Os","id":30119083059978240,"from_user_id":69988683,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"81492","profile_image_url":"http://a1.twimg.com/profile_images/423894208/Picture_7_normal.jpg","created_at":"Wed, 26 Jan 2011 04:24:28 +0000","from_user":"satzz","id_str":"30118851488251904","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Emacs\u306e\u30e2\u30fc\u30c9\u8868\u793a\u304c\u4eca(Ruby Controller Outputz RoR Flymake REl hs)\u3068\u306a\u3063\u3066\u3066\u3088\u304f\u308f\u304b\u3089\u306a\u3044\u3093\u3060\u3051\u3069\u6700\u5f8c\u306eREl\u3068\u304bhs\u3063\u3066\u4f55\u3060\u308d\u3046\u2026haskell\u3068\u304b2\u5e74\u4ee5\u4e0a\u66f8\u3044\u3066\u306a\u3044\u3051\u3069\u2026","id":30118851488251904,"from_user_id":81492,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.hootsuite.com&quot; rel=&quot;nofollow&quot;&gt;HootSuite&lt;/a&gt;"},{"from_user_id_str":"9518356","profile_image_url":"http://a2.twimg.com/profile_images/119165723/ocaml-icon_normal.png","created_at":"Wed, 26 Jan 2011 04:19:19 +0000","from_user":"planet_ocaml","id_str":"30117557788741632","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I so miss #haskell type classes in #ocaml - i want to do something like refinement. Also why does ocaml not have... http://bit.ly/geYRwt","id":30117557788741632,"from_user_id":9518356,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"218059","profile_image_url":"http://a1.twimg.com/profile_images/1053837723/twitter-icon9_normal.jpg","created_at":"Wed, 26 Jan 2011 04:16:32 +0000","from_user":"aprikip","id_str":"30116854940835840","metadata":{"result_type":"recent"},"to_user_id":null,"text":"yatex-mode\u3084haskell-mode\u306e\u3053\u3068\u3067\u3059\u306d\u3001\u308f\u304b\u308a\u307e\u3059\u3002","id":30116854940835840,"from_user_id":218059,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://sites.google.com/site/yorufukurou/&quot; rel=&quot;nofollow&quot;&gt;YoruFukurou&lt;/a&gt;"},{"from_user_id_str":"216363","profile_image_url":"http://a1.twimg.com/profile_images/72454310/Tim-Avatar_normal.png","created_at":"Wed, 26 Jan 2011 04:15:30 +0000","from_user":"dysinger","id_str":"30116594684264448","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell in Hawaii tonight for me... #fun","id":30116594684264448,"from_user_id":216363,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.nambu.com/&quot; rel=&quot;nofollow&quot;&gt;Nambu&lt;/a&gt;"},{"from_user_id_str":"1774820","profile_image_url":"http://a2.twimg.com/profile_images/61169291/dan_desert_thumb_normal.jpg","created_at":"Wed, 26 Jan 2011 04:13:36 +0000","from_user":"DanMil","id_str":"30116117682851840","metadata":{"result_type":"recent"},"to_user_id":1594784,"text":"@ojrac @chewedwire @tomheon Haskell isn't a language, it's a belief system. A seductive one...","id":30116117682851840,"from_user_id":1774820,"to_user":"ojrac","geo":null,"iso_language_code":"en","to_user_id_str":"1594784","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"659256","profile_image_url":"http://a0.twimg.com/profile_images/746976711/angular-final_normal.jpg","created_at":"Wed, 26 Jan 2011 04:11:06 +0000","from_user":"djspiewak","id_str":"30115488931520512","metadata":{"result_type":"recent"},"to_user_id":null,"text":"One of the very nice things about Haskell as opposed to SML is the reduced proliferation of identifiers (e.g. andb, orb, etc). #typeclasses","id":30115488931520512,"from_user_id":659256,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://itunes.apple.com/us/app/twitter/id409789998?mt=12&quot; rel=&quot;nofollow&quot;&gt;Twitter for Mac&lt;/a&gt;"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Wed, 26 Jan 2011 04:06:12 +0000","from_user":"listwarenet","id_str":"30114255890026496","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-cafe/84752-re-haskell-cafe-gpl-license-of-h-matrix-and-prelude-numeric.html Re: Haskell-c","id":30114255890026496,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"&lt;a href=&quot;http://1e10.org/cloud/&quot; rel=&quot;nofollow&quot;&gt;1e10&lt;/a&gt;"},{"from_user_id_str":"1594784","profile_image_url":"http://a2.twimg.com/profile_images/378515773/square-profile_normal.jpg","created_at":"Wed, 26 Jan 2011 04:01:29 +0000","from_user":"ojrac","id_str":"30113067333324800","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @tomheon: @ojrac @chewedwire Don't worry, learning Haskell will not give you any clear idea what monad means.","id":30113067333324800,"from_user_id":1594784,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"207589736","profile_image_url":"http://a3.twimg.com/profile_images/1225527428/headshot_1_normal.jpg","created_at":"Wed, 26 Jan 2011 04:00:13 +0000","from_user":"ashleevelazq101","id_str":"30112747555397632","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Federal investigation finds safety violations at The Acadia Hospital: By Meg Haskell, BDN Staff The investigatio... http://bit.ly/dONnpn","id":30112747555397632,"from_user_id":207589736,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"17671137","profile_image_url":"http://a2.twimg.com/profile_images/290264834/Haskell-logo-outer-glow_normal.png","created_at":"Wed, 26 Jan 2011 03:58:00 +0000","from_user":"Hackage","id_str":"30112192346984448","metadata":{"result_type":"recent"},"to_user_id":null,"text":"streams 0.4, added by EdwardKmett: Various Haskell 2010 stream comonads http://bit.ly/idBkPe","id":30112192346984448,"from_user_id":17671137,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"17489366","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Wed, 26 Jan 2011 03:58:00 +0000","from_user":"aapnoot","id_str":"30112191881420800","metadata":{"result_type":"recent"},"to_user_id":null,"text":"streams 0.4, added by EdwardKmett: Various Haskell 2010 stream comonads http://bit.ly/idBkPe","id":30112191881420800,"from_user_id":17489366,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"8530482","profile_image_url":"http://a2.twimg.com/profile_images/137867266/n608671563_7396_normal.jpg","created_at":"Wed, 26 Jan 2011 03:50:12 +0000","from_user":"jeffmclamb","id_str":"30110229207187456","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Angel - daemon to run and monitor processes like daemontools or god, written in Haskell http://ff.im/-wNyLk","id":30110229207187456,"from_user_id":8530482,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://friendfeed.com&quot; rel=&quot;nofollow&quot;&gt;FriendFeed&lt;/a&gt;"},{"from_user_id_str":"177539201","profile_image_url":"http://a0.twimg.com/profile_images/1178368800/img_normal.jpeg","created_at":"Wed, 26 Jan 2011 03:46:01 +0000","from_user":"tomheon","id_str":"30109174645919744","metadata":{"result_type":"recent"},"to_user_id":1594784,"text":"@ojrac @chewedwire Don't worry, learning Haskell will not give you any clear idea what monad means.","id":30109174645919744,"from_user_id":177539201,"to_user":"ojrac","geo":null,"iso_language_code":"en","to_user_id_str":"1594784","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"1594784","profile_image_url":"http://a2.twimg.com/profile_images/378515773/square-profile_normal.jpg","created_at":"Wed, 26 Jan 2011 03:44:34 +0000","from_user":"ojrac","id_str":"30108808684503040","metadata":{"result_type":"recent"},"to_user_id":128028225,"text":"@chewedwire @tomheon Why are you making me curious about Haskell? I LIKE not knowing what monad means!!","id":30108808684503040,"from_user_id":1594784,"to_user":"chewedwire","geo":null,"iso_language_code":"en","to_user_id_str":"128028225","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"23750094","profile_image_url":"http://a0.twimg.com/profile_images/951373780/Moeinthecar_normal.jpg","created_at":"Wed, 26 Jan 2011 03:41:54 +0000","from_user":"shokalshab","id_str":"30108140443795456","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I'm at Magnitude Cheer @ Gymnastics Olympica USA (7735 Haskell Ave., btw Saticoy &amp; Strathern, Van Nuys) http://4sq.com/gmXfaL","id":30108140443795456,"from_user_id":23750094,"geo":null,"iso_language_code":"en","place":{"id":"4e4a2a2f86cb2946","type":"poi","full_name":"Gymnastics Olympica USA, Van Nuys"},"to_user_id_str":null,"source":"&lt;a href=&quot;http://foursquare.com&quot; rel=&quot;nofollow&quot;&gt;foursquare&lt;/a&gt;"},{"from_user_id_str":"8135112","profile_image_url":"http://a0.twimg.com/profile_images/1165240350/LIMITED_normal.jpg","created_at":"Wed, 26 Jan 2011 03:41:35 +0000","from_user":"Claricei","id_str":"30108059208515584","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @kristenmchugh22: @KeithOlbermann Ryan looks like Jughead w/o the hat. And sounds as mealy-mouthed as Eddie Haskell.","id":30108059208515584,"from_user_id":8135112,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"128028225","profile_image_url":"http://a1.twimg.com/profile_images/1224994593/Coding_Drunk_normal.jpg","created_at":"Wed, 26 Jan 2011 03:40:02 +0000","from_user":"chewedwire","id_str":"30107670367182848","metadata":{"result_type":"recent"},"to_user_id":177539201,"text":"@tomheon Cool, I'll take a look. I feel like I should mention this: http://bit.ly/hVstDM","id":30107670367182848,"from_user_id":128028225,"to_user":"tomheon","geo":null,"iso_language_code":"en","to_user_id_str":"177539201","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"8679778","profile_image_url":"http://a3.twimg.com/profile_images/1195318056/me_nyc_12_18_10_icon_normal.jpg","created_at":"Wed, 26 Jan 2011 03:38:42 +0000","from_user":"kristenmchugh22","id_str":"30107332381777920","metadata":{"result_type":"recent"},"to_user_id":756269,"text":"@KeithOlbermann Ryan looks like Jughead w/o the hat. And sounds as mealy-mouthed as Eddie Haskell.","id":30107332381777920,"from_user_id":8679778,"to_user":"KeithOlbermann","geo":null,"iso_language_code":"en","to_user_id_str":"756269","source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"103316559","profile_image_url":"http://a1.twimg.com/profile_images/1179458751/bc3beab4-d59d-4e78-b13b-50747986cfa2_normal.png","created_at":"Wed, 26 Jan 2011 03:36:15 +0000","from_user":"cityslikr","id_str":"30106719153557504","metadata":{"result_type":"recent"},"to_user_id":null,"text":"&quot;Social safety net into a hammock.&quot; So says Eddie Haskell with the GOP response. #SOTU","id":30106719153557504,"from_user_id":103316559,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://blackberry.com/twitter&quot; rel=&quot;nofollow&quot;&gt;Twitter for BlackBerry\u00ae&lt;/a&gt;"},{"from_user_id_str":"169063143","profile_image_url":"http://a0.twimg.com/profile_images/1160506212/9697_1_normal.gif","created_at":"Wed, 26 Jan 2011 03:31:52 +0000","from_user":"wrkforce_safety","id_str":"30105614919143424","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Federal investigation finds safety violations at The Acadia Hospital: By Meg Haskell, BDN Staff The investigatio... http://bit.ly/gA60C1","id":30105614919143424,"from_user_id":169063143,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"177539201","profile_image_url":"http://a0.twimg.com/profile_images/1178368800/img_normal.jpeg","created_at":"Wed, 26 Jan 2011 03:29:40 +0000","from_user":"tomheon","id_str":"30105060960632832","metadata":{"result_type":"recent"},"to_user_id":128028225,"text":"@chewedwire Great book on Haskell: http://oreilly.com/catalog/9780596514983","id":30105060960632832,"from_user_id":177539201,"to_user":"chewedwire","geo":null,"iso_language_code":"en","to_user_id_str":"128028225","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"782692","profile_image_url":"http://a0.twimg.com/profile_images/1031304589/Profile.2007.1_normal.jpg","created_at":"Wed, 26 Jan 2011 03:29:19 +0000","from_user":"turnageb","id_str":"30104974591533057","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @ovillalon: Paul Ryan solves the mystery of whatever happened to Eddie Haskell. #sotu","id":30104974591533057,"from_user_id":782692,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"128028225","profile_image_url":"http://a1.twimg.com/profile_images/1224994593/Coding_Drunk_normal.jpg","created_at":"Wed, 26 Jan 2011 03:28:04 +0000","from_user":"chewedwire","id_str":"30104657267265536","metadata":{"result_type":"recent"},"to_user_id":177539201,"text":"@tomheon I always loved the pattern matching in SML and it looks like Haskell is MUCH better at it. I'm messing around now at tryhaskell.org","id":30104657267265536,"from_user_id":128028225,"to_user":"tomheon","geo":null,"iso_language_code":"en","to_user_id_str":"177539201","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"12834082","profile_image_url":"http://a3.twimg.com/profile_images/1083036140/mugshot_normal.png","created_at":"Wed, 26 Jan 2011 03:28:01 +0000","from_user":"ovillalon","id_str":"30104647213518848","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Paul Ryan solves the mystery of whatever happened to Eddie Haskell. #sotu","id":30104647213518848,"from_user_id":12834082,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"13540930","profile_image_url":"http://a1.twimg.com/profile_images/1205312219/23467_350321383101_821143101_5114147_3010041_n_normal.jpg","created_at":"Wed, 26 Jan 2011 03:26:02 +0000","from_user":"goodfox","id_str":"30104146455560192","metadata":{"result_type":"recent"},"to_user_id":10226179,"text":"@billykeene22 Bordeaux is one of my heroes. I was so excited when he accepted the invitation to campus. He's been a great friend to Haskell.","id":30104146455560192,"from_user_id":13540930,"to_user":"billykeene22","geo":null,"iso_language_code":"en","to_user_id_str":"10226179","source":"&lt;a href=&quot;http://www.ubertwitter.com/bb/download.php&quot; rel=&quot;nofollow&quot;&gt;\u00dcberTwitter&lt;/a&gt;"},{"from_user_id_str":"18616016","profile_image_url":"http://a2.twimg.com/profile_images/1173522726/214397343_normal.jpg","created_at":"Wed, 26 Jan 2011 03:25:18 +0000","from_user":"josej30","id_str":"30103962313031681","metadata":{"result_type":"recent"},"to_user_id":14870909,"text":"@cris7ian Ahh bueno multiparadigma ya es respetable :) Empezar\u00e9 a explotar la parte funcional de los lenguajes ahora #Haskell","id":30103962313031681,"from_user_id":18616016,"to_user":"Cris7ian","geo":null,"iso_language_code":"es","to_user_id_str":"14870909","source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"14870909","profile_image_url":"http://a2.twimg.com/profile_images/1176930429/oso_yo_normal.png","created_at":"Wed, 26 Jan 2011 03:23:43 +0000","from_user":"Cris7ian","id_str":"30103562360983553","metadata":{"result_type":"recent"},"to_user_id":18616016,"text":"@josej30 hahaha no, es multiparadigma y es bastante lazy. Nothing like haskell, pero s\u00ed, el de Flash","id":30103562360983553,"from_user_id":14870909,"to_user":"josej30","geo":null,"iso_language_code":"es","to_user_id_str":"18616016","source":"&lt;a href=&quot;http://www.echofon.com/&quot; rel=&quot;nofollow&quot;&gt;Echofon&lt;/a&gt;"},{"from_user_id_str":"2421643","profile_image_url":"http://a0.twimg.com/profile_images/1190361665/ernestgrumbles-17_normal.jpg","created_at":"Wed, 26 Jan 2011 03:20:24 +0000","from_user":"ernestgrumbles","id_str":"30102730756333568","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Wow... WolframAlpha did not know who Eddie Haskell is. Guess I'll never use that &quot;knowledge engine&quot; again.","id":30102730756333568,"from_user_id":2421643,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"128028225","profile_image_url":"http://a1.twimg.com/profile_images/1224994593/Coding_Drunk_normal.jpg","created_at":"Wed, 26 Jan 2011 03:14:21 +0000","from_user":"chewedwire","id_str":"30101204428132352","metadata":{"result_type":"recent"},"to_user_id":177539201,"text":"@tomheon How is Haskell better/different from CL or Scheme? I honestly don't know, although I'm becoming more curious.","id":30101204428132352,"from_user_id":128028225,"to_user":"tomheon","geo":null,"iso_language_code":"en","to_user_id_str":"177539201","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"13540930","profile_image_url":"http://a1.twimg.com/profile_images/1205312219/23467_350321383101_821143101_5114147_3010041_n_normal.jpg","created_at":"Wed, 26 Jan 2011 03:06:54 +0000","from_user":"goodfox","id_str":"30099329809129473","metadata":{"result_type":"recent"},"to_user_id":null,"text":"A day of vision &amp; speeches. #SOTU now. And a wonderful Haskell Convocation address earlier today by Sinte Gleske President Lionel Bordeaux.","id":30099329809129473,"from_user_id":13540930,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.ubertwitter.com/bb/download.php&quot; rel=&quot;nofollow&quot;&gt;\u00dcberTwitter&lt;/a&gt;"},{"from_user_id_str":"119185220","profile_image_url":"http://a0.twimg.com/profile_images/1089027228/dfg_normal.jpg","created_at":"Wed, 26 Jan 2011 03:03:38 +0000","from_user":"LaLiciouz_03","id_str":"30098510623805440","metadata":{"result_type":"recent"},"to_user_id":null,"text":"The Game with the girl room 330 Haskell follow us...","id":30098510623805440,"from_user_id":119185220,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"18616016","profile_image_url":"http://a2.twimg.com/profile_images/1173522726/214397343_normal.jpg","created_at":"Wed, 26 Jan 2011 02:57:25 +0000","from_user":"josej30","id_str":"30096946144215040","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Voy a extra\u00f1ar Haskell cuando regrese al mundo imperativo. Hay alg\u00fan lenguaje imperativo que tenga este poder funcional? #ci3661","id":30096946144215040,"from_user_id":18616016,"geo":null,"iso_language_code":"es","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"17671137","profile_image_url":"http://a2.twimg.com/profile_images/290264834/Haskell-logo-outer-glow_normal.png","created_at":"Wed, 26 Jan 2011 02:55:32 +0000","from_user":"Hackage","id_str":"30096471814574080","metadata":{"result_type":"recent"},"to_user_id":null,"text":"comonad-transformers 0.9.0, added by EdwardKmett: Haskell 98 comonad transformers http://bit.ly/h6xIsf","id":30096471814574080,"from_user_id":17671137,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"177539201","profile_image_url":"http://a0.twimg.com/profile_images/1178368800/img_normal.jpeg","created_at":"Wed, 26 Jan 2011 02:48:12 +0000","from_user":"tomheon","id_str":"30094626920603649","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Every time I look at Haskell I love it more.","id":30094626920603649,"from_user_id":177539201,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"60792568","profile_image_url":"http://a0.twimg.com/profile_images/1203647517/glenda-flash_normal.jpg","created_at":"Wed, 26 Jan 2011 02:40:42 +0000","from_user":"r_takaishi","id_str":"30092735935422464","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell\u3088\u308aD\u8a00\u8a9e\u304c\u4e0a\u3068\u306f\u601d\u308f\u306a\u304b\u3063\u305f\uff0e http://www.tiobe.com/index.php/content/paperinfo/tpci/index.html","id":30092735935422464,"from_user_id":60792568,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twmode.sf.net/&quot; rel=&quot;nofollow&quot;&gt;twmode&lt;/a&gt;"},{"from_user_id_str":"160145510","profile_image_url":"http://a0.twimg.com/profile_images/1218108166/going_galt_normal.jpg","created_at":"Wed, 26 Jan 2011 02:39:31 +0000","from_user":"wtp1787","id_str":"30092439653974018","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @KLSouth: Eddie Haskell Goes to Washington... &quot;You look really nice tonight, Ms Cleaver&quot;","id":30092439653974018,"from_user_id":160145510,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"96616016","profile_image_url":"http://a1.twimg.com/profile_images/1196978169/Picture0002_normal.jpg","created_at":"Wed, 26 Jan 2011 02:39:20 +0000","from_user":"MelissaRNMBA","id_str":"30092392203816960","metadata":{"result_type":"recent"},"to_user_id":14862975,"text":"@KLSouth At least Eddie Haskell was entertaining.","id":30092392203816960,"from_user_id":96616016,"to_user":"KLSouth","geo":null,"iso_language_code":"en","to_user_id_str":"14862975","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"14862975","profile_image_url":"http://a0.twimg.com/profile_images/421596393/kls_4_normal.JPG","created_at":"Wed, 26 Jan 2011 02:38:29 +0000","from_user":"KLSouth","id_str":"30092178327871489","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Eddie Haskell Goes to Washington... &quot;You look really nice tonight, Ms Cleaver&quot;","id":30092178327871489,"from_user_id":14862975,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Wed, 26 Jan 2011 02:36:17 +0000","from_user":"listwarenet","id_str":"30091626869161984","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-beginners/84641-haskell-beginners-wildcards-in-expressions.html Haskell-beginners - Wild","id":30091626869161984,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"&lt;a href=&quot;http://1e10.org/cloud/&quot; rel=&quot;nofollow&quot;&gt;1e10&lt;/a&gt;"},{"from_user_id_str":"24538048","profile_image_url":"http://a2.twimg.com/profile_images/1117267605/rope_normal.jpg","created_at":"Wed, 26 Jan 2011 02:23:14 +0000","from_user":"dbph","id_str":"30088341030440960","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @dnene: Skilled Calisthenics. Haskell code that outputs python which spits ruby which emits the haskell source. http://j.mp/YlQUL via @mfeathers","id":30088341030440960,"from_user_id":24538048,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"158951567","profile_image_url":"http://a3.twimg.com/profile_images/962721419/Logo_3_normal.jpg","created_at":"Wed, 26 Jan 2011 01:58:31 +0000","from_user":"YubaVetTech","id_str":"30082124207886336","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Dr. Haskell has just been awarded the prestigious Hayward Award for \u2018Excellence in Education\u2019. This award honors... http://fb.me/QgQCxd74","id":30082124207886336,"from_user_id":158951567,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.facebook.com/twitter&quot; rel=&quot;nofollow&quot;&gt;Facebook&lt;/a&gt;"},{"from_user_id_str":"158951567","profile_image_url":"http://a3.twimg.com/profile_images/962721419/Logo_3_normal.jpg","created_at":"Wed, 26 Jan 2011 01:56:04 +0000","from_user":"YubaVetTech","id_str":"30081505476743168","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Dr. Haskell has just been awarded the prestigous Haward Award for Excellence in Education. This award honors... http://fb.me/PC9mYmCR","id":30081505476743168,"from_user_id":158951567,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.facebook.com/twitter&quot; rel=&quot;nofollow&quot;&gt;Facebook&lt;/a&gt;"},{"from_user_id_str":"2331498","profile_image_url":"http://a3.twimg.com/profile_images/494632120/me_normal.jpg","created_at":"Wed, 26 Jan 2011 01:43:50 +0000","from_user":"Verus","id_str":"30078427155406848","metadata":{"result_type":"recent"},"to_user_id":79273052,"text":"@kami_joe \u3044\u3084\uff0c\u8ab2\u984c\u306f\u89e3\u6c7a\u5bfe\u8c61(\u30d1\u30ba\u30eb\u3068\u304b)\u3092\u4e0e\u3048\u3089\u308c\u3066\uff0c\u554f\u984c\u5b9a\u7fa9\u3068\u30d7\u30ed\u30b0\u30e9\u30df\u30f3\u30b0(\u6307\u5b9a\u8a00\u8a9e\u306fC++\u3082\u3057\u304f\u306fJava)\u3068\u3044\u3046\u3044\u308f\u3070\u666e\u901a\u306a\u8ab2\u984c\u3067\u306f\u3042\u308b\u3093\u3060\u3051\u3069\uff0e\u95a2\u6570\u578b\u8a00\u8a9e\u306fHaskell\u306e\u6388\u696d\u304c\u307e\u305f\u5225\u306b\u3042\u308b\u306e\uff0e","id":30078427155406848,"from_user_id":2331498,"to_user":"kami_joe","geo":null,"iso_language_code":"ja","to_user_id_str":"79273052","source":"&lt;a href=&quot;http://itunes.apple.com/us/app/twitter/id409789998?mt=12&quot; rel=&quot;nofollow&quot;&gt;Twitter for Mac&lt;/a&gt;"},{"from_user_id_str":"79151233","profile_image_url":"http://a2.twimg.com/a/1295051201/images/default_profile_2_normal.png","created_at":"Wed, 26 Jan 2011 01:40:37 +0000","from_user":"cz_newdrafts","id_str":"30077617361125376","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell programming language http://bit.ly/gpPAwB","id":30077617361125376,"from_user_id":79151233,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"&lt;a href=&quot;http://tommorris.org/&quot; rel=&quot;nofollow&quot;&gt;tommorris' hacksample&lt;/a&gt;"},{"from_user_id_str":"2331498","profile_image_url":"http://a3.twimg.com/profile_images/494632120/me_normal.jpg","created_at":"Wed, 26 Jan 2011 01:02:57 +0000","from_user":"Verus","id_str":"30068139416879104","metadata":{"result_type":"recent"},"to_user_id":9252720,"text":"@shukukei Java\u3068C\u306f\u3042\u308b\u7a0b\u5ea6\u66f8\u3051\u3066\u3042\u305f\u308a\u307e\u3048\u306a\u3068\u3053\u308d\u304c\u3042\u308b\u304b\u3089\u306a\u30fc\uff0ePython\u306f\u500b\u4eba\u7684\u306b\u611f\u899a\u304c\u5408\u308f\u306a\u3044\uff0e\u611f\u899a\u306a\u306e\u3067\uff0c\u3082\u3046\u3069\u3046\u3057\u3088\u3046\u3082\u306a\u3044\uff57 \u3044\u307e\u306fScala\u3068Haskell\u3092\u3082\u3063\u3068\u6975\u3081\u305f\u3044\u3068\u3053\u308d\uff0e","id":30068139416879104,"from_user_id":2331498,"to_user":"shukukei","geo":null,"iso_language_code":"ja","to_user_id_str":"9252720","source":"&lt;a href=&quot;http://itunes.apple.com/us/app/twitter/id409789998?mt=12&quot; rel=&quot;nofollow&quot;&gt;Twitter for Mac&lt;/a&gt;"},{"from_user_id_str":"2781460","profile_image_url":"http://a0.twimg.com/profile_images/82526625/.joeyicon_normal.jpg","created_at":"Wed, 26 Jan 2011 01:02:35 +0000","from_user":"joeyhess","id_str":"30068046538219520","metadata":{"result_type":"recent"},"to_user_id":null,"text":"just figured out that I can use parameterized types to remove a dependency loop in git-annex's type definitions. whee #haskell","id":30068046538219520,"from_user_id":2781460,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://identi.ca&quot; rel=&quot;nofollow&quot;&gt;identica&lt;/a&gt;"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Wed, 26 Jan 2011 00:54:22 +0000","from_user":"listwarenet","id_str":"30065977920061440","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-beginners/84466-haskell-beginners-bytestring-question.html Haskell-beginners - Bytestrin","id":30065977920061440,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"&lt;a href=&quot;http://1e10.org/cloud/&quot; rel=&quot;nofollow&quot;&gt;1e10&lt;/a&gt;"},{"from_user_id_str":"1291845","profile_image_url":"http://a0.twimg.com/profile_images/1225743404/ThinOxygen-small-opaque-solidarity_normal.png","created_at":"Wed, 26 Jan 2011 00:52:07 +0000","from_user":"_aaron_","id_str":"30065412242669568","metadata":{"result_type":"recent"},"to_user_id":null,"text":"wanted: librly licensed high level native compiled lang with min runtime (otherwise cobra/mono would be perfect) for win. lua? haskell? ooc?","id":30065412242669568,"from_user_id":1291845,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"5912444","profile_image_url":"http://a2.twimg.com/profile_images/546261026/ssf0xg11_normal.jpg","created_at":"Wed, 26 Jan 2011 00:45:45 +0000","from_user":"shelarcy","id_str":"30063810773516288","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @Hackage: download 0.3.1.1, added by MagnusTherning: High-level file download based on URLs http://bit.ly/eHfiJB","id":30063810773516288,"from_user_id":5912444,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"135993","profile_image_url":"http://a2.twimg.com/profile_images/1190667086/myface2010small_normal.jpg","created_at":"Wed, 26 Jan 2011 00:41:00 +0000","from_user":"kudzu_naoki","id_str":"30062613287141376","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @tanakh: \u9b54\u6cd5Haskell\u5c11\u5973\u5019\u88dc\u3092\u63a2\u3059\u306e\u3082\u5927\u5909\u306a\u3093\u3060","id":30062613287141376,"from_user_id":135993,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.hootsuite.com&quot; rel=&quot;nofollow&quot;&gt;HootSuite&lt;/a&gt;"},{"from_user_id_str":"52620546","profile_image_url":"http://a1.twimg.com/profile_images/434693356/twitter-icon_normal.png","created_at":"Wed, 26 Jan 2011 00:40:25 +0000","from_user":"omasanori","id_str":"30062465656033280","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u9b54\u6cd5Haskell\u5c11\u5973\u306e\u4e00\u65e5\u306fGHC HEAD\u306e\u30d3\u30eb\u30c9\u304b\u3089\u59cb\u307e\u308b","id":30062465656033280,"from_user_id":52620546,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.movatwi.jp&quot; rel=&quot;nofollow&quot;&gt;www.movatwi.jp&lt;/a&gt;"},{"from_user_id_str":"52620546","profile_image_url":"http://a1.twimg.com/profile_images/434693356/twitter-icon_normal.png","created_at":"Wed, 26 Jan 2011 00:37:12 +0000","from_user":"omasanori","id_str":"30061656331526144","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @tanakh: \u50d5\u3068\u5951\u7d04\u3057\u3066\u9b54\u6cd5Haskell\u5c11\u5973\u306b\u306a\u308d\u3046\u3088\uff01","id":30061656331526144,"from_user_id":52620546,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.hootsuite.com&quot; rel=&quot;nofollow&quot;&gt;HootSuite&lt;/a&gt;"},{"from_user_id_str":"135993","profile_image_url":"http://a2.twimg.com/profile_images/1190667086/myface2010small_normal.jpg","created_at":"Wed, 26 Jan 2011 00:35:42 +0000","from_user":"kudzu_naoki","id_str":"30061282665168896","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @tanakh: \u50d5\u3068\u5951\u7d04\u3057\u3066\u9b54\u6cd5Haskell\u5c11\u5973\u306b\u306a\u308d\u3046\u3088\uff01","id":30061282665168896,"from_user_id":135993,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.hootsuite.com&quot; rel=&quot;nofollow&quot;&gt;HootSuite&lt;/a&gt;"},{"from_user_id_str":"1631333","profile_image_url":"http://a1.twimg.com/profile_images/81268862/profile300_normal.jpg","created_at":"Wed, 26 Jan 2011 00:30:02 +0000","from_user":"qnighy","id_str":"30059855884582913","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @tanakh: \u50d5\u3068\u5951\u7d04\u3057\u3066\u9b54\u6cd5Haskell\u5c11\u5973\u306b\u306a\u308d\u3046\u3088\uff01","id":30059855884582913,"from_user_id":1631333,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.hootsuite.com&quot; rel=&quot;nofollow&quot;&gt;HootSuite&lt;/a&gt;"},{"from_user_id_str":"9093754","profile_image_url":"http://a1.twimg.com/profile_images/99435906/PHD_3d_col_blk_normal.jpg","created_at":"Wed, 26 Jan 2011 00:26:20 +0000","from_user":"phdwine","id_str":"30058925516656640","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Last weekend of Tri Nations Tasting with PHD wines at Haskell Vineyards. Hope you didn't miss the Pinot Noir tasting last week !","id":30058925516656640,"from_user_id":9093754,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"2119923","profile_image_url":"http://a2.twimg.com/profile_images/1096701078/djayprofile_normal.jpg","created_at":"Wed, 26 Jan 2011 00:21:14 +0000","from_user":"djay75","id_str":"30057639543050240","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @dnene: Skilled Calisthenics. Haskell code that outputs python which spits ruby which emits the haskell source. http://j.mp/YlQUL via @mfeathers","id":30057639543050240,"from_user_id":2119923,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"134323731","profile_image_url":"http://a2.twimg.com/profile_images/1225818824/IMG00518-20110125-1547_normal.jpg","created_at":"Wed, 26 Jan 2011 00:19:30 +0000","from_user":"PrinceOfBrkeley","id_str":"30057205554216960","metadata":{"result_type":"recent"},"to_user_id":167093027,"text":"@PayThaPrince go to haskell.","id":30057205554216960,"from_user_id":134323731,"to_user":"PayThaPrince","geo":null,"iso_language_code":"en","to_user_id_str":"167093027","source":"&lt;a href=&quot;http://blackberry.com/twitter&quot; rel=&quot;nofollow&quot;&gt;Twitter for BlackBerry\u00ae&lt;/a&gt;"},{"from_user_id_str":"705857","profile_image_url":"http://a1.twimg.com/profile_images/429483912/ben_twitter_normal.jpg","created_at":"Wed, 26 Jan 2011 00:03:28 +0000","from_user":"bennadel","id_str":"30053166972141569","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Using #Homebrew to install Haskell - the last of the Seven Languages (in Seven Weeks) http://bit.ly/eA9Cv1 This has been some journey.","id":30053166972141569,"from_user_id":705857,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"251466","profile_image_url":"http://a2.twimg.com/profile_images/1194100934/pass_normal.jpg","created_at":"Wed, 26 Jan 2011 00:02:54 +0000","from_user":"simonszu","id_str":"30053025502466048","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Ouh yeah! Ich werde doch produktiv sein, diese Semesterferien. Ich werde funktional Programmieren lernen. #haskell, Baby.","id":30053025502466048,"from_user_id":251466,"geo":null,"iso_language_code":"de","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.echofon.com/&quot; rel=&quot;nofollow&quot;&gt;Echofon&lt;/a&gt;"},{"from_user_id_str":"357786","profile_image_url":"http://a0.twimg.com/profile_images/612044841/FM_2010_normal.jpg","created_at":"Tue, 25 Jan 2011 23:59:13 +0000","from_user":"diligiant","id_str":"30052100973006848","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @paulrbrown: &quot;...we only discovered a single bug after compilation.&quot; (http://t.co/K0wlEYz) #haskell","id":30052100973006848,"from_user_id":357786,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://itunes.apple.com/us/app/twitter/id409789998?mt=12&quot; rel=&quot;nofollow&quot;&gt;Twitter for Mac&lt;/a&gt;"},{"from_user_id_str":"101597523","profile_image_url":"http://a1.twimg.com/profile_images/1206183256/2010-12-12-204902_normal.jpg","created_at":"Tue, 25 Jan 2011 23:54:46 +0000","from_user":"wlad_kent","id_str":"30050977964892160","metadata":{"result_type":"recent"},"to_user_id":86297184,"text":"@Nilson_Neto Isso eh bem basico. quando vc estiver estudando recurs\u00e3o em Haskell, ai vc vai ver oq eh papo de nerd - kkk - 1\u00ba periodo isso.","id":30050977964892160,"from_user_id":101597523,"to_user":"Nilson_Neto","geo":null,"iso_language_code":"pt","to_user_id_str":"86297184","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Tue, 25 Jan 2011 23:51:22 +0000","from_user":"listwarenet","id_str":"30050123383832577","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-cafe/84336-haskell-cafe-monomorphic-let-bindings-and-darcs.html Haskell-cafe - Monomorph","id":30050123383832577,"from_user_id":144546280,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://1e10.org/cloud/&quot; rel=&quot;nofollow&quot;&gt;1e10&lt;/a&gt;"},{"from_user_id_str":"5776901","profile_image_url":"http://a0.twimg.com/profile_images/472682157/lucabw_normal.JPG","created_at":"Tue, 25 Jan 2011 23:48:40 +0000","from_user":"lsbardel","id_str":"30049446469312512","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Very interesting technology stack these guys use http://bit.ly/ghAjS7 #python #redis #haskell","id":30049446469312512,"from_user_id":5776901,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"3005901","profile_image_url":"http://a0.twimg.com/profile_images/278943006/Lone_Pine_Peak_-_Peter_200x200_normal.jpg","created_at":"Tue, 25 Jan 2011 23:45:48 +0000","from_user":"pmonks","id_str":"30048721110573056","metadata":{"result_type":"recent"},"to_user_id":203834278,"text":"@techielicous Haskell: http://bit.ly/gy3oFi ;-)","id":30048721110573056,"from_user_id":3005901,"to_user":"techielicous","geo":null,"iso_language_code":"en","to_user_id_str":"203834278","source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"162697074","profile_image_url":"http://a2.twimg.com/profile_images/826205838/ryan3_normal.jpg","created_at":"Tue, 25 Jan 2011 23:44:47 +0000","from_user":"TheRonaldMCD","id_str":"30048468781244416","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I'm at Aldi Food Market (4122 Gaston Ave, Haskell, Dallas) http://4sq.com/ekqRY7","id":30048468781244416,"from_user_id":162697074,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"&lt;a href=&quot;http://foursquare.com&quot; rel=&quot;nofollow&quot;&gt;foursquare&lt;/a&gt;"},{"from_user_id_str":"203834278","profile_image_url":"http://a0.twimg.com/profile_images/1223375080/me_normal.jpg","created_at":"Tue, 25 Jan 2011 23:44:04 +0000","from_user":"techielicous","id_str":"30048286589067264","metadata":{"result_type":"recent"},"to_user_id":3005901,"text":"@pmonks I was thinking Haskell or Scheme","id":30048286589067264,"from_user_id":203834278,"to_user":"pmonks","geo":null,"iso_language_code":"en","to_user_id_str":"3005901","source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"537690","profile_image_url":"http://a3.twimg.com/profile_images/45665122/nushiostamp_normal.jpg","created_at":"Tue, 25 Jan 2011 23:38:14 +0000","from_user":"nushio","id_str":"30046818658164737","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u305d\u3046\u3044\u3084\u5951\u7d04\u306b\u3088\u308b\u30d7\u30ed\u30b0\u30e9\u30df\u30f3\u30b0\u3068\u304b\u3042\u3063\u305f\u306a\u3002Haskell\u306a\u3093\u304b\u3088\u308a\u3042\u3063\u3061\u306e\u65b9\u304c\u9b54\u6cd5\u5c11\u5973\u547c\u3070\u308f\u308a\u306b\u3075\u3055\u308f\u3057\u3044\u3002","id":30046818658164737,"from_user_id":537690,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"181192","profile_image_url":"http://a2.twimg.com/profile_images/1089890701/q530888600_9828_normal.jpg","created_at":"Tue, 25 Jan 2011 23:38:03 +0000","from_user":"aodag","id_str":"30046772223016960","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @omasanori: \u300c\u3082\u3046\u4f55\u5e74\u3082Haskell\u306e\u3053\u3068\u3057\u304b\u8003\u3048\u3066\u306a\u304b\u3063\u305f\u304b\u3089\u306a\u3001\u30eb\u30fc\u30d7\u306e\u4f7f\u3044\u65b9\u5fd8\u308c\u3066\u305f\u300d","id":30046772223016960,"from_user_id":181192,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.movatwi.jp&quot; rel=&quot;nofollow&quot;&gt;www.movatwi.jp&lt;/a&gt;"},{"from_user_id_str":"5886055","profile_image_url":"http://a3.twimg.com/profile_images/85531669/ichi_normal.jpg","created_at":"Tue, 25 Jan 2011 23:37:53 +0000","from_user":"kanaya","id_str":"30046729243983873","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u9e97\u3057\u3044\u3002\u201c@omasanori: \u300c\u3082\u3046\u4f55\u5e74\u3082Haskell\u306e\u3053\u3068\u3057\u304b\u8003\u3048\u3066\u306a\u304b\u3063\u305f\u304b\u3089\u306a\u3001\u30eb\u30fc\u30d7\u306e\u4f7f\u3044\u65b9\u5fd8\u308c\u3066\u305f\u300d\u201d","id":30046729243983873,"from_user_id":5886055,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://itunes.apple.com/app/twitter/id333903271?mt=8&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPad&lt;/a&gt;"},{"from_user_id_str":"52620546","profile_image_url":"http://a1.twimg.com/profile_images/434693356/twitter-icon_normal.png","created_at":"Tue, 25 Jan 2011 23:36:26 +0000","from_user":"omasanori","id_str":"30046367187476481","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u300c\u3082\u3046\u4f55\u5e74\u3082Haskell\u306e\u3053\u3068\u3057\u304b\u8003\u3048\u3066\u306a\u304b\u3063\u305f\u304b\u3089\u306a\u3001\u30eb\u30fc\u30d7\u306e\u4f7f\u3044\u65b9\u5fd8\u308c\u3066\u305f\u300d","id":30046367187476481,"from_user_id":52620546,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.movatwi.jp&quot; rel=&quot;nofollow&quot;&gt;www.movatwi.jp&lt;/a&gt;"},{"from_user_id_str":"1659992","profile_image_url":"http://a1.twimg.com/profile_images/504488750/1_normal.jpg","created_at":"Tue, 25 Jan 2011 23:16:13 +0000","from_user":"finalfusion","id_str":"30041278544609280","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @necocen: Haskell\u306e\u30df\u30b5\u30ef\u3001\u3068\u3044\u3046\u3082\u306e\u3092\u8003\u3048\u3066\u307f\u3066\u3071\u3063\u3068\u3057\u306a\u3044","id":30041278544609280,"from_user_id":1659992,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"272513","profile_image_url":"http://a2.twimg.com/profile_images/320244078/Mike_Painting2_normal.png","created_at":"Tue, 25 Jan 2011 23:05:09 +0000","from_user":"mikehadlow","id_str":"30038492373319680","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Just written the same simple program in C#, F# and Haskell: 18, 12 and 9 LoC respectively. And I'm much better at C# than F# or Haskell.","id":30038492373319680,"from_user_id":272513,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"89393264","profile_image_url":"http://a0.twimg.com/profile_images/1169486472/020_portland_me_normal.jpg","created_at":"Tue, 25 Jan 2011 23:01:28 +0000","from_user":"newsportlandme","id_str":"30037564589084673","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Governor's Choice to Run Maine DOC Under Scrutiny - MPBN: State Rep. Anne Haskell, a Portland Democrat, says Mai... http://bit.ly/fO30gC","id":30037564589084673,"from_user_id":89393264,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"38138","profile_image_url":"http://a3.twimg.com/profile_images/1212565885/Screen_shot_2011-01-11_at_5.28.47_PM_normal.png","created_at":"Tue, 25 Jan 2011 22:59:55 +0000","from_user":"michaelneale","id_str":"30037174615281664","metadata":{"result_type":"recent"},"to_user_id":null,"text":"The haskell EvilMangler http://t.co/P2Tls7J","id":30037174615281664,"from_user_id":38138,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"&lt;a href=&quot;http://itunes.apple.com/us/app/twitter/id409789998?mt=12&quot; rel=&quot;nofollow&quot;&gt;Twitter for Mac&lt;/a&gt;"},{"from_user_id_str":"45692","profile_image_url":"http://a3.twimg.com/profile_images/1177741507/dogkarno_r_normal.jpg","created_at":"Tue, 25 Jan 2011 22:45:06 +0000","from_user":"karno","id_str":"30033448286552064","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell\u3063\u3066\u95a2\u6570\u306b\u30ab\u30ec\u30fc\u7c89\u3076\u3061\u8fbc\u3080\u3068\u304b\u306a\u3093\u3068\u304b","id":30033448286552064,"from_user_id":45692,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://yubitter.com/&quot; rel=&quot;nofollow&quot;&gt;yubitter&lt;/a&gt;"},{"from_user_id_str":"27605","profile_image_url":"http://a2.twimg.com/profile_images/15826632/meron_normal.jpg","created_at":"Tue, 25 Jan 2011 22:44:23 +0000","from_user":"celeron1ghz","id_str":"30033268761956352","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @necocen: Haskell\u306e\u30df\u30b5\u30ef\u3001\u3068\u3044\u3046\u3082\u306e\u3092\u8003\u3048\u3066\u307f\u3066\u3071\u3063\u3068\u3057\u306a\u3044","id":30033268761956352,"from_user_id":27605,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"12901","profile_image_url":"http://a1.twimg.com/profile_images/56091349/haruhi_nagato-Y_normal.jpg","created_at":"Tue, 25 Jan 2011 22:43:30 +0000","from_user":"necocen","id_str":"30033044035346432","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u307e\u3042Haskell\u77e5\u3089\u3093\u3057\u306d","id":30033044035346432,"from_user_id":12901,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"12901","profile_image_url":"http://a1.twimg.com/profile_images/56091349/haruhi_nagato-Y_normal.jpg","created_at":"Tue, 25 Jan 2011 22:42:54 +0000","from_user":"necocen","id_str":"30032894856531968","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell\u306e\u30df\u30b5\u30ef\u3001\u3068\u3044\u3046\u3082\u306e\u3092\u8003\u3048\u3066\u307f\u3066\u3071\u3063\u3068\u3057\u306a\u3044","id":30032894856531968,"from_user_id":12901,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"10821270","profile_image_url":"http://a0.twimg.com/profile_images/1195474259/Salto_Marlon_normal.jpg","created_at":"Tue, 25 Jan 2011 22:35:09 +0000","from_user":"jjedMoriAnktah","id_str":"30030942106025984","metadata":{"result_type":"recent"},"to_user_id":null,"text":"&quot;A Haskell program that outputs a Python program that outputs a Ruby program that outputs the original Haskell program&quot; http://is.gd/E6Julu","id":30030942106025984,"from_user_id":10821270,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"7554762","profile_image_url":"http://a0.twimg.com/profile_images/100515212/ajay-photo_normal.jpg","created_at":"Tue, 25 Jan 2011 22:34:30 +0000","from_user":"comatose_kid","id_str":"30030780205899776","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @bumptech: Bump Dev Blog - Why we use Haskell at Bump http://devblog.bu.mp/haskell-at-bump","id":30030780205899776,"from_user_id":7554762,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"148474705","profile_image_url":"http://a0.twimg.com/profile_images/1119234716/fur_hat_-_gilbeys_vodka_-_life_-_11-30-1962_normal.JPG","created_at":"Tue, 25 Jan 2011 22:29:19 +0000","from_user":"landmvintage","id_str":"30029476003840000","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @faerymoongodess: Magnificent Miriam Haskell Baroque Pearl Necklace by @MercyMadge http://etsy.me/hqRl51","id":30029476003840000,"from_user_id":148474705,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"37715508","profile_image_url":"http://a1.twimg.com/profile_images/1207891411/ballerina_normal.jpg","created_at":"Tue, 25 Jan 2011 22:24:52 +0000","from_user":"faerymoongodess","id_str":"30028356326002688","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Magnificent Miriam Haskell Baroque Pearl Necklace by @MercyMadge http://etsy.me/hqRl51","id":30028356326002688,"from_user_id":37715508,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"17671137","profile_image_url":"http://a2.twimg.com/profile_images/290264834/Haskell-logo-outer-glow_normal.png","created_at":"Tue, 25 Jan 2011 22:17:16 +0000","from_user":"Hackage","id_str":"30026442456694784","metadata":{"result_type":"recent"},"to_user_id":null,"text":"base16-bytestring 0.1.0.0, added by BryanOSullivan: Fast base16 (hex) encoding and deconding for ByteStrings http://bit.ly/eu75TN","id":30026442456694784,"from_user_id":17671137,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"199750997","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Tue, 25 Jan 2011 22:12:07 +0000","from_user":"benreads","id_str":"30025146991382528","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Writing Systems Software in a Functional Language -- brief, but fun. I want to see how well they can make Systems Haskell perform at scale.","id":30025146991382528,"from_user_id":199750997,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"35359797","profile_image_url":"http://a1.twimg.com/profile_images/1173453785/48893_521140819_1896062_q_normal.jpg","created_at":"Tue, 25 Jan 2011 22:09:45 +0000","from_user":"jcawthorne1","id_str":"30024549265309696","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Just saw Jeff Haskell give the middle finger!! Lol awesome","id":30024549265309696,"from_user_id":35359797,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"13540930","profile_image_url":"http://a1.twimg.com/profile_images/1205312219/23467_350321383101_821143101_5114147_3010041_n_normal.jpg","created_at":"Tue, 25 Jan 2011 22:06:44 +0000","from_user":"goodfox","id_str":"30023790381498369","metadata":{"result_type":"recent"},"to_user_id":null,"text":"At the Haskell Convocation. (@ Haskell Indian Nations U Auditorium) http://4sq.com/eKKXyn","id":30023790381498369,"from_user_id":13540930,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://foursquare.com&quot; rel=&quot;nofollow&quot;&gt;foursquare&lt;/a&gt;"},{"from_user_id_str":"14674418","profile_image_url":"http://a2.twimg.com/profile_images/238230125/IMG_1030-1_normal.jpg","created_at":"Tue, 25 Jan 2011 22:02:31 +0000","from_user":"sanityinc","id_str":"30022731919523840","metadata":{"result_type":"recent"},"to_user_id":371289,"text":"@xshay Haskell's great, but Clojure's similarly lazy in all the ways that matter, and is more practical for day-to-day use.","id":30022731919523840,"from_user_id":14674418,"to_user":"xshay","geo":null,"iso_language_code":"en","to_user_id_str":"371289","source":"&lt;a href=&quot;http://www.echofon.com/&quot; rel=&quot;nofollow&quot;&gt;Echofon&lt;/a&gt;"},{"from_user_id_str":"371289","profile_image_url":"http://a2.twimg.com/profile_images/1113482439/me-brisbane_normal.jpg","created_at":"Tue, 25 Jan 2011 21:58:29 +0000","from_user":"xshay","id_str":"30021714444292096","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Just made a lazy sequence of prime numbers in haskell. I'm smitten.","id":30021714444292096,"from_user_id":371289,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://itunes.apple.com/us/app/twitter/id409789998?mt=12&quot; rel=&quot;nofollow&quot;&gt;Twitter for Mac&lt;/a&gt;"},{"from_user_id_str":"199453873","profile_image_url":"http://a3.twimg.com/a/1294785484/images/default_profile_3_normal.png","created_at":"Tue, 25 Jan 2011 21:48:40 +0000","from_user":"stackfeed","id_str":"30019243982454784","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Practical Scala reference manual, for searching things like method names: Hello, \n\nInspired by\nHaskell API Searc... http://bit.ly/g4zWZQ","id":30019243982454784,"from_user_id":199453873,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"17489366","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Tue, 25 Jan 2011 21:45:32 +0000","from_user":"aapnoot","id_str":"30018455189065728","metadata":{"result_type":"recent"},"to_user_id":null,"text":"download 0.3.1, added by MagnusTherning: High-level file download based on URLs http://bit.ly/i8mYvi","id":30018455189065728,"from_user_id":17489366,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"17489366","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Tue, 25 Jan 2011 21:45:31 +0000","from_user":"aapnoot","id_str":"30018452601180160","metadata":{"result_type":"recent"},"to_user_id":null,"text":"download 0.3.1.1, added by MagnusTherning: High-level file download based on URLs http://bit.ly/eHfiJB","id":30018452601180160,"from_user_id":17489366,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"17671137","profile_image_url":"http://a2.twimg.com/profile_images/290264834/Haskell-logo-outer-glow_normal.png","created_at":"Tue, 25 Jan 2011 21:45:31 +0000","from_user":"Hackage","id_str":"30018451867176960","metadata":{"result_type":"recent"},"to_user_id":null,"text":"download 0.3.1, added by MagnusTherning: High-level file download based on URLs http://bit.ly/i8mYvi","id":30018451867176960,"from_user_id":17671137,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"138502705","profile_image_url":"http://a1.twimg.com/profile_images/1083845614/yclogo_normal.gif","created_at":"Tue, 25 Jan 2011 21:45:04 +0000","from_user":"newsyc100","id_str":"30018340839755777","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell improves log processing 4x over Python http://devblog.bu.mp/haskell-at-bump (http://bit.ly/gQxxR8)","id":30018340839755777,"from_user_id":138502705,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://news.ycombinator.com&quot; rel=&quot;nofollow&quot;&gt;newsyc&lt;/a&gt;"},{"from_user_id_str":"1578246","profile_image_url":"http://a0.twimg.com/profile_images/59312315/avatar_simpson_small_normal.jpg","created_at":"Tue, 25 Jan 2011 21:43:32 +0000","from_user":"magthe","id_str":"30017953801969665","metadata":{"result_type":"recent"},"to_user_id":null,"text":"New version of download uploaded to #hackage #haskell","id":30017953801969665,"from_user_id":1578246,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://api.supertweet.net&quot; rel=&quot;nofollow&quot;&gt;MyAuth API Proxy&lt;/a&gt;"},{"from_user_id_str":"135838970","profile_image_url":"http://a2.twimg.com/profile_images/1079929891/logo_normal.png","created_at":"Tue, 25 Jan 2011 21:37:51 +0000","from_user":"reward999","id_str":"30016525180084224","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Found Great Dane (Main &amp; Haskell- Dallas): We found a great dane. 214-712-0000 http://bit.ly/fQ8iBw","id":30016525180084224,"from_user_id":135838970,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"137719265","profile_image_url":"http://a2.twimg.com/profile_images/1092224079/8__4__normal.jpg","created_at":"Tue, 25 Jan 2011 21:34:22 +0000","from_user":"WeiMatas","id_str":"30015646020411392","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Fourth day Rez party Eddie Haskell County in second life \u2013 which took place in cabaret Tadd","id":30015646020411392,"from_user_id":137719265,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://dlvr.it&quot; rel=&quot;nofollow&quot;&gt;dlvr.it&lt;/a&gt;"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Tue, 25 Jan 2011 21:33:21 +0000","from_user":"listwarenet","id_str":"30015392571195392","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-cafe/83889-haskell-cafe-gpl-license-of-h-matrix-and-prelude-numeric.html Haskell-cafe -","id":30015392571195392,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"&lt;a href=&quot;http://1e10.org/cloud/&quot; rel=&quot;nofollow&quot;&gt;1e10&lt;/a&gt;"}],"max_id":30121530767708160,"since_id":0,"refresh_url":"?since_id=30121530767708160&q=haskell","next_page":"?page=2&max_id=30121530767708160&rpp=100&q=haskell","results_per_page":100,"page":1,"completed_in":1.195569,"since_id_str":"0","max_id_str":"30121530767708160","query":"haskell"}
benchmarks/json-data/twitter20.jsondeleted−1
@@ -1 +0,0 @@
1−{"results":[{"from_user_id_str":"166199691","profile_image_url":"http://a2.twimg.com/profile_images/1252958188/38_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:26 +0000","from_user":"_classicc","id_str":"41191052790603776","metadata":{"result_type":"recent"},"to_user_id":null,"text":"my twitter is actin slow today.","id":41191052790603776,"from_user_id":166199691,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"138835410","profile_image_url":"http://a1.twimg.com/profile_images/1250985094/243321801_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:26 +0000","from_user":"amereronday","id_str":"41191050307567616","metadata":{"result_type":"recent"},"to_user_id":null,"text":"twitter jail, here i come.","id":41191050307567616,"from_user_id":138835410,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"359548","profile_image_url":"http://a2.twimg.com/profile_images/53612334/don_otvos_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:26 +0000","from_user":"donnyo","id_str":"41191050110451712","metadata":{"result_type":"recent"},"to_user_id":7074534,"text":"@stlsmallbiz I see there is currently a Twitter promo too....tempting....","id":41191050110451712,"from_user_id":359548,"to_user":"stlsmallbiz","geo":null,"iso_language_code":"en","place":{"id":"82b7b2f97b12261d","type":"poi","full_name":"Yammer Inc, San Francisco"},"to_user_id_str":"7074534","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"122523770","profile_image_url":"http://a0.twimg.com/profile_images/1073533262/11646_1076222405045_1810798478_156114_3663737_n_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:26 +0000","from_user":"msBreChan","id_str":"41191049720238080","metadata":{"result_type":"recent"},"to_user_id":null,"text":"so twitter gt spam now -_-","id":41191049720238080,"from_user_id":122523770,"geo":{"type":"Point","coordinates":[35.2213,-80.8276]},"iso_language_code":"en","place":{"id":"4d5ed95f830e9b41","type":"neighborhood","full_name":"Elizabeth, Charlotte"},"to_user_id_str":null,"source":"&lt;a href=&quot;http://mobile.twitter.com&quot; rel=&quot;nofollow&quot;&gt;Twitter for Android&lt;/a&gt;"},{"from_user_id_str":"229024950","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_6_normal.png","created_at":"Fri, 25 Feb 2011 17:41:25 +0000","from_user":"NinaMaechik","id_str":"41191047853912064","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Glad I can remember my twitter password! LOL! Hugs to Nick from his aunties...","id":41191047853912064,"from_user_id":229024950,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"215545822","profile_image_url":"http://a2.twimg.com/profile_images/1239909540/RTL_normal.png","created_at":"Fri, 25 Feb 2011 17:41:25 +0000","from_user":"RightToLaugh","id_str":"41191047371558912","metadata":{"result_type":"recent"},"to_user_id":null,"text":"#Bacon wrapped dates http://bit.ly/hUxVC9 Just like my grandma used to make http://twitter.com/#","id":41191047371558912,"from_user_id":215545822,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"217845526","profile_image_url":"http://a0.twimg.com/sticky/default_profile_images/default_profile_3_normal.png","created_at":"Fri, 25 Feb 2011 17:41:25 +0000","from_user":"TheShoeLooker","id_str":"41191047052804096","metadata":{"result_type":"recent"},"to_user_id":38033240,"text":"@ShoeDazzle love love love to twitter or blog about your deals and shoes!\ntheshoelooker.blogspot.com","id":41191047052804096,"from_user_id":217845526,"to_user":"shoedazzle","geo":null,"iso_language_code":"en","to_user_id_str":"38033240","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"24953438","profile_image_url":"http://a3.twimg.com/profile_images/1181252763/76820_10150100014748783_677998782_7386695_4377006_n_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:25 +0000","from_user":"liljermaine32","id_str":"41191046025056256","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Twitter fam I gotta question 4 ya is texas south or midwest #arguments","id":41191046025056256,"from_user_id":24953438,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://mobile.twitter.com&quot; rel=&quot;nofollow&quot;&gt;Twitter for Android&lt;/a&gt;"},{"from_user_id_str":"122451024","profile_image_url":"http://a2.twimg.com/profile_images/1143400129/100706-ETCanada_201134_1__normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:25 +0000","from_user":"Kim_DEon","id_str":"41191045161164801","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Help @CARE @EvaLongoria and ME use Twitter to change the lives of girls in poverty across the world! Ready? Go to http://TwitChange.com NOW!","id":41191045161164801,"from_user_id":122451024,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"128351479","profile_image_url":"http://a3.twimg.com/profile_images/1150198829/Kirby_Photo__edit__normal.JPG","created_at":"Fri, 25 Feb 2011 17:41:24 +0000","from_user":"TheDaveKirby","id_str":"41191043894493184","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Maybe its time to clean house...MY HOUSE http://bit.ly/ejG22P","id":41191043894493184,"from_user_id":128351479,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"87512773","profile_image_url":"http://a0.twimg.com/profile_images/1252511106/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:24 +0000","from_user":"supportthehood","id_str":"41191043206610946","metadata":{"result_type":"recent"},"to_user_id":2467330,"text":"@eastcoastmp3 #FF it's the way twitter works !!!","id":41191043206610946,"from_user_id":87512773,"to_user":"eastcoastmp3","geo":null,"iso_language_code":"en","to_user_id_str":"2467330","source":"&lt;a href=&quot;http://twitter.com/&quot; rel=&quot;nofollow&quot;&gt;Twitter for iPhone&lt;/a&gt;"},{"from_user_id_str":"149894545","profile_image_url":"http://a0.twimg.com/profile_images/1219334400/patrick_camo_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:24 +0000","from_user":"suburbpat","id_str":"41191040912330752","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I havent had a rib session on twitter in a while.......I wanna Rib with a nigga with alot followers lol","id":41191040912330752,"from_user_id":149894545,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"97749622","profile_image_url":"http://a0.twimg.com/profile_images/1254640781/IMG1633A_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:24 +0000","from_user":"jrricardosantos","id_str":"41191040547430400","metadata":{"result_type":"recent"},"to_user_id":101017476,"text":"@yofzs pq tirou o CAPS LOCK? kkkk tava bem legal...hehehe eu estou no t\u00e9dio...kkk tbm estou no twitter e msn..aff!!","id":41191040547430400,"from_user_id":97749622,"to_user":"yofzs","geo":null,"iso_language_code":"en","to_user_id_str":"101017476","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"94381536","profile_image_url":"http://a1.twimg.com/profile_images/1174777929/41509_100001699300415_3521888_n_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:23 +0000","from_user":"DonNieves","id_str":"41191038978752512","metadata":{"result_type":"recent"},"to_user_id":151926400,"text":"@TiiH13 cheira meu ovo, no email, no orkut, no msn, no facebook, no twitter, no skype, no spark, no ICQ e no google talk","id":41191038978752512,"from_user_id":94381536,"to_user":"TiiH13","geo":null,"iso_language_code":"en","to_user_id_str":"151926400","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"211858432","profile_image_url":"http://a3.twimg.com/profile_images/1231906180/JonasBrothers_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:23 +0000","from_user":"OriginalJBfans","id_str":"41191038328651776","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I literally forgot about this twitter... so whats occuring followers?","id":41191038328651776,"from_user_id":211858432,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"90317132","profile_image_url":"http://a3.twimg.com/profile_images/1230085056/254101635_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:23 +0000","from_user":"Just2smooth","id_str":"41191036936126464","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Wassup twitter","id":41191036936126464,"from_user_id":90317132,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://ubersocial.com&quot; rel=&quot;nofollow&quot;&gt;\u00dcberSocial&lt;/a&gt;"},{"from_user_id_str":"144771504","profile_image_url":"http://a1.twimg.com/profile_images/1243343836/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:23 +0000","from_user":"ima_b_b_badman","id_str":"41191036638339072","metadata":{"result_type":"recent"},"to_user_id":null,"text":"i been M.I.A. all day twitter my bad","id":41191036638339072,"from_user_id":144771504,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"207922664","profile_image_url":"http://a2.twimg.com/profile_images/1237106108/258356167_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:22 +0000","from_user":"itsthecarter_","id_str":"41191036013391873","metadata":{"result_type":"recent"},"to_user_id":null,"text":"twitter is a stupid addiction.","id":41191036013391873,"from_user_id":207922664,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://ubersocial.com&quot; rel=&quot;nofollow&quot;&gt;\u00dcberSocial&lt;/a&gt;"},{"from_user_id_str":"150000649","profile_image_url":"http://a0.twimg.com/profile_images/1237789059/belllaa_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:22 +0000","from_user":"angelicabrvo","id_str":"41191035707207680","metadata":{"result_type":"recent"},"to_user_id":null,"text":"que hubo twitter? huy que feoxd","id":41191035707207680,"from_user_id":150000649,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://blackberry.com/twitter&quot; rel=&quot;nofollow&quot;&gt;Twitter for BlackBerry\u00ae&lt;/a&gt;"},{"from_user_id_str":"185713003","profile_image_url":"http://a2.twimg.com/profile_images/1191421540/163229_177015295661467_154687431227587_492170_2147500_n_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:22 +0000","from_user":"downbytheshores","id_str":"41191033945595905","metadata":{"result_type":"recent"},"to_user_id":null,"text":"follow us on twitter\nwww.twitter.com/downbytheshores http://fb.me/DhDS915e","id":41191033945595905,"from_user_id":185713003,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.facebook.com/twitter&quot; rel=&quot;nofollow&quot;&gt;Facebook&lt;/a&gt;"}],"max_id":41191052790603776,"since_id":38643906774044672,"refresh_url":"?since_id=41191052790603776&q=twitter","next_page":"?page=2&max_id=41191052790603776&rpp=20&lang=en&q=twitter","results_per_page":20,"page":1,"completed_in":0.128719,"warning":"adjusted since_id to 38643906774044672 (), requested since_id was older than allowed -- since_id removed for pagination.","since_id_str":"38643906774044672","max_id_str":"41191052790603776","query":"twitter"}
benchmarks/json-data/twitter50.jsondeleted−1
@@ -1 +0,0 @@
1−{"results":[{"from_user_id_str":"207858021","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Wed, 26 Jan 2011 04:30:38 +0000","from_user":"pboudarga","id_str":"30120402839666689","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I'm at Rolla Sushi Grill (27737 Bouquet Canyon Road, #106, Btw Haskell Canyon and Rosedell Drive, Saugus) http://4sq.com/gqqdhs","id":30120402839666689,"from_user_id":207858021,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://foursquare.com&quot; rel=&quot;nofollow&quot;&gt;foursquare&lt;/a&gt;"},{"from_user_id_str":"69988683","profile_image_url":"http://a0.twimg.com/profile_images/1211955817/avatar_7888_normal.gif","created_at":"Wed, 26 Jan 2011 04:25:23 +0000","from_user":"YNK33","id_str":"30119083059978240","metadata":{"result_type":"recent"},"to_user_id":null,"text":"hsndfile 0.5.0: Free and open source Haskell bindings for libsndfile http://bit.ly/gHaBWG Mac Os","id":30119083059978240,"from_user_id":69988683,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"81492","profile_image_url":"http://a1.twimg.com/profile_images/423894208/Picture_7_normal.jpg","created_at":"Wed, 26 Jan 2011 04:24:28 +0000","from_user":"satzz","id_str":"30118851488251904","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Emacs\u306e\u30e2\u30fc\u30c9\u8868\u793a\u304c\u4eca(Ruby Controller Outputz RoR Flymake REl hs)\u3068\u306a\u3063\u3066\u3066\u3088\u304f\u308f\u304b\u3089\u306a\u3044\u3093\u3060\u3051\u3069\u6700\u5f8c\u306eREl\u3068\u304bhs\u3063\u3066\u4f55\u3060\u308d\u3046\u2026haskell\u3068\u304b2\u5e74\u4ee5\u4e0a\u66f8\u3044\u3066\u306a\u3044\u3051\u3069\u2026","id":30118851488251904,"from_user_id":81492,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.hootsuite.com&quot; rel=&quot;nofollow&quot;&gt;HootSuite&lt;/a&gt;"},{"from_user_id_str":"9518356","profile_image_url":"http://a2.twimg.com/profile_images/119165723/ocaml-icon_normal.png","created_at":"Wed, 26 Jan 2011 04:19:19 +0000","from_user":"planet_ocaml","id_str":"30117557788741632","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I so miss #haskell type classes in #ocaml - i want to do something like refinement. Also why does ocaml not have... http://bit.ly/geYRwt","id":30117557788741632,"from_user_id":9518356,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"218059","profile_image_url":"http://a1.twimg.com/profile_images/1053837723/twitter-icon9_normal.jpg","created_at":"Wed, 26 Jan 2011 04:16:32 +0000","from_user":"aprikip","id_str":"30116854940835840","metadata":{"result_type":"recent"},"to_user_id":null,"text":"yatex-mode\u3084haskell-mode\u306e\u3053\u3068\u3067\u3059\u306d\u3001\u308f\u304b\u308a\u307e\u3059\u3002","id":30116854940835840,"from_user_id":218059,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://sites.google.com/site/yorufukurou/&quot; rel=&quot;nofollow&quot;&gt;YoruFukurou&lt;/a&gt;"},{"from_user_id_str":"216363","profile_image_url":"http://a1.twimg.com/profile_images/72454310/Tim-Avatar_normal.png","created_at":"Wed, 26 Jan 2011 04:15:30 +0000","from_user":"dysinger","id_str":"30116594684264448","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell in Hawaii tonight for me... #fun","id":30116594684264448,"from_user_id":216363,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.nambu.com/&quot; rel=&quot;nofollow&quot;&gt;Nambu&lt;/a&gt;"},{"from_user_id_str":"1774820","profile_image_url":"http://a2.twimg.com/profile_images/61169291/dan_desert_thumb_normal.jpg","created_at":"Wed, 26 Jan 2011 04:13:36 +0000","from_user":"DanMil","id_str":"30116117682851840","metadata":{"result_type":"recent"},"to_user_id":1594784,"text":"@ojrac @chewedwire @tomheon Haskell isn't a language, it's a belief system. A seductive one...","id":30116117682851840,"from_user_id":1774820,"to_user":"ojrac","geo":null,"iso_language_code":"en","to_user_id_str":"1594784","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"659256","profile_image_url":"http://a0.twimg.com/profile_images/746976711/angular-final_normal.jpg","created_at":"Wed, 26 Jan 2011 04:11:06 +0000","from_user":"djspiewak","id_str":"30115488931520512","metadata":{"result_type":"recent"},"to_user_id":null,"text":"One of the very nice things about Haskell as opposed to SML is the reduced proliferation of identifiers (e.g. andb, orb, etc). #typeclasses","id":30115488931520512,"from_user_id":659256,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://itunes.apple.com/us/app/twitter/id409789998?mt=12&quot; rel=&quot;nofollow&quot;&gt;Twitter for Mac&lt;/a&gt;"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Wed, 26 Jan 2011 04:06:12 +0000","from_user":"listwarenet","id_str":"30114255890026496","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-cafe/84752-re-haskell-cafe-gpl-license-of-h-matrix-and-prelude-numeric.html Re: Haskell-c","id":30114255890026496,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"&lt;a href=&quot;http://1e10.org/cloud/&quot; rel=&quot;nofollow&quot;&gt;1e10&lt;/a&gt;"},{"from_user_id_str":"1594784","profile_image_url":"http://a2.twimg.com/profile_images/378515773/square-profile_normal.jpg","created_at":"Wed, 26 Jan 2011 04:01:29 +0000","from_user":"ojrac","id_str":"30113067333324800","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @tomheon: @ojrac @chewedwire Don't worry, learning Haskell will not give you any clear idea what monad means.","id":30113067333324800,"from_user_id":1594784,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"207589736","profile_image_url":"http://a3.twimg.com/profile_images/1225527428/headshot_1_normal.jpg","created_at":"Wed, 26 Jan 2011 04:00:13 +0000","from_user":"ashleevelazq101","id_str":"30112747555397632","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Federal investigation finds safety violations at The Acadia Hospital: By Meg Haskell, BDN Staff The investigatio... http://bit.ly/dONnpn","id":30112747555397632,"from_user_id":207589736,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"17671137","profile_image_url":"http://a2.twimg.com/profile_images/290264834/Haskell-logo-outer-glow_normal.png","created_at":"Wed, 26 Jan 2011 03:58:00 +0000","from_user":"Hackage","id_str":"30112192346984448","metadata":{"result_type":"recent"},"to_user_id":null,"text":"streams 0.4, added by EdwardKmett: Various Haskell 2010 stream comonads http://bit.ly/idBkPe","id":30112192346984448,"from_user_id":17671137,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"17489366","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Wed, 26 Jan 2011 03:58:00 +0000","from_user":"aapnoot","id_str":"30112191881420800","metadata":{"result_type":"recent"},"to_user_id":null,"text":"streams 0.4, added by EdwardKmett: Various Haskell 2010 stream comonads http://bit.ly/idBkPe","id":30112191881420800,"from_user_id":17489366,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"8530482","profile_image_url":"http://a2.twimg.com/profile_images/137867266/n608671563_7396_normal.jpg","created_at":"Wed, 26 Jan 2011 03:50:12 +0000","from_user":"jeffmclamb","id_str":"30110229207187456","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Angel - daemon to run and monitor processes like daemontools or god, written in Haskell http://ff.im/-wNyLk","id":30110229207187456,"from_user_id":8530482,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://friendfeed.com&quot; rel=&quot;nofollow&quot;&gt;FriendFeed&lt;/a&gt;"},{"from_user_id_str":"177539201","profile_image_url":"http://a0.twimg.com/profile_images/1178368800/img_normal.jpeg","created_at":"Wed, 26 Jan 2011 03:46:01 +0000","from_user":"tomheon","id_str":"30109174645919744","metadata":{"result_type":"recent"},"to_user_id":1594784,"text":"@ojrac @chewedwire Don't worry, learning Haskell will not give you any clear idea what monad means.","id":30109174645919744,"from_user_id":177539201,"to_user":"ojrac","geo":null,"iso_language_code":"en","to_user_id_str":"1594784","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"1594784","profile_image_url":"http://a2.twimg.com/profile_images/378515773/square-profile_normal.jpg","created_at":"Wed, 26 Jan 2011 03:44:34 +0000","from_user":"ojrac","id_str":"30108808684503040","metadata":{"result_type":"recent"},"to_user_id":128028225,"text":"@chewedwire @tomheon Why are you making me curious about Haskell? I LIKE not knowing what monad means!!","id":30108808684503040,"from_user_id":1594784,"to_user":"chewedwire","geo":null,"iso_language_code":"en","to_user_id_str":"128028225","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"23750094","profile_image_url":"http://a0.twimg.com/profile_images/951373780/Moeinthecar_normal.jpg","created_at":"Wed, 26 Jan 2011 03:41:54 +0000","from_user":"shokalshab","id_str":"30108140443795456","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I'm at Magnitude Cheer @ Gymnastics Olympica USA (7735 Haskell Ave., btw Saticoy &amp; Strathern, Van Nuys) http://4sq.com/gmXfaL","id":30108140443795456,"from_user_id":23750094,"geo":null,"iso_language_code":"en","place":{"id":"4e4a2a2f86cb2946","type":"poi","full_name":"Gymnastics Olympica USA, Van Nuys"},"to_user_id_str":null,"source":"&lt;a href=&quot;http://foursquare.com&quot; rel=&quot;nofollow&quot;&gt;foursquare&lt;/a&gt;"},{"from_user_id_str":"8135112","profile_image_url":"http://a0.twimg.com/profile_images/1165240350/LIMITED_normal.jpg","created_at":"Wed, 26 Jan 2011 03:41:35 +0000","from_user":"Claricei","id_str":"30108059208515584","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @kristenmchugh22: @KeithOlbermann Ryan looks like Jughead w/o the hat. And sounds as mealy-mouthed as Eddie Haskell.","id":30108059208515584,"from_user_id":8135112,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"128028225","profile_image_url":"http://a1.twimg.com/profile_images/1224994593/Coding_Drunk_normal.jpg","created_at":"Wed, 26 Jan 2011 03:40:02 +0000","from_user":"chewedwire","id_str":"30107670367182848","metadata":{"result_type":"recent"},"to_user_id":177539201,"text":"@tomheon Cool, I'll take a look. I feel like I should mention this: http://bit.ly/hVstDM","id":30107670367182848,"from_user_id":128028225,"to_user":"tomheon","geo":null,"iso_language_code":"en","to_user_id_str":"177539201","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"8679778","profile_image_url":"http://a3.twimg.com/profile_images/1195318056/me_nyc_12_18_10_icon_normal.jpg","created_at":"Wed, 26 Jan 2011 03:38:42 +0000","from_user":"kristenmchugh22","id_str":"30107332381777920","metadata":{"result_type":"recent"},"to_user_id":756269,"text":"@KeithOlbermann Ryan looks like Jughead w/o the hat. And sounds as mealy-mouthed as Eddie Haskell.","id":30107332381777920,"from_user_id":8679778,"to_user":"KeithOlbermann","geo":null,"iso_language_code":"en","to_user_id_str":"756269","source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"103316559","profile_image_url":"http://a1.twimg.com/profile_images/1179458751/bc3beab4-d59d-4e78-b13b-50747986cfa2_normal.png","created_at":"Wed, 26 Jan 2011 03:36:15 +0000","from_user":"cityslikr","id_str":"30106719153557504","metadata":{"result_type":"recent"},"to_user_id":null,"text":"&quot;Social safety net into a hammock.&quot; So says Eddie Haskell with the GOP response. #SOTU","id":30106719153557504,"from_user_id":103316559,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://blackberry.com/twitter&quot; rel=&quot;nofollow&quot;&gt;Twitter for BlackBerry\u00ae&lt;/a&gt;"},{"from_user_id_str":"169063143","profile_image_url":"http://a0.twimg.com/profile_images/1160506212/9697_1_normal.gif","created_at":"Wed, 26 Jan 2011 03:31:52 +0000","from_user":"wrkforce_safety","id_str":"30105614919143424","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Federal investigation finds safety violations at The Acadia Hospital: By Meg Haskell, BDN Staff The investigatio... http://bit.ly/gA60C1","id":30105614919143424,"from_user_id":169063143,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"177539201","profile_image_url":"http://a0.twimg.com/profile_images/1178368800/img_normal.jpeg","created_at":"Wed, 26 Jan 2011 03:29:40 +0000","from_user":"tomheon","id_str":"30105060960632832","metadata":{"result_type":"recent"},"to_user_id":128028225,"text":"@chewedwire Great book on Haskell: http://oreilly.com/catalog/9780596514983","id":30105060960632832,"from_user_id":177539201,"to_user":"chewedwire","geo":null,"iso_language_code":"en","to_user_id_str":"128028225","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"782692","profile_image_url":"http://a0.twimg.com/profile_images/1031304589/Profile.2007.1_normal.jpg","created_at":"Wed, 26 Jan 2011 03:29:19 +0000","from_user":"turnageb","id_str":"30104974591533057","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @ovillalon: Paul Ryan solves the mystery of whatever happened to Eddie Haskell. #sotu","id":30104974591533057,"from_user_id":782692,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"128028225","profile_image_url":"http://a1.twimg.com/profile_images/1224994593/Coding_Drunk_normal.jpg","created_at":"Wed, 26 Jan 2011 03:28:04 +0000","from_user":"chewedwire","id_str":"30104657267265536","metadata":{"result_type":"recent"},"to_user_id":177539201,"text":"@tomheon I always loved the pattern matching in SML and it looks like Haskell is MUCH better at it. I'm messing around now at tryhaskell.org","id":30104657267265536,"from_user_id":128028225,"to_user":"tomheon","geo":null,"iso_language_code":"en","to_user_id_str":"177539201","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"12834082","profile_image_url":"http://a3.twimg.com/profile_images/1083036140/mugshot_normal.png","created_at":"Wed, 26 Jan 2011 03:28:01 +0000","from_user":"ovillalon","id_str":"30104647213518848","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Paul Ryan solves the mystery of whatever happened to Eddie Haskell. #sotu","id":30104647213518848,"from_user_id":12834082,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"13540930","profile_image_url":"http://a1.twimg.com/profile_images/1205312219/23467_350321383101_821143101_5114147_3010041_n_normal.jpg","created_at":"Wed, 26 Jan 2011 03:26:02 +0000","from_user":"goodfox","id_str":"30104146455560192","metadata":{"result_type":"recent"},"to_user_id":10226179,"text":"@billykeene22 Bordeaux is one of my heroes. I was so excited when he accepted the invitation to campus. He's been a great friend to Haskell.","id":30104146455560192,"from_user_id":13540930,"to_user":"billykeene22","geo":null,"iso_language_code":"en","to_user_id_str":"10226179","source":"&lt;a href=&quot;http://www.ubertwitter.com/bb/download.php&quot; rel=&quot;nofollow&quot;&gt;\u00dcberTwitter&lt;/a&gt;"},{"from_user_id_str":"18616016","profile_image_url":"http://a2.twimg.com/profile_images/1173522726/214397343_normal.jpg","created_at":"Wed, 26 Jan 2011 03:25:18 +0000","from_user":"josej30","id_str":"30103962313031681","metadata":{"result_type":"recent"},"to_user_id":14870909,"text":"@cris7ian Ahh bueno multiparadigma ya es respetable :) Empezar\u00e9 a explotar la parte funcional de los lenguajes ahora #Haskell","id":30103962313031681,"from_user_id":18616016,"to_user":"Cris7ian","geo":null,"iso_language_code":"es","to_user_id_str":"14870909","source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"14870909","profile_image_url":"http://a2.twimg.com/profile_images/1176930429/oso_yo_normal.png","created_at":"Wed, 26 Jan 2011 03:23:43 +0000","from_user":"Cris7ian","id_str":"30103562360983553","metadata":{"result_type":"recent"},"to_user_id":18616016,"text":"@josej30 hahaha no, es multiparadigma y es bastante lazy. Nothing like haskell, pero s\u00ed, el de Flash","id":30103562360983553,"from_user_id":14870909,"to_user":"josej30","geo":null,"iso_language_code":"es","to_user_id_str":"18616016","source":"&lt;a href=&quot;http://www.echofon.com/&quot; rel=&quot;nofollow&quot;&gt;Echofon&lt;/a&gt;"},{"from_user_id_str":"2421643","profile_image_url":"http://a0.twimg.com/profile_images/1190361665/ernestgrumbles-17_normal.jpg","created_at":"Wed, 26 Jan 2011 03:20:24 +0000","from_user":"ernestgrumbles","id_str":"30102730756333568","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Wow... WolframAlpha did not know who Eddie Haskell is. Guess I'll never use that &quot;knowledge engine&quot; again.","id":30102730756333568,"from_user_id":2421643,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"128028225","profile_image_url":"http://a1.twimg.com/profile_images/1224994593/Coding_Drunk_normal.jpg","created_at":"Wed, 26 Jan 2011 03:14:21 +0000","from_user":"chewedwire","id_str":"30101204428132352","metadata":{"result_type":"recent"},"to_user_id":177539201,"text":"@tomheon How is Haskell better/different from CL or Scheme? I honestly don't know, although I'm becoming more curious.","id":30101204428132352,"from_user_id":128028225,"to_user":"tomheon","geo":null,"iso_language_code":"en","to_user_id_str":"177539201","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"13540930","profile_image_url":"http://a1.twimg.com/profile_images/1205312219/23467_350321383101_821143101_5114147_3010041_n_normal.jpg","created_at":"Wed, 26 Jan 2011 03:06:54 +0000","from_user":"goodfox","id_str":"30099329809129473","metadata":{"result_type":"recent"},"to_user_id":null,"text":"A day of vision &amp; speeches. #SOTU now. And a wonderful Haskell Convocation address earlier today by Sinte Gleske President Lionel Bordeaux.","id":30099329809129473,"from_user_id":13540930,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.ubertwitter.com/bb/download.php&quot; rel=&quot;nofollow&quot;&gt;\u00dcberTwitter&lt;/a&gt;"},{"from_user_id_str":"119185220","profile_image_url":"http://a0.twimg.com/profile_images/1089027228/dfg_normal.jpg","created_at":"Wed, 26 Jan 2011 03:03:38 +0000","from_user":"LaLiciouz_03","id_str":"30098510623805440","metadata":{"result_type":"recent"},"to_user_id":null,"text":"The Game with the girl room 330 Haskell follow us...","id":30098510623805440,"from_user_id":119185220,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"18616016","profile_image_url":"http://a2.twimg.com/profile_images/1173522726/214397343_normal.jpg","created_at":"Wed, 26 Jan 2011 02:57:25 +0000","from_user":"josej30","id_str":"30096946144215040","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Voy a extra\u00f1ar Haskell cuando regrese al mundo imperativo. Hay alg\u00fan lenguaje imperativo que tenga este poder funcional? #ci3661","id":30096946144215040,"from_user_id":18616016,"geo":null,"iso_language_code":"es","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"17671137","profile_image_url":"http://a2.twimg.com/profile_images/290264834/Haskell-logo-outer-glow_normal.png","created_at":"Wed, 26 Jan 2011 02:55:32 +0000","from_user":"Hackage","id_str":"30096471814574080","metadata":{"result_type":"recent"},"to_user_id":null,"text":"comonad-transformers 0.9.0, added by EdwardKmett: Haskell 98 comonad transformers http://bit.ly/h6xIsf","id":30096471814574080,"from_user_id":17671137,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitterfeed.com&quot; rel=&quot;nofollow&quot;&gt;twitterfeed&lt;/a&gt;"},{"from_user_id_str":"177539201","profile_image_url":"http://a0.twimg.com/profile_images/1178368800/img_normal.jpeg","created_at":"Wed, 26 Jan 2011 02:48:12 +0000","from_user":"tomheon","id_str":"30094626920603649","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Every time I look at Haskell I love it more.","id":30094626920603649,"from_user_id":177539201,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"60792568","profile_image_url":"http://a0.twimg.com/profile_images/1203647517/glenda-flash_normal.jpg","created_at":"Wed, 26 Jan 2011 02:40:42 +0000","from_user":"r_takaishi","id_str":"30092735935422464","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell\u3088\u308aD\u8a00\u8a9e\u304c\u4e0a\u3068\u306f\u601d\u308f\u306a\u304b\u3063\u305f\uff0e http://www.tiobe.com/index.php/content/paperinfo/tpci/index.html","id":30092735935422464,"from_user_id":60792568,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"&lt;a href=&quot;http://twmode.sf.net/&quot; rel=&quot;nofollow&quot;&gt;twmode&lt;/a&gt;"},{"from_user_id_str":"160145510","profile_image_url":"http://a0.twimg.com/profile_images/1218108166/going_galt_normal.jpg","created_at":"Wed, 26 Jan 2011 02:39:31 +0000","from_user":"wtp1787","id_str":"30092439653974018","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @KLSouth: Eddie Haskell Goes to Washington... &quot;You look really nice tonight, Ms Cleaver&quot;","id":30092439653974018,"from_user_id":160145510,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"96616016","profile_image_url":"http://a1.twimg.com/profile_images/1196978169/Picture0002_normal.jpg","created_at":"Wed, 26 Jan 2011 02:39:20 +0000","from_user":"MelissaRNMBA","id_str":"30092392203816960","metadata":{"result_type":"recent"},"to_user_id":14862975,"text":"@KLSouth At least Eddie Haskell was entertaining.","id":30092392203816960,"from_user_id":96616016,"to_user":"KLSouth","geo":null,"iso_language_code":"en","to_user_id_str":"14862975","source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"14862975","profile_image_url":"http://a0.twimg.com/profile_images/421596393/kls_4_normal.JPG","created_at":"Wed, 26 Jan 2011 02:38:29 +0000","from_user":"KLSouth","id_str":"30092178327871489","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Eddie Haskell Goes to Washington... &quot;You look really nice tonight, Ms Cleaver&quot;","id":30092178327871489,"from_user_id":14862975,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.tweetdeck.com&quot; rel=&quot;nofollow&quot;&gt;TweetDeck&lt;/a&gt;"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Wed, 26 Jan 2011 02:36:17 +0000","from_user":"listwarenet","id_str":"30091626869161984","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-beginners/84641-haskell-beginners-wildcards-in-expressions.html Haskell-beginners - Wild","id":30091626869161984,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"&lt;a href=&quot;http://1e10.org/cloud/&quot; rel=&quot;nofollow&quot;&gt;1e10&lt;/a&gt;"},{"from_user_id_str":"24538048","profile_image_url":"http://a2.twimg.com/profile_images/1117267605/rope_normal.jpg","created_at":"Wed, 26 Jan 2011 02:23:14 +0000","from_user":"dbph","id_str":"30088341030440960","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @dnene: Skilled Calisthenics. Haskell code that outputs python which spits ruby which emits the haskell source. http://j.mp/YlQUL via @mfeathers","id":30088341030440960,"from_user_id":24538048,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"},{"from_user_id_str":"158951567","profile_image_url":"http://a3.twimg.com/profile_images/962721419/Logo_3_normal.jpg","created_at":"Wed, 26 Jan 2011 01:58:31 +0000","from_user":"YubaVetTech","id_str":"30082124207886336","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Dr. Haskell has just been awarded the prestigious Hayward Award for \u2018Excellence in Education\u2019. This award honors... http://fb.me/QgQCxd74","id":30082124207886336,"from_user_id":158951567,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.facebook.com/twitter&quot; rel=&quot;nofollow&quot;&gt;Facebook&lt;/a&gt;"},{"from_user_id_str":"158951567","profile_image_url":"http://a3.twimg.com/profile_images/962721419/Logo_3_normal.jpg","created_at":"Wed, 26 Jan 2011 01:56:04 +0000","from_user":"YubaVetTech","id_str":"30081505476743168","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Dr. Haskell has just been awarded the prestigous Haward Award for Excellence in Education. This award honors... http://fb.me/PC9mYmCR","id":30081505476743168,"from_user_id":158951567,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://www.facebook.com/twitter&quot; rel=&quot;nofollow&quot;&gt;Facebook&lt;/a&gt;"},{"from_user_id_str":"2331498","profile_image_url":"http://a3.twimg.com/profile_images/494632120/me_normal.jpg","created_at":"Wed, 26 Jan 2011 01:43:50 +0000","from_user":"Verus","id_str":"30078427155406848","metadata":{"result_type":"recent"},"to_user_id":79273052,"text":"@kami_joe \u3044\u3084\uff0c\u8ab2\u984c\u306f\u89e3\u6c7a\u5bfe\u8c61(\u30d1\u30ba\u30eb\u3068\u304b)\u3092\u4e0e\u3048\u3089\u308c\u3066\uff0c\u554f\u984c\u5b9a\u7fa9\u3068\u30d7\u30ed\u30b0\u30e9\u30df\u30f3\u30b0(\u6307\u5b9a\u8a00\u8a9e\u306fC++\u3082\u3057\u304f\u306fJava)\u3068\u3044\u3046\u3044\u308f\u3070\u666e\u901a\u306a\u8ab2\u984c\u3067\u306f\u3042\u308b\u3093\u3060\u3051\u3069\uff0e\u95a2\u6570\u578b\u8a00\u8a9e\u306fHaskell\u306e\u6388\u696d\u304c\u307e\u305f\u5225\u306b\u3042\u308b\u306e\uff0e","id":30078427155406848,"from_user_id":2331498,"to_user":"kami_joe","geo":null,"iso_language_code":"ja","to_user_id_str":"79273052","source":"&lt;a href=&quot;http://itunes.apple.com/us/app/twitter/id409789998?mt=12&quot; rel=&quot;nofollow&quot;&gt;Twitter for Mac&lt;/a&gt;"},{"from_user_id_str":"79151233","profile_image_url":"http://a2.twimg.com/a/1295051201/images/default_profile_2_normal.png","created_at":"Wed, 26 Jan 2011 01:40:37 +0000","from_user":"cz_newdrafts","id_str":"30077617361125376","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell programming language http://bit.ly/gpPAwB","id":30077617361125376,"from_user_id":79151233,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"&lt;a href=&quot;http://tommorris.org/&quot; rel=&quot;nofollow&quot;&gt;tommorris' hacksample&lt;/a&gt;"},{"from_user_id_str":"2331498","profile_image_url":"http://a3.twimg.com/profile_images/494632120/me_normal.jpg","created_at":"Wed, 26 Jan 2011 01:02:57 +0000","from_user":"Verus","id_str":"30068139416879104","metadata":{"result_type":"recent"},"to_user_id":9252720,"text":"@shukukei Java\u3068C\u306f\u3042\u308b\u7a0b\u5ea6\u66f8\u3051\u3066\u3042\u305f\u308a\u307e\u3048\u306a\u3068\u3053\u308d\u304c\u3042\u308b\u304b\u3089\u306a\u30fc\uff0ePython\u306f\u500b\u4eba\u7684\u306b\u611f\u899a\u304c\u5408\u308f\u306a\u3044\uff0e\u611f\u899a\u306a\u306e\u3067\uff0c\u3082\u3046\u3069\u3046\u3057\u3088\u3046\u3082\u306a\u3044\uff57 \u3044\u307e\u306fScala\u3068Haskell\u3092\u3082\u3063\u3068\u6975\u3081\u305f\u3044\u3068\u3053\u308d\uff0e","id":30068139416879104,"from_user_id":2331498,"to_user":"shukukei","geo":null,"iso_language_code":"ja","to_user_id_str":"9252720","source":"&lt;a href=&quot;http://itunes.apple.com/us/app/twitter/id409789998?mt=12&quot; rel=&quot;nofollow&quot;&gt;Twitter for Mac&lt;/a&gt;"},{"from_user_id_str":"2781460","profile_image_url":"http://a0.twimg.com/profile_images/82526625/.joeyicon_normal.jpg","created_at":"Wed, 26 Jan 2011 01:02:35 +0000","from_user":"joeyhess","id_str":"30068046538219520","metadata":{"result_type":"recent"},"to_user_id":null,"text":"just figured out that I can use parameterized types to remove a dependency loop in git-annex's type definitions. whee #haskell","id":30068046538219520,"from_user_id":2781460,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://identi.ca&quot; rel=&quot;nofollow&quot;&gt;identica&lt;/a&gt;"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Wed, 26 Jan 2011 00:54:22 +0000","from_user":"listwarenet","id_str":"30065977920061440","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-beginners/84466-haskell-beginners-bytestring-question.html Haskell-beginners - Bytestrin","id":30065977920061440,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"&lt;a href=&quot;http://1e10.org/cloud/&quot; rel=&quot;nofollow&quot;&gt;1e10&lt;/a&gt;"},{"from_user_id_str":"1291845","profile_image_url":"http://a0.twimg.com/profile_images/1225743404/ThinOxygen-small-opaque-solidarity_normal.png","created_at":"Wed, 26 Jan 2011 00:52:07 +0000","from_user":"_aaron_","id_str":"30065412242669568","metadata":{"result_type":"recent"},"to_user_id":null,"text":"wanted: librly licensed high level native compiled lang with min runtime (otherwise cobra/mono would be perfect) for win. lua? haskell? ooc?","id":30065412242669568,"from_user_id":1291845,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"&lt;a href=&quot;http://twitter.com/&quot;&gt;web&lt;/a&gt;"}],"max_id":30120402839666689,"since_id":0,"refresh_url":"?since_id=30120402839666689&q=haskell","next_page":"?page=2&max_id=30120402839666689&rpp=50&q=haskell","results_per_page":50,"page":1,"completed_in":0.291696,"since_id_str":"0","max_id_str":"30120402839666689","query":"haskell"}
benchmarks/med.txt.bz2deleted

Binary file not shown.

benchmarks/warp-3.0.1.1/LICENSEdeleted−20
@@ -1,20 +0,0 @@
1−Copyright (c) 2012 Michael Snoyman, http://www.yesodweb.com/
2−
3−Permission is hereby granted, free of charge, to any person obtaining
4−a copy of this software and associated documentation files (the
5−"Software"), to deal in the Software without restriction, including
6−without limitation the rights to use, copy, modify, merge, publish,
7−distribute, sublicense, and/or sell copies of the Software, and to
8−permit persons to whom the Software is furnished to do so, subject to
9−the following conditions:
10−
11−The above copyright notice and this permission notice shall be
12−included in all copies or substantial portions of the Software.
13−
14−THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
15−EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
16−MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
17−NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE
18−LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION
19−OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION
20−WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
benchmarks/warp-3.0.1.1/Network/Wai/Handler/Warp/ReadInt.hsdeleted−67
@@ -1,67 +0,0 @@
1−{-# LANGUAGE OverloadedStrings #-}
2−{-# LANGUAGE MagicHash #-}
3−{-# LANGUAGE BangPatterns #-}
4−
5−-- Copyright : Erik de Castro Lopo <erikd@mega-nerd.com>
6−-- License : BSD3
7−
8−module Network.Wai.Handler.Warp.ReadInt (
9− readInt
10− , readInt64
11− ) where
12−
13−-- This function lives in its own file because the MagicHash pragma interacts
14−-- poorly with the CPP pragma.
15−
16−import Data.ByteString (ByteString)
17−import qualified Data.ByteString as S
18−import Data.Int (Int64)
19−import GHC.Prim
20−import GHC.Types
21−import GHC.Word
22−
23−{-# INLINE readInt #-}
24−readInt :: Integral a => ByteString -> a
25−readInt bs = fromIntegral $ readInt64 bs
26−
27−-- This function is used to parse the Content-Length field of HTTP headers and
28−-- is a performance hot spot. It should only be replaced with something
29−-- significantly and provably faster.
30−--
31−-- It needs to be able work correctly on 32 bit CPUs for file sizes > 2G so we
32−-- use Int64 here and then make a generic 'readInt' that allows conversion to
33−-- Int and Integer.
34−
35−{-# NOINLINE readInt64 #-}
36−readInt64 :: ByteString -> Int64
37−readInt64 bs = S.foldl' (\ !i !c -> i * 10 + fromIntegral (mhDigitToInt c)) 0
38− $ S.takeWhile isDigit bs
39−
40−data Table = Table !Addr#
41−
42−{-# NOINLINE mhDigitToInt #-}
43−mhDigitToInt :: Word8 -> Int
44−mhDigitToInt (W8# i) = I# (word2Int# (indexWord8OffAddr# addr (word2Int# i)))
45− where
46− !(Table addr) = table
47− table :: Table
48− table = Table
49− "\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\
50− \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\
51− \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\
52− \\x00\x01\x02\x03\x04\x05\x06\x07\x08\x09\x00\x00\x00\x00\x00\x00\
53− \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\
54− \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\
55− \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\
56− \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\
57− \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\
58− \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\
59− \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\
60− \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\
61− \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\
62− \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\
63− \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\
64− \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00"#
65−
66−isDigit :: Word8 -> Bool
67−isDigit w = w >= 48 && w <= 57
benchmarks/warp-3.0.1.1/Network/Wai/Handler/Warp/RequestHeader.hsdeleted−172
@@ -1,172 +0,0 @@
1−{-# LANGUAGE DeriveDataTypeable #-}
2−{-# LANGUAGE OverloadedStrings #-}
3−{-# LANGUAGE BangPatterns #-}
4−
5−module Network.Wai.Handler.Warp.RequestHeader (
6− parseHeaderLines
7− , parseByteRanges
8− ) where
9−
10−import Control.Exception (Exception, throwIO)
11−import Control.Monad (when)
12−import Data.Typeable (Typeable)
13−import qualified Data.ByteString as S
14−import qualified Data.ByteString.Char8 as B (unpack, readInteger)
15−import Data.ByteString.Internal (ByteString(..), memchr)
16−import qualified Data.CaseInsensitive as CI
17−import Data.Word (Word8)
18−import Foreign.ForeignPtr (withForeignPtr)
19−import Foreign.Ptr (Ptr, plusPtr, minusPtr, nullPtr)
20−import Foreign.Storable (peek)
21−import qualified Network.HTTP.Types as H
22−-- import Network.Wai.Handler.Warp.Types
23−import qualified Network.HTTP.Types.Header as HH
24−-- $setup
25−-- >>> :set -XOverloadedStrings
26−
27−data InvalidRequest = NotEnoughLines [String]
28− | BadFirstLine String
29− | NonHttp
30− | IncompleteHeaders
31− | ConnectionClosedByPeer
32− | OverLargeHeader
33− deriving (Eq, Typeable, Show)
34−
35−instance Exception InvalidRequest
36−
37−----------------------------------------------------------------
38−
39−parseHeaderLines :: [ByteString]
40− -> IO (H.Method
41− ,ByteString -- Path
42− ,ByteString -- Path, parsed
43− ,ByteString -- Query
44− ,H.HttpVersion
45− ,H.RequestHeaders
46− )
47−parseHeaderLines [] = throwIO $ NotEnoughLines []
48−parseHeaderLines (firstLine:otherLines) = do
49− (method, path', query, httpversion) <- parseRequestLine firstLine
50− let path = H.extractPath path'
51− hdr = map parseHeader otherLines
52− return (method, path', path, query, httpversion, hdr)
53−
54−----------------------------------------------------------------
55−
56−-- |
57−--
58−-- >>> parseRequestLine "GET / HTTP/1.1"
59−-- ("GET","/","",HTTP/1.1)
60−-- >>> parseRequestLine "POST /cgi/search.cgi?key=foo HTTP/1.0"
61−-- ("POST","/cgi/search.cgi","?key=foo",HTTP/1.0)
62−-- >>> parseRequestLine "GET "
63−-- *** Exception: Warp: Invalid first line of request: "GET "
64−-- >>> parseRequestLine "GET /NotHTTP UNKNOWN/1.1"
65−-- *** Exception: Warp: Request line specified a non-HTTP request
66−parseRequestLine :: ByteString
67− -> IO (H.Method
68− ,ByteString -- Path
69− ,ByteString -- Query
70− ,H.HttpVersion)
71−parseRequestLine requestLine@(PS fptr off len) = withForeignPtr fptr $ \ptr -> do
72− when (len < 14) $ throwIO baderr
73− let methodptr = ptr `plusPtr` off
74− limptr = methodptr `plusPtr` len
75− lim0 = fromIntegral len
76−
77− pathptr0 <- memchr methodptr 32 lim0 -- ' '
78− when (pathptr0 == nullPtr || (limptr `minusPtr` pathptr0) < 11) $
79− throwIO baderr
80− let pathptr = pathptr0 `plusPtr` 1
81− lim1 = fromIntegral (limptr `minusPtr` pathptr0)
82−
83− httpptr0 <- memchr pathptr 32 lim1 -- ' '
84− when (httpptr0 == nullPtr || (limptr `minusPtr` httpptr0) < 9) $
85− throwIO baderr
86− let httpptr = httpptr0 `plusPtr` 1
87− lim2 = fromIntegral (httpptr0 `minusPtr` pathptr)
88−
89− checkHTTP httpptr
90− !hv <- httpVersion httpptr
91− queryptr <- memchr pathptr 63 lim2 -- '?'
92−
93− let !method = bs ptr methodptr pathptr0
94− !path
95− | queryptr == nullPtr = bs ptr pathptr httpptr0
96− | otherwise = bs ptr pathptr queryptr
97− !query
98− | queryptr == nullPtr = S.empty
99− | otherwise = bs ptr queryptr httpptr0
100−
101− return (method,path,query,hv)
102− where
103− baderr = BadFirstLine $ B.unpack requestLine
104− check :: Ptr Word8 -> Int -> Word8 -> IO ()
105− check p n w = do
106− w0 <- peek $ p `plusPtr` n
107− when (w0 /= w) $ throwIO NonHttp
108− checkHTTP httpptr = do
109− check httpptr 0 72 -- 'H'
110− check httpptr 1 84 -- 'T'
111− check httpptr 2 84 -- 'T'
112− check httpptr 3 80 -- 'P'
113− check httpptr 4 47 -- '/'
114− check httpptr 6 46 -- '.'
115− httpVersion httpptr = do
116− major <- peek $ httpptr `plusPtr` 5
117− minor <- peek $ httpptr `plusPtr` 7
118− return $ if major == (49 :: Word8) && minor == (49 :: Word8) then
119− H.http11
120− else
121− H.http10
122− bs ptr p0 p1 = PS fptr o l
123− where
124− o = p0 `minusPtr` ptr
125− l = p1 `minusPtr` p0
126−
127−----------------------------------------------------------------
128−
129−-- |
130−--
131−-- >>> parseHeader "Content-Length:47"
132−-- ("Content-Length","47")
133−-- >>> parseHeader "Accept-Ranges: bytes"
134−-- ("Accept-Ranges","bytes")
135−-- >>> parseHeader "Host: example.com:8080"
136−-- ("Host","example.com:8080")
137−-- >>> parseHeader "NoSemiColon"
138−-- ("NoSemiColon","")
139−
140−parseHeader :: ByteString -> H.Header
141−parseHeader s =
142− let (k, rest) = S.break (== 58) s -- ':'
143− rest' = S.dropWhile (\c -> c == 32 || c == 9) $ S.drop 1 rest
144− in (CI.mk k, rest')
145−
146−parseByteRanges :: S.ByteString -> Maybe HH.ByteRanges
147−parseByteRanges bs1 = do
148− bs2 <- stripPrefix "bytes=" bs1
149− (r, bs3) <- range bs2
150− ranges (r:) bs3
151− where
152− range bs2 =
153− case stripPrefix "-" bs2 of
154− Just bs3 -> do
155− (i, bs4) <- B.readInteger bs3
156− Just (HH.ByteRangeSuffix i, bs4)
157− Nothing -> do
158− (i, bs3) <- B.readInteger bs2
159− bs4 <- stripPrefix "-" bs3
160− case B.readInteger bs4 of
161− Nothing -> Just (HH.ByteRangeFrom i, bs4)
162− Just (j, bs5) -> Just (HH.ByteRangeFromTo i j, bs5)
163− ranges front bs3 =
164− case stripPrefix "," bs3 of
165− Nothing -> Just (front [])
166− Just bs4 -> do
167− (r, bs5) <- range bs4
168− ranges (front . (r:)) bs5
169−
170− stripPrefix x y
171− | x `S.isPrefixOf` y = Just (S.drop (S.length x) y)
172− | otherwise = Nothing
bytestringparser.cabalnew file+34
@@ -0,0 +1,34 @@
1+name: bytestringparser
2+version: 0.3
3+license: BSD3
4+license-file: LICENSE
5+category: Text, Parsing
6+author: Bryan O'Sullivan <bos@serpentine.com>
7+stability: experimental
8+synopsis: Combinator parsing with Data.ByteString.Lazy
9+cabal-version: >= 1.2
10+
11+flag split-base
12+flag applicative-in-base
13+
14+library
15+ if flag(split-base)
16+ -- bytestring was in base-2.0 and 2.1.1
17+ build-depends: base >= 2.0 && < 2.2
18+ else
19+ -- in base 1.0 and 3.0 bytestring is a separate package
20+ build-depends: base < 2.0 || >= 3, bytestring >= 0.9, containers >= 0.1.0.1
21+
22+ if flag(applicative-in-base)
23+ build-depends: base >= 2.0
24+ cpp-options: -DAPPLICATIVE_IN_BASE
25+ else
26+ build-depends: base < 2.0
27+
28+ extensions: CPP
29+ exposed-modules: Data.ParserCombinators.Attoparsec
30+ Data.ParserCombinators.Attoparsec.Char8
31+ Data.ParserCombinators.Attoparsec.FastSet
32+ Data.ParserCombinators.Attoparsec.Internal
33+ hs-source-dirs: src
34+ ghc-options: -O2 -Wall -Werror -funbox-strict-fields
changelog.mddeleted−114
@@ -1,114 +0,0 @@
1−0.13.2.1
2−
3−* Improved performance of `Data.Attoparsec.Text.asciiCI`
4−
5−0.13.2.0
6−
7−* `pure` is now strict in `Position`
8−
9−0.13.1.0
10−
11−* `runScanner` now correctly returns the final state
12− (https://github.com/bos/attoparsec/issues/105).
13−* `Parser`, `ZeptoT`, `Buffer`, and `More` now expose `Semigroup` instances.
14−* `Parser`, and `ZeptoT` now expose `MonadFail` instances.
15−
16−0.13.0.2
17−
18−* Restore the fast specialised character set implementation for Text
19−* Move testsuite from test-framework to tasty
20−* Performance optimization of takeWhile and takeWhile1
21−
22−0.13.0.1
23−
24−* Fixed a bug in the implementations of inClass and notInClass for
25− Text (https://github.com/bos/attoparsec/issues/103)
26−
27−0.13.0.0
28−
29−* Made the parser type in the Zepto module a monad transformer
30− (needed by aeson's string unescaping parser).
31−
32−0.12.1.6
33−
34−* Fixed a case folding bug in the ByteString version of stringCI.
35−
36−0.12.1.5
37−
38−* Fixed an indexing bug in the new Text implementation of string,
39− reported by Michel Boucey.
40−
41−0.12.1.4
42−
43−* Fixed a case where the string parser would consume an unnecessary
44− amount of input before failing a match, when it could bail much
45− earlier (https://github.com/bos/attoparsec/issues/97)
46−
47−* Added more context to error messages
48− (https://github.com/bos/attoparsec/pull/79)
49−
50−0.12.1.3
51−
52−* Fixed incorrect tracking of Text lengths
53− (https://github.com/bos/attoparsec/issues/80)
54−
55−0.12.1.2
56−
57−* Fixed the incorrect tracking of capacity if the initial buffer was
58− empty (https://github.com/bos/attoparsec/issues/75)
59−
60−0.12.1.1
61−
62−* Fixed a data corruption bug that occurred under some circumstances
63− if a buffer grew after prompting for more input
64− (https://github.com/bos/attoparsec/issues/74)
65−
66−0.12.1.0
67−
68−* Now compatible with GHC 7.9
69−
70−* Reintroduced the Chunk class, used by the parsers package
71−
72−0.12.0.0
73−
74−* A new internal representation makes almost all real-world parsers
75− faster, sometimes by big margins. For example, parsing JSON data
76− with aeson is now up to 70% faster. These performance improvements
77− also come with reduced memory consumption and some new capabilities.
78−
79−* The new match combinator gives both the result of a parse and the
80− input that it matched.
81−
82−* The test suite has doubled in size. This made it possible to switch
83− to the new internal representation with a decent degree of
84− confidence that everything was more or less working.
85−
86−* The benchmark suite now contains a small family of benchmarks taken
87− from real-world uses of attoparsec.
88−
89−* A few types that ought to have been private now are.
90−
91−* A few obsolete modules and functions have been marked as deprecated.
92− They will be removed from the next major release.
93−
94−0.11.3.0
95−
96−* New function scientific is compatible with rational, but parses
97− integers more efficiently (https://github.com/bos/aeson/issues/198)
98−
99−0.11.2.0
100−
101−* The new Chunk typeclass allows for some code sharing with Ed
102− Kmett's parsers package: http://hackage.haskell.org/package/parsers
103−
104−* New function runScanner generalises scan to return the final state
105− of the scanner as well as the input consumed.
106−
107−
108−0.11.1.0
109−
110−* New dependency: the scientific package. This allows us to parse
111− numbers much more efficiently.
112−
113−* peekWord8', peekChar': new primitive parsers that allow
114− single-character lookahead.
doc/attoparsec-rewired-2.mddeleted−93
@@ -1,93 +0,0 @@
1−In my
2−[first of this pair of articles](http://www.serpentine.com/blog/2010/03/03/whats-in-a-parsing-library-1/),
3−I laid out some of the qualities I've been looking for in a parsing
4−library.
5−
6−Before I dive back into detail, I want to show off some numbers. The
7−new Attoparsec code is _fast_.
8−
9−![Performance](http://chart.apis.google.com/chart?cht=bvs&chs=340x200&chd=t:260,0,0,0,0|0,471,0,0,0|0,0,17037,0,0|0,0,0,23753,0|0,0,0,0,36753&chds=0,40000&chco=4D89F9|894DF9|F94D89|4DB989|1969FD&chdl=260+ms:+http_parser|471+ms:+Attoparsec|17037+ms:+Parsec+3+CPS|23753+ms:+Lazy+Parsec+3+CPS|36753+ms:+Parsec+3&chxt=y&chxl=0:||10|20|30|40&chtt=Time+to+parse+45,668|HTTP+GET+requests)
10−
11−What did I benchmark? I captured some real HTTP GET requests from a
12−live public web server, averaging 431 bytes per request. I chucked
13−them into a file, and measured the time needed to parse the entire
14−contents of the file with the following libraries:
15−
16−* Ryan Dahl's [http-parser](http://github.com/ry/http-parser) library,
17− which is 1,672 lines of hand-rolled C craziness. Its heritage seems
18− to be closely based on the Ragel-generated parser used by Mongrel.
19− This library is a fair approximation to about as fast as you can
20− get, since it's been tuned for just one purpose. I wrote a small,
21− but reasonably realistic,
22− [driver program](http://bitbucket.org/bos/attoparsec/src/tip/examples/rfc2616.c)
23− to wire it up to file-based data, adding another 210 lines of code.
24−
25−* An Attoparsec-based
26− [HTTP request parser](http://bitbucket.org/bos/attoparsec/src/tip/examples/RFC2616.hs),
27− 54 lines long, with about 30 lines of
28− [driver program](http://bitbucket.org/bos/attoparsec/src/tip/examples/TestRFC2616.hs).
29− (Attoparsec itself is about 900 lines of code.)
30−
31−* Several
32− [Parsec-3-based parsers](http://bitbucket.org/bos/attoparsec/src/tip/examples/Parsec_RFC2616.hs),
33− which are almost identical in length to the Attoparsec-based
34− version.
35−
36−The Parsec 3 parsers come in three varieties:
37−
38−* The fastest uses a patch that Antoine Latter wrote to switch Parsec
39− 3's internal machinery over to using continuation passing style
40− (CPS). This parser uses `ByteString` for input, and reads the
41− entire 18.8MB file in one chunk.
42−
43−* Next is the same parser, using lazy `ByteString` I/O to read the
44− file in 64KB chunks. This costs about 50% in performance, but is
45− almost mandatory to maintain a sensible footprint on large inputs.
46−
47−* In last place is the official version of Parsec 3, reading the input
48− in one chunk. (Reading lazily still costs an additional 50%, but I
49− didn't want to further clutter the chart with more big numbers.)
50−
51−What's interesting to me is that the tiny Attoparsec-based parser,
52−which is more or less a transliteration of the relevant parts of
53−[RFC 2616](http://www.w3.org/Protocols/rfc2616/rfc2616.html), is so
54−fast.
55−
56−I went back and remeasured performance of the Attoparsec and C parsers
57−on a larger data set (295,568 URLs), and got these numbers:
58−
59−* Attoparsec: 2.889 seconds, or 102,308 requests/second
60−
61−* C: 1.614 seconds, or 183,128 requests/second
62−
63−That clocks the Attoparsec-based parser at about 56% the speed of the
64−C parser. Not bad, given that it's about 3.2% the number of lines of
65−code!
66−
67−Of course there are tradeoffs involved here.
68−
69−* Parsec 3 emits much more friendly error messages, and can handle
70− many different input types. Attoparsec, being aimed at
71− plumbing-oriented network protocols, considers friendly error
72− messages to not be worth the effort, and is specialised to the
73− arrays of bytes you get straight off the network.
74−
75−* Parsec 3 requires all of its input to be available when the parser
76− is run (either in one large chunk or via lazy I/O). If Attoparsec
77− has insufficient data to return a complete result, it hands back a
78− continuation that you provide extra data to. This eliminates the
79− need for lazy I/O and any additional buffering, and makes for a
80− beautiful, pure API that doesn't care what its input source is.
81−
82−The memory footprint of the Attoparsec-based parser is small: it will
83−run in 568KB of heap on my 64-bit laptop. The smallest heap size that
84−the Parsec 3 parser can survive in isn't all that much larger: with
85−lazily read input, it will run in a 750KB heap.
86−
87−Overall, this is yet another instance where a little careful attention
88−to performance yields very exciting results. Personally, I'd be quite
89−happy to trade a 97% reduction in code size for such a small
90−performance hit, especially given the clarity, ease of use, and
91−flexibility of the resulting code. (The `http_parser` API is frankly
92−not so much fun to use, even though I completely understand the
93−motivation behind it.)
doc/whats-in-a-parser-1.mddeleted−88
@@ -1,88 +0,0 @@
1−My goal in working on the
2−[new GHC I/O manager](http://www.serpentine.com/blog/2010/01/22/new-ghc-io-manager-first-benchmark-numbers/)
3−has been to get the Haskell network stack into a state where it could
4−be used to attack high-performance and scalable networking problems,
5−domains in which it has historically been weak.
6−
7−While it's encouraging to have an excellent networking stack (Johan
8−and I now have this thoroughly in hand), the next thing I'd look for
9−is libraries to help build networked applications. One of the
10−fundamental things that such apps need to do well is parse data, be it
11−received from the network or read from files.
12−
13−The Haskell parsing library of first resort has for years been
14−[Parsec](http://www.haskell.org/haskellwiki/Parsec). While other
15−capable libraries exist
16−(e.g. [polyparse](http://hackage.haskell.org/package/polyparse) and
17−[uu-parsinglib](http://hackage.haskell.org/package/uu-parsinglib)),
18−they don't appear to see much use.
19−
20−As appealing as Parsec's API is, it has a few problems:
21−
22−* Parsec 2 is slow, and it has high memory overhead, due to its use of
23− Haskell's `String` type for tokens. Parsec 3 can use the more
24− efficient `ByteString` type (which is in any case much more
25− appropriate for networked applications that deal in octets), but it
26− achieves this flexibility at the cost of being even slower than
27− Parsec 2.
28−
29−* Parsec's API demands that all of a parser's input be available at
30− once. People usually work around this by feeding a Parsec parser
31− with lazily read data, but lazy I/O is at odds with my goal of
32− writing solid networked code.
33−
34−What properties should a parsing library for networked applications
35−ideally possess? There are a few obvious desiderata that have been
36−well known for years. For example, it's important to have an appealing
37−API and programming model. Parsec squarely fits this desire.
38−
39−Performance is also a big consideration. Ideally, a parsing library
40−would be fast enough that you wouldn't feel any real need for either
41−of the following:
42−
43−* A few weeks to write an insane hand-bummed parser.
44−
45−* Mechanical parser generators or lexers
46− (e.g. [happy](http://www.haskell.org/happy/) or
47− [alex](http://www.haskell.org/alex/)).
48−
49−There are some additional important constraints on a realistic
50−library: it must fit well into a highly concurrent networked world
51−full of unreliable, hostile and incompetent clients.
52−
53−* High concurrency levels demand a low per-connection memory
54− footprint.
55−
56−* The need to cope with poorly behaved clients requires that
57− applications must be able to throttle connections that are too busy,
58− or kill connections that are too slow or attempting to consume too
59− many server resources. A good parsing library will not get in the
60− way of these needs.
61−
62−A few years ago, I made a few half-hearted attempts to write a
63−specialised version of Parsec, which I eventually named
64−[Attoparsec](http://hackage.haskell.org/package/attoparsec).
65−
66−I began with a stripped-down Parsec that was specialised to accept
67−`ByteString` input. I then extended the API to allow a parser to
68−consume small chunks of input at a time.
69−
70−Because I wasn't using Attoparsec "in anger" at the time, I made sure
71−that my library worked (more or less), but I was not measuring its
72−performance.
73−
74−In late January of this year, I began to think about using Attoparsec
75−as the parser for a simple HTTP server that I could use to benchmark
76−our new GHC I/O manager code. Clearly, I'd want the parser to perform
77−well, or it would distort my numbers rather badly.
78−
79−By coincidence, [John MacFarlane](http://johnmacfarlane.net/) emailed
80−me around the same time, with disturbing findings: he'd tried
81−Attoparsec, and found its performance to be *terrible*! In fact, it
82−was 4 to 20 times _slower_ than plain Parsec with his experimental
83−parser and test data. Clearly, I had some hard work to look forward
84−to.
85−
86−Happily, that work is now almost complete, and I am pleased with the
87−results. In the next post, I'll have some details of what this all
88−entails.
examples/Atto_RFC2616.hsdeleted−45
@@ -1,45 +0,0 @@
1−{-# LANGUAGE BangPatterns #-}
2−
3−module Main (main) where
4−
5−import Control.Applicative
6−import Control.Exception (bracket)
7−import Control.Monad (forM_)
8−import Data.Attoparsec.ByteString
9−import RFC2616
10−import System.Environment
11−import System.IO
12−import qualified Data.ByteString.Char8 as B
13−
14−refill :: Handle -> IO B.ByteString
15−refill h = B.hGet h (80*1024)
16−
17−listy :: FilePath -> Handle -> IO ()
18−listy file h = do
19− r <- parseWith (refill h) (many request) =<< refill h
20− case r of
21− Fail _ _ msg -> hPutStrLn stderr $ file ++ ": " ++ msg
22− Done _ reqs -> print (length reqs)
23−
24−incrementy :: FilePath -> Handle -> IO ()
25−incrementy file h = go (0::Int) =<< refill h
26− where
27− go !n is = do
28− r <- parseWith (refill h) request is
29− case r of
30− Fail _ _ msg -> hPutStrLn stderr $ file ++ ": " ++ msg
31− Done bs _req
32− | B.null bs -> do
33− s <- refill h
34− if B.null s
35− then print (n+1)
36− else go (n+1) s
37− | otherwise -> go (n+1) bs
38−
39−main :: IO ()
40−main = do
41− args <- getArgs
42− forM_ args $ \arg ->
43− bracket (openFile arg ReadMode) hClose $
44− -- listy arg
45− incrementy arg
examples/Makefiledeleted−19
@@ -1,19 +0,0 @@
1−CC := cc
2−CFLAGS := -O3 -Wall
3−# To make the code about 6% faster:
4−# CFLAGS += -fwhole-program --combine
5−CPPFLAGS := -I$(HOME)/hg/http-parser
6−
7−all: c-http
8−
9−c-http: rfc2616.c http_parser.c
10− $(CC) $(CFLAGS) $(CPPFLAGS) -o $@ $^
11−
12−clean:
13− rm -f *.hi *.o c-http
14−
15−http_parser.c: http_parser.h
16− curl -O https://raw.githubusercontent.com/joyent/http-parser/master/http_parser.c
17−
18−http_parser.h:
19− curl -O https://raw.githubusercontent.com/joyent/http-parser/master/http_parser.h
examples/Parsec_RFC2616.hsdeleted−88
@@ -1,88 +0,0 @@
1−{-# LANGUAGE BangPatterns, CPP, FlexibleContexts #-}
2−
3−module Main (main) where
4−
5−import Control.Applicative
6−import Control.Exception (bracket)
7−import System.Environment (getArgs)
8−import System.IO (hClose, openFile, IOMode(ReadMode))
9−import Text.Parsec.Char (anyChar, char, satisfy, string)
10−import Text.Parsec.Combinator (many1, manyTill, skipMany1)
11−import Text.Parsec.Prim hiding (many, token, (<|>))
12−import qualified Data.IntSet as S
13−
14−#if 1
15−import Text.Parsec.ByteString.Lazy (Parser, parseFromFile)
16−import qualified Data.ByteString.Lazy as B
17−#else
18−import Text.Parsec.ByteString (Parser, parseFromFile)
19−import qualified Data.ByteString as B
20−#endif
21−
22−token :: Stream s m Char => ParsecT s u m Char
23−token = satisfy $ \c -> S.notMember (fromEnum c) set
24− where set = S.fromList . map fromEnum $ ['\0'..'\31'] ++ "()<>@,;:\\\"/[]?={} \t" ++ ['\128'..'\255']
25−
26−isHorizontalSpace :: Char -> Bool
27−isHorizontalSpace c = c == ' ' || c == '\t'
28−
29−skipHSpaces :: Stream s m Char => ParsecT s u m ()
30−skipHSpaces = skipMany1 (satisfy isHorizontalSpace)
31−
32−data Request = Request {
33− _requestMethod :: String
34− , _requestUri :: String
35− , _requestProtocol :: String
36− } deriving (Eq, Ord, Show)
37−
38−requestLine :: Stream s m Char => ParsecT s u m Request
39−requestLine = do
40− method <- many1 token <* skipHSpaces
41− uri <- many1 (satisfy (not . isHorizontalSpace)) <* skipHSpaces <* string "HTTP/"
42− proto <- many httpVersion <* endOfLine
43− return $! Request method uri proto
44− where
45− httpVersion = satisfy $ \c -> c == '1' || c == '0' || c == '.'
46−
47−endOfLine :: Stream s m Char => ParsecT s u m ()
48−endOfLine = (string "\r\n" *> pure ()) <|> (char '\n' *> pure ())
49−
50−data Header = Header {
51− _headerName :: String
52− , _headerValue :: [String]
53− } deriving (Eq, Ord, Show)
54−
55−messageHeader :: Stream s m Char => ParsecT s u m Header
56−messageHeader = do
57− header <- many1 token <* char ':' <* skipHSpaces
58− body <- manyTill anyChar endOfLine
59− conts <- many $ skipHSpaces *> manyTill anyChar endOfLine
60− return $! Header header (body:conts)
61−
62−request :: Stream s m Char => ParsecT s u m (Request, [Header])
63−request = (,) <$> requestLine <*> many messageHeader <* endOfLine
64−
65−listy :: FilePath -> IO ()
66−listy arg = do
67− r <- parseFromFile (many request) arg
68− case r of
69− Left err -> putStrLn $ arg ++ ": " ++ show err
70− Right rs -> print (length rs)
71−
72−chunky :: FilePath -> IO ()
73−chunky arg = bracket (openFile arg ReadMode) hClose $ \h ->
74− loop (0::Int) =<< B.hGetContents h
75− where
76− loop !n bs
77− | B.null bs = print n
78− | otherwise = case parse myReq arg bs of
79− Left err -> putStrLn $ arg ++ ": " ++ show err
80− Right (r,bs') -> loop (n+1) bs'
81− myReq :: Parser ((Request, [Header]), B.ByteString)
82− myReq = liftA2 (,) request getInput
83−
84−main :: IO ()
85−main = mapM_ f =<< getArgs
86− where
87− --f = listy
88− f = chunky
examples/RFC2616.hsdeleted−65
@@ -1,65 +0,0 @@
1−{-# LANGUAGE OverloadedStrings #-}
2−
3−module RFC2616
4− (
5− Header(..)
6− , Request(..)
7− , Response(..)
8− , request
9− , response
10− ) where
11−
12−import Control.Applicative
13−import Data.Attoparsec.ByteString as P
14−import Data.Attoparsec.ByteString.Char8 (char8, endOfLine, isDigit_w8)
15−import Data.ByteString (ByteString)
16−import Data.Word (Word8)
17−import Data.Attoparsec.ByteString.Char8 (isEndOfLine, isHorizontalSpace)
18−
19−isToken :: Word8 -> Bool
20−isToken w = w <= 127 && notInClass "\0-\31()<>@,;:\\\"/[]?={} \t" w
21−
22−skipSpaces :: Parser ()
23−skipSpaces = satisfy isHorizontalSpace *> skipWhile isHorizontalSpace
24−
25−data Request = Request {
26− requestMethod :: ByteString
27− , requestUri :: ByteString
28− , requestVersion :: ByteString
29− } deriving (Eq, Ord, Show)
30−
31−httpVersion :: Parser ByteString
32−httpVersion = "HTTP/" *> P.takeWhile (\c -> isDigit_w8 c || c == 46)
33−
34−requestLine :: Parser Request
35−requestLine = Request <$> (takeWhile1 isToken <* char8 ' ')
36− <*> (takeWhile1 (/=32) <* char8 ' ')
37− <*> (httpVersion <* endOfLine)
38−
39−data Header = Header {
40− headerName :: ByteString
41− , headerValue :: [ByteString]
42− } deriving (Eq, Ord, Show)
43−
44−messageHeader :: Parser Header
45−messageHeader = Header
46− <$> (P.takeWhile isToken <* char8 ':' <* skipWhile isHorizontalSpace)
47− <*> ((:) <$> (takeTill isEndOfLine <* endOfLine)
48− <*> (many $ skipSpaces *> takeTill isEndOfLine <* endOfLine))
49−
50−request :: Parser (Request, [Header])
51−request = (,) <$> requestLine <*> many messageHeader <* endOfLine
52−
53−data Response = Response {
54− responseVersion :: ByteString
55− , responseCode :: ByteString
56− , responseMsg :: ByteString
57− } deriving (Eq, Ord, Show)
58−
59−responseLine :: Parser Response
60−responseLine = Response <$> (httpVersion <* char8 ' ')
61− <*> (P.takeWhile isDigit_w8 <* char8 ' ')
62− <*> (takeTill isEndOfLine <* endOfLine)
63−
64−response :: Parser (Response, [Header])
65−response = (,) <$> responseLine <*> many messageHeader <* endOfLine
examples/attoparsec-examples.cabaldeleted−31
@@ -1,31 +0,0 @@
1−-- These examples are not intended to be installed.
2−-- So don't install 'em.
3−
4−name: attoparsec-examples
5−version: 0
6−cabal-version: >=1.6
7−build-type: Simple
8−
9−executable atto-rfc2616
10− main-is: Atto_RFC2616.hs
11− hs-source-dirs: .. .
12− ghc-options: -O2 -Wall -rtsopts
13− build-depends:
14− array,
15− base == 4.*,
16− bytestring >= 0.10.4.0,
17− deepseq >= 1.1,
18− scientific >= 0.3.1,
19− text >= 1.1.1.0
20−
21−executable parsec-rfc2616
22− main-is: Parsec_RFC2616.hs
23− hs-source-dirs: .
24− ghc-options: -O2 -Wall -rtsopts
25− build-depends:
26− array,
27− base == 4.*,
28− containers,
29− bytestring >= 0.10.4.0,
30− parsec,
31− text >= 1.1.1.0
examples/http-requests.txtdeleted−494
@@ -1,494 +0,0 @@
1−GET / HTTP/1.1
2−Host: www.reddit.com
3−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
4−Accept: text/html,application/xhtml+xml,application/xml;q=0.9,*/*;q=0.8
5−Accept-Language: en-us,en;q=0.5
6−Accept-Encoding: gzip, deflate
7−Connection: keep-alive
8−
9−GET /reddit.v_EZwRzV-Ns.css HTTP/1.1
10−Host: www.redditstatic.com
11−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
12−Accept: text/css,*/*;q=0.1
13−Accept-Language: en-us,en;q=0.5
14−Accept-Encoding: gzip, deflate
15−Connection: keep-alive
16−Referer: http://www.reddit.com/
17−
18−GET /reddit-init.en-us.O1zuMqOOQvY.js HTTP/1.1
19−Host: www.redditstatic.com
20−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
21−Accept: */*
22−Accept-Language: en-us,en;q=0.5
23−Accept-Encoding: gzip, deflate
24−Connection: keep-alive
25−Referer: http://www.reddit.com/
26−
27−GET /reddit.en-us.31yAfSoTsfo.js HTTP/1.1
28−Host: www.redditstatic.com
29−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
30−Accept: */*
31−Accept-Language: en-us,en;q=0.5
32−Accept-Encoding: gzip, deflate
33−Connection: keep-alive
34−Referer: http://www.reddit.com/
35−
36−GET /kill.png HTTP/1.1
37−Host: www.redditstatic.com
38−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
39−Accept: image/png,image/*;q=0.8,*/*;q=0.5
40−Accept-Language: en-us,en;q=0.5
41−Accept-Encoding: gzip, deflate
42−Connection: keep-alive
43−Referer: http://www.reddit.com/
44−
45−GET /icon.png HTTP/1.1
46−Host: www.redditstatic.com
47−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
48−Accept: text/html,application/xhtml+xml,application/xml;q=0.9,*/*;q=0.8
49−Accept-Language: en-us,en;q=0.5
50−Accept-Encoding: gzip, deflate
51−Connection: keep-alive
52−
53−GET /favicon.ico HTTP/1.1
54−Host: www.redditstatic.com
55−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
56−Accept: text/html,application/xhtml+xml,application/xml;q=0.9,*/*;q=0.8
57−Accept-Language: en-us,en;q=0.5
58−Accept-Encoding: gzip, deflate
59−Connection: keep-alive
60−
61−GET /AMZM4CWd6zstSC8y.jpg HTTP/1.1
62−Host: b.thumbs.redditmedia.com
63−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
64−Accept: image/png,image/*;q=0.8,*/*;q=0.5
65−Accept-Language: en-us,en;q=0.5
66−Accept-Encoding: gzip, deflate
67−Connection: keep-alive
68−Referer: http://www.reddit.com/
69−
70−GET /jz1d5Nm0w97-YyNm.jpg HTTP/1.1
71−Host: b.thumbs.redditmedia.com
72−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
73−Accept: image/png,image/*;q=0.8,*/*;q=0.5
74−Accept-Language: en-us,en;q=0.5
75−Accept-Encoding: gzip, deflate
76−Connection: keep-alive
77−Referer: http://www.reddit.com/
78−
79−GET /aWGO99I6yOcNUKXB.jpg HTTP/1.1
80−Host: a.thumbs.redditmedia.com
81−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
82−Accept: image/png,image/*;q=0.8,*/*;q=0.5
83−Accept-Language: en-us,en;q=0.5
84−Accept-Encoding: gzip, deflate
85−Connection: keep-alive
86−Referer: http://www.reddit.com/
87−
88−GET /rZ_rD5TjrJM0E9Aj.css HTTP/1.1
89−Host: e.thumbs.redditmedia.com
90−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
91−Accept: text/css,*/*;q=0.1
92−Accept-Language: en-us,en;q=0.5
93−Accept-Encoding: gzip, deflate
94−Connection: keep-alive
95−Referer: http://www.reddit.com/
96−
97−GET /tmsPwagFzyTvrGRx.jpg HTTP/1.1
98−Host: a.thumbs.redditmedia.com
99−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
100−Accept: image/png,image/*;q=0.8,*/*;q=0.5
101−Accept-Language: en-us,en;q=0.5
102−Accept-Encoding: gzip, deflate
103−Connection: keep-alive
104−Referer: http://www.reddit.com/
105−
106−GET /KYgUaLvXCK3TCEJx.jpg HTTP/1.1
107−Host: a.thumbs.redditmedia.com
108−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
109−Accept: image/png,image/*;q=0.8,*/*;q=0.5
110−Accept-Language: en-us,en;q=0.5
111−Accept-Encoding: gzip, deflate
112−Connection: keep-alive
113−Referer: http://www.reddit.com/
114−
115−GET /81pzxT5x2ozuEaxX.jpg HTTP/1.1
116−Host: e.thumbs.redditmedia.com
117−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
118−Accept: image/png,image/*;q=0.8,*/*;q=0.5
119−Accept-Language: en-us,en;q=0.5
120−Accept-Encoding: gzip, deflate
121−Connection: keep-alive
122−Referer: http://www.reddit.com/
123−
124−GET /MFqCUiUVPO5V8t6x.jpg HTTP/1.1
125−Host: a.thumbs.redditmedia.com
126−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
127−Accept: image/png,image/*;q=0.8,*/*;q=0.5
128−Accept-Language: en-us,en;q=0.5
129−Accept-Encoding: gzip, deflate
130−Connection: keep-alive
131−Referer: http://www.reddit.com/
132−
133−GET /TFpYTiAO5aEowokv.jpg HTTP/1.1
134−Host: e.thumbs.redditmedia.com
135−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
136−Accept: image/png,image/*;q=0.8,*/*;q=0.5
137−Accept-Language: en-us,en;q=0.5
138−Accept-Encoding: gzip, deflate
139−Connection: keep-alive
140−Referer: http://www.reddit.com/
141−
142−GET /eMWMpmm9APNeNqcF.jpg HTTP/1.1
143−Host: e.thumbs.redditmedia.com
144−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
145−Accept: image/png,image/*;q=0.8,*/*;q=0.5
146−Accept-Language: en-us,en;q=0.5
147−Accept-Encoding: gzip, deflate
148−Connection: keep-alive
149−Referer: http://www.reddit.com/
150−
151−GET /S-IpsJrOKuaK9GZ8.jpg HTTP/1.1
152−Host: c.thumbs.redditmedia.com
153−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
154−Accept: image/png,image/*;q=0.8,*/*;q=0.5
155−Accept-Language: en-us,en;q=0.5
156−Accept-Encoding: gzip, deflate
157−Connection: keep-alive
158−Referer: http://www.reddit.com/
159−
160−GET /3V6dj9PDsNnheDXn.jpg HTTP/1.1
161−Host: c.thumbs.redditmedia.com
162−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
163−Accept: image/png,image/*;q=0.8,*/*;q=0.5
164−Accept-Language: en-us,en;q=0.5
165−Accept-Encoding: gzip, deflate
166−Connection: keep-alive
167−Referer: http://www.reddit.com/
168−
169−GET /wQ3-VmNXhv8sg4SJ.jpg HTTP/1.1
170−Host: c.thumbs.redditmedia.com
171−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
172−Accept: image/png,image/*;q=0.8,*/*;q=0.5
173−Accept-Language: en-us,en;q=0.5
174−Accept-Encoding: gzip, deflate
175−Connection: keep-alive
176−Referer: http://www.reddit.com/
177−
178−GET /ixd1C1njpczEWC22.jpg HTTP/1.1
179−Host: c.thumbs.redditmedia.com
180−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
181−Accept: image/png,image/*;q=0.8,*/*;q=0.5
182−Accept-Language: en-us,en;q=0.5
183−Accept-Encoding: gzip, deflate
184−Connection: keep-alive
185−Referer: http://www.reddit.com/
186−
187−GET /nGsQj15VyOHMwmq8.jpg HTTP/1.1
188−Host: c.thumbs.redditmedia.com
189−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
190−Accept: image/png,image/*;q=0.8,*/*;q=0.5
191−Accept-Language: en-us,en;q=0.5
192−Accept-Encoding: gzip, deflate
193−Connection: keep-alive
194−Referer: http://www.reddit.com/
195−
196−GET /zT4yQmDxQLbIxK1b.jpg HTTP/1.1
197−Host: c.thumbs.redditmedia.com
198−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
199−Accept: image/png,image/*;q=0.8,*/*;q=0.5
200−Accept-Language: en-us,en;q=0.5
201−Accept-Encoding: gzip, deflate
202−Connection: keep-alive
203−Referer: http://www.reddit.com/
204−
205−GET /L5e1HcZLv1iu4nrG.jpg HTTP/1.1
206−Host: f.thumbs.redditmedia.com
207−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
208−Accept: image/png,image/*;q=0.8,*/*;q=0.5
209−Accept-Language: en-us,en;q=0.5
210−Accept-Encoding: gzip, deflate
211−Connection: keep-alive
212−Referer: http://www.reddit.com/
213−
214−GET /WJFFPxD8X4JO_lIG.jpg HTTP/1.1
215−Host: f.thumbs.redditmedia.com
216−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
217−Accept: image/png,image/*;q=0.8,*/*;q=0.5
218−Accept-Language: en-us,en;q=0.5
219−Accept-Encoding: gzip, deflate
220−Connection: keep-alive
221−Referer: http://www.reddit.com/
222−
223−GET /hVMVTDdjuY3bQox5.jpg HTTP/1.1
224−Host: f.thumbs.redditmedia.com
225−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
226−Accept: image/png,image/*;q=0.8,*/*;q=0.5
227−Accept-Language: en-us,en;q=0.5
228−Accept-Encoding: gzip, deflate
229−Connection: keep-alive
230−Referer: http://www.reddit.com/
231−
232−GET /rnWf8CjBcyPQs5y_.jpg HTTP/1.1
233−Host: f.thumbs.redditmedia.com
234−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
235−Accept: image/png,image/*;q=0.8,*/*;q=0.5
236−Accept-Language: en-us,en;q=0.5
237−Accept-Encoding: gzip, deflate
238−Connection: keep-alive
239−Referer: http://www.reddit.com/
240−
241−GET /gZJL1jNylKbGV4d-.jpg HTTP/1.1
242−Host: d.thumbs.redditmedia.com
243−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
244−Accept: image/png,image/*;q=0.8,*/*;q=0.5
245−Accept-Language: en-us,en;q=0.5
246−Accept-Encoding: gzip, deflate
247−Connection: keep-alive
248−Referer: http://www.reddit.com/
249−
250−GET /aNd2zNRLXiMnKUFh.jpg HTTP/1.1
251−Host: c.thumbs.redditmedia.com
252−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
253−Accept: image/png,image/*;q=0.8,*/*;q=0.5
254−Accept-Language: en-us,en;q=0.5
255−Accept-Encoding: gzip, deflate
256−Connection: keep-alive
257−Referer: http://www.reddit.com/
258−
259−GET /droparrowgray.gif HTTP/1.1
260−Host: www.redditstatic.com
261−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
262−Accept: image/png,image/*;q=0.8,*/*;q=0.5
263−Accept-Language: en-us,en;q=0.5
264−Accept-Encoding: gzip, deflate
265−Connection: keep-alive
266−Referer: http://www.redditstatic.com/reddit.v_EZwRzV-Ns.css
267−
268−GET /sprite-reddit.an0Lnf61Ap4.png HTTP/1.1
269−Host: www.redditstatic.com
270−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
271−Accept: image/png,image/*;q=0.8,*/*;q=0.5
272−Accept-Language: en-us,en;q=0.5
273−Accept-Encoding: gzip, deflate
274−Connection: keep-alive
275−Referer: http://www.redditstatic.com/reddit.v_EZwRzV-Ns.css
276−
277−GET /ga.js HTTP/1.1
278−Host: www.google-analytics.com
279−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
280−Accept: */*
281−Accept-Language: en-us,en;q=0.5
282−Accept-Encoding: gzip, deflate
283−Connection: keep-alive
284−Referer: http://www.reddit.com/
285−If-Modified-Since: Tue, 29 Oct 2013 19:33:51 GMT
286−
287−GET /reddit/ads.html?sr=-reddit.com&bust2 HTTP/1.1
288−Host: static.adzerk.net
289−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
290−Accept: text/html,application/xhtml+xml,application/xml;q=0.9,*/*;q=0.8
291−Accept-Language: en-us,en;q=0.5
292−Accept-Encoding: gzip, deflate
293−Connection: keep-alive
294−Referer: http://www.reddit.com/
295−
296−GET /pixel/of_destiny.png?v=hOlmDALJCWWdjzfBV4ZxJPmrdCLWB%2Ftq7Z%2Ffp4Q%2FxXbVPPREuMJMVGzKraTuhhNWxCCwi6yFEZg%3D&r=783333388 HTTP/1.1
297−Host: pixel.redditmedia.com
298−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
299−Accept: image/png,image/*;q=0.8,*/*;q=0.5
300−Accept-Language: en-us,en;q=0.5
301−Accept-Encoding: gzip, deflate
302−Connection: keep-alive
303−Referer: http://www.reddit.com/
304−
305−GET /UNcO-h_QcS9PD-Gn.jpg HTTP/1.1
306−Host: c.thumbs.redditmedia.com
307−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
308−Accept: image/png,image/*;q=0.8,*/*;q=0.5
309−Accept-Language: en-us,en;q=0.5
310−Accept-Encoding: gzip, deflate
311−Connection: keep-alive
312−Referer: http://e.thumbs.redditmedia.com/rZ_rD5TjrJM0E9Aj.css
313−
314−GET /welcome-lines.png HTTP/1.1
315−Host: www.redditstatic.com
316−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
317−Accept: image/png,image/*;q=0.8,*/*;q=0.5
318−Accept-Language: en-us,en;q=0.5
319−Accept-Encoding: gzip, deflate
320−Connection: keep-alive
321−Referer: http://www.redditstatic.com/reddit.v_EZwRzV-Ns.css
322−
323−GET /welcome-upvote.png HTTP/1.1
324−Host: www.redditstatic.com
325−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
326−Accept: image/png,image/*;q=0.8,*/*;q=0.5
327−Accept-Language: en-us,en;q=0.5
328−Accept-Encoding: gzip, deflate
329−Connection: keep-alive
330−Referer: http://www.redditstatic.com/reddit.v_EZwRzV-Ns.css
331−
332−GET /__utm.gif?utmwv=5.5.1&utms=1&utmn=720496082&utmhn=www.reddit.com&utme=8(site*srpath*usertype*uitype)9(%20reddit.com*%20reddit.com-GET_listing*guest*web)11(3!2)&utmcs=UTF-8&utmsr=2560x1600&utmvp=1288x792&utmsc=24-bit&utmul=en-us&utmje=1&utmfl=13.0%20r0&utmdt=reddit%3A%20the%20front%20page%20of%20the%20internet&utmhid=2129416330&utmr=-&utmp=%2F&utmht=1400862512705&utmac=UA-12131688-1&utmcc=__utma%3D55650728.585571751.1400862513.1400862513.1400862513.1%3B%2B__utmz%3D55650728.1400862513.1.1.utmcsr%3D(direct)%7Cutmccn%3D(direct)%7Cutmcmd%3D(none)%3B&utmu=qR~ HTTP/1.1
333−Host: www.google-analytics.com
334−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
335−Accept: image/png,image/*;q=0.8,*/*;q=0.5
336−Accept-Language: en-us,en;q=0.5
337−Accept-Encoding: gzip, deflate
338−Connection: keep-alive
339−Referer: http://www.reddit.com/
340−
341−GET /ImnpOQhbXUPkwceN.png HTTP/1.1
342−Host: a.thumbs.redditmedia.com
343−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
344−Accept: image/png,image/*;q=0.8,*/*;q=0.5
345−Accept-Language: en-us,en;q=0.5
346−Accept-Encoding: gzip, deflate
347−Connection: keep-alive
348−Referer: http://www.reddit.com/
349−
350−GET /ajax/libs/jquery/1.7.1/jquery.min.js HTTP/1.1
351−Host: ajax.googleapis.com
352−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
353−Accept: */*
354−Accept-Language: en-us,en;q=0.5
355−Accept-Encoding: gzip, deflate
356−Connection: keep-alive
357−Referer: http://static.adzerk.net/reddit/ads.html?sr=-reddit.com&bust2
358−
359−GET /__utm.gif?utmwv=5.5.1&utms=2&utmn=1493472678&utmhn=www.reddit.com&utmt=event&utme=5(AdBlock*enabled*false)(0)8(site*srpath*usertype*uitype)9(%20reddit.com*%20reddit.com-GET_listing*guest*web)11(3!2)&utmcs=UTF-8&utmsr=2560x1600&utmvp=1288x792&utmsc=24-bit&utmul=en-us&utmje=1&utmfl=13.0%20r0&utmdt=reddit%3A%20the%20front%20page%20of%20the%20internet&utmhid=2129416330&utmr=-&utmp=%2F&utmht=1400862512708&utmac=UA-12131688-1&utmni=1&utmcc=__utma%3D55650728.585571751.1400862513.1400862513.1400862513.1%3B%2B__utmz%3D55650728.1400862513.1.1.utmcsr%3D(direct)%7Cutmccn%3D(direct)%7Cutmcmd%3D(none)%3B&utmu=6R~ HTTP/1.1
360−Host: www.google-analytics.com
361−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
362−Accept: image/png,image/*;q=0.8,*/*;q=0.5
363−Accept-Language: en-us,en;q=0.5
364−Accept-Encoding: gzip, deflate
365−Connection: keep-alive
366−Referer: http://www.reddit.com/
367−
368−GET /ados.js?q=43 HTTP/1.1
369−Host: secure.adzerk.net
370−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
371−Accept: */*
372−Accept-Language: en-us,en;q=0.5
373−Accept-Encoding: gzip, deflate
374−Connection: keep-alive
375−Referer: http://static.adzerk.net/reddit/ads.html?sr=-reddit.com&bust2
376−
377−GET /fetch-trackers?callback=jQuery111005268222517967478_1400862512407&ids%5B%5D=t3_25jzeq-t8_k2ii&_=1400862512408 HTTP/1.1
378−Host: tracker.redditmedia.com
379−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
380−Accept: */*
381−Accept-Language: en-us,en;q=0.5
382−Accept-Encoding: gzip, deflate
383−Connection: keep-alive
384−Referer: http://www.reddit.com/
385−
386−GET /ados?t=1400862512892&request={%22Placements%22:[{%22A%22:5146,%22S%22:24950,%22D%22:%22main%22,%22AT%22:5},{%22A%22:5146,%22S%22:24950,%22D%22:%22sponsorship%22,%22AT%22:8}],%22Keywords%22:%22-reddit.com%22,%22Referrer%22:%22http%3A%2F%2Fwww.reddit.com%2F%22,%22IsAsync%22:true,%22WriteResults%22:true} HTTP/1.1
387−Host: engine.adzerk.net
388−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
389−Accept: */*
390−Accept-Language: en-us,en;q=0.5
391−Accept-Encoding: gzip, deflate
392−Connection: keep-alive
393−Referer: http://static.adzerk.net/reddit/ads.html?sr=-reddit.com&bust2
394−
395−GET /pixel/of_doom.png?id=t3_25jzeq-t8_k2ii&hash=da31d967485cdbd459ce1e9a5dde279fef7fc381&r=1738649500 HTTP/1.1
396−Host: pixel.redditmedia.com
397−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
398−Accept: image/png,image/*;q=0.8,*/*;q=0.5
399−Accept-Language: en-us,en;q=0.5
400−Accept-Encoding: gzip, deflate
401−Connection: keep-alive
402−Referer: http://www.reddit.com/
403−
404−GET /Extensions/adFeedback.js HTTP/1.1
405−Host: static.adzrk.net
406−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
407−Accept: */*
408−Accept-Language: en-us,en;q=0.5
409−Accept-Encoding: gzip, deflate
410−Connection: keep-alive
411−Referer: http://static.adzerk.net/reddit/ads.html?sr=-reddit.com&bust2
412−
413−GET /Extensions/adFeedback.css HTTP/1.1
414−Host: static.adzrk.net
415−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
416−Accept: text/css,*/*;q=0.1
417−Accept-Language: en-us,en;q=0.5
418−Accept-Encoding: gzip, deflate
419−Connection: keep-alive
420−Referer: http://static.adzerk.net/reddit/ads.html?sr=-reddit.com&bust2
421−
422−GET /reddit/ads-load.html?bust2 HTTP/1.1
423−Host: static.adzerk.net
424−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
425−Accept: text/html,application/xhtml+xml,application/xml;q=0.9,*/*;q=0.8
426−Accept-Language: en-us,en;q=0.5
427−Accept-Encoding: gzip, deflate
428−Connection: keep-alive
429−Referer: http://www.reddit.com/
430−
431−GET /Advertisers/a774d7d6148046efa89403a8db635a81.jpg HTTP/1.1
432−Host: static.adzerk.net
433−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
434−Accept: image/png,image/*;q=0.8,*/*;q=0.5
435−Accept-Language: en-us,en;q=0.5
436−Accept-Encoding: gzip, deflate
437−Connection: keep-alive
438−Referer: http://static.adzerk.net/reddit/ads.html?sr=-reddit.com&bust2
439−
440−GET /i.gif?e=eyJhdiI6NjIzNTcsImF0Ijo1LCJjbSI6MTE2MzUxLCJjaCI6Nzk4NCwiY3IiOjMzNzAxNSwiZGkiOiI4NmI2Y2UzYWM5NDM0MjhkOTk2ZTg4MjYwZDE5ZTE1YyIsImRtIjoxLCJmYyI6NDE2MTI4LCJmbCI6MjEwNDY0LCJrdyI6Ii1yZWRkaXQuY29tIiwibWsiOiItcmVkZGl0LmNvbSIsIm53Ijo1MTQ2LCJwYyI6MCwicHIiOjIwMzYyLCJydCI6MSwicmYiOiJodHRwOi8vd3d3LnJlZGRpdC5jb20vIiwic3QiOjI0OTUwLCJ1ayI6InVlMS01ZWIwOGFlZWQ5YTc0MDFjOTE5NWNiOTMzZWI3Yzk2NiIsInRzIjoxNDAwODYyNTkzNjQ1fQ&s=lwlbFf2Uywt7zVBFRj_qXXu7msY HTTP/1.1
441−Host: engine.adzerk.net
442−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
443−Accept: image/png,image/*;q=0.8,*/*;q=0.5
444−Accept-Language: en-us,en;q=0.5
445−Accept-Encoding: gzip, deflate
446−Connection: keep-alive
447−Referer: http://static.adzerk.net/reddit/ads.html?sr=-reddit.com&bust2
448−Cookie: azk=ue1-5eb08aeed9a7401c9195cb933eb7c966
449−
450−GET /BurstingPipe/adServer.bs?cn=tf&c=19&mc=imp&pli=9994987&PluID=0&ord=1400862593644&rtu=-1 HTTP/1.1
451−Host: bs.serving-sys.com
452−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
453−Accept: image/png,image/*;q=0.8,*/*;q=0.5
454−Accept-Language: en-us,en;q=0.5
455−Accept-Encoding: gzip, deflate
456−Connection: keep-alive
457−Referer: http://static.adzerk.net/reddit/ads.html?sr=-reddit.com&bust2
458−
459−GET /Advertisers/63cfd0044ffd49c0a71a6626f7a1d8f0.jpg HTTP/1.1
460−Host: static.adzerk.net
461−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
462−Accept: image/png,image/*;q=0.8,*/*;q=0.5
463−Accept-Language: en-us,en;q=0.5
464−Accept-Encoding: gzip, deflate
465−Connection: keep-alive
466−Referer: http://static.adzerk.net/reddit/ads-load.html?bust2
467−
468−GET /BurstingPipe/adServer.bs?cn=tf&c=19&mc=imp&pli=9962555&PluID=0&ord=1400862593645&rtu=-1 HTTP/1.1
469−Host: bs.serving-sys.com
470−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
471−Accept: image/png,image/*;q=0.8,*/*;q=0.5
472−Accept-Language: en-us,en;q=0.5
473−Accept-Encoding: gzip, deflate
474−Connection: keep-alive
475−Referer: http://static.adzerk.net/reddit/ads-load.html?bust2
476−Cookie: S_9994987=6754579095859875029; A4=01fmFvgRnI09SF00000; u2=d1263d39-874b-4a89-86cd-a2ab0860ed4e3Zl040
477−
478−GET /i.gif?e=eyJhdiI6NjIzNTcsImF0Ijo4LCJjbSI6MTE2MzUxLCJjaCI6Nzk4NCwiY3IiOjMzNzAxOCwiZGkiOiI3OTdlZjU3OWQ5NjE0ODdiODYyMGMyMGJkOTE4YzNiMSIsImRtIjoxLCJmYyI6NDE2MTMxLCJmbCI6MjEwNDY0LCJrdyI6Ii1yZWRkaXQuY29tIiwibWsiOiItcmVkZGl0LmNvbSIsIm53Ijo1MTQ2LCJwYyI6MCwicHIiOjIwMzYyLCJydCI6MSwicmYiOiJodHRwOi8vd3d3LnJlZGRpdC5jb20vIiwic3QiOjI0OTUwLCJ1ayI6InVlMS01ZWIwOGFlZWQ5YTc0MDFjOTE5NWNiOTMzZWI3Yzk2NiIsInRzIjoxNDAwODYyNTkzNjQ2fQ&s=OjzxzXAgQksbdQOHNm-bjZcnZPA HTTP/1.1
479−Host: engine.adzerk.net
480−User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.8; rv:15.0) Gecko/20100101 Firefox/15.0.1
481−Accept: image/png,image/*;q=0.8,*/*;q=0.5
482−Accept-Language: en-us,en;q=0.5
483−Accept-Encoding: gzip, deflate
484−Connection: keep-alive
485−Referer: http://static.adzerk.net/reddit/ads-load.html?bust2
486−Cookie: azk=ue1-5eb08aeed9a7401c9195cb933eb7c966
487−
488−GET /subscribe?host_int=1042356184&ns_map=571794054_374233948806,464381511_13349283399&user_id=245722467&nid=1399334269710011966&ts=1400862514 HTTP/1.1
489−Host: notify8.dropbox.com
490−Accept-Encoding: identity
491−Connection: keep-alive
492−X-Dropbox-Locale: en_US
493−User-Agent: DropboxDesktopClient/2.7.54 (Macintosh; 10.8; ('i32',); en_US)
494−
examples/rfc2616.cdeleted−244
@@ -1,244 +0,0 @@
1−/*
2− * This is a simple driver for the http-parser package. It is
3− * intended to read one HTTP request after another from a file,
4− * nothing more.
5− *
6− * For "feature parity" with the Haskell code in RFC2616.hs, we
7− * allocate and populate a simple structure describing each request,
8− * since that's the sort of thing that many real applications would
9− * themselves do and the library doesn't do this for us.
10− *
11− * For the http-parser source, see
12− * https://github.com/joyent/http-parser/blob/master/http_parser.c
13− */
14−
15−/*
16− * Turn off this preprocessor symbol to have the callbacks do nothing
17− * at all, which "improves performance" by about 50%.
18− */
19−/*#define LOOK_BUSY*/
20−
21−#include <assert.h>
22−#include <fcntl.h>
23−#include <stdio.h>
24−#include <stdlib.h>
25−#include <string.h>
26−#include <sys/stat.h>
27−#include <sys/types.h>
28−#include <unistd.h>
29−
30−#include "http_parser.h"
31−
32−struct http_string {
33− size_t len;
34− char value[0];
35−};
36−
37−struct http_header {
38− struct http_string *name;
39− struct http_string *value;
40− struct http_header *next;
41−};
42−
43−struct http_request {
44− struct http_string *method;
45− struct http_string *uri;
46− struct http_header *headers, *last;
47−};
48−
49−struct data {
50− size_t count;
51− struct http_request req;
52−};
53−
54−static void *xmalloc(size_t size)
55−{
56− void *ptr;
57−
58− if ((ptr = malloc(size)) == NULL) {
59− perror("malloc");
60− exit(1);
61− }
62−
63− return ptr;
64−}
65−
66−static struct http_string *xstrdup(const char *src, size_t len, size_t extra)
67−{
68− struct http_string *dst = xmalloc(sizeof(*dst) + len + extra);
69− memcpy(dst->value, src, len);
70− dst->len = len;
71− return dst;
72−}
73−
74−static void xstrcat(struct http_string **dst, const char *src, size_t len)
75−{
76− struct http_string *p;
77−
78− if (*dst == NULL) {
79− *dst = xstrdup(src, len, 0);
80− return;
81− }
82−
83− p = xstrdup((*dst)->value, (*dst)->len, len);
84− memcpy(p->value + (*dst)->len, src, len);
85− p->len += len;
86− free(*dst);
87− *dst = p;
88−}
89−
90−static int begin(http_parser *p)
91−{
92− struct data *data = p->data;
93−
94− data->count++;
95−
96− return 0;
97−}
98−
99−static int url(http_parser *p, const char *at, size_t len)
100−{
101−#ifdef LOOK_BUSY
102− struct data *data = p->data;
103−
104− xstrcat(&data->req.uri, at, len);
105−#endif
106−
107− return 0;
108−}
109−
110−static int header_field(http_parser *p, const char *at, size_t len)
111−{
112−#ifdef LOOK_BUSY
113− struct data *data = p->data;
114−
115− if (data->req.last && data->req.last->value == NULL) {
116− xstrcat(&data->req.last->name, at, len);
117− } else {
118− struct http_header *hdr = xmalloc(sizeof(*hdr));
119−
120− hdr->name = xstrdup(at, len, 0);
121− hdr->value = NULL;
122− hdr->next = NULL;
123−
124− if (data->req.last != NULL)
125− data->req.last->next = hdr;
126− data->req.last = hdr;
127− if (data->req.headers == NULL)
128− data->req.headers = hdr;
129− }
130−#endif
131−
132− return 0;
133−}
134−
135−static int header_value(http_parser *p, const char *at, size_t len)
136−{
137−#ifdef LOOK_BUSY
138− struct data *data = p->data;
139−
140− xstrcat(&data->req.last->value, at, len);
141−#endif
142−
143− return 0;
144−}
145−
146−static int complete(http_parser *p)
147−{
148−#ifdef LOOK_BUSY
149− struct data *data = p->data;
150− struct http_header *hdr, *next;
151−
152− free(data->req.method);
153− free(data->req.uri);
154−
155− for (hdr = data->req.headers; hdr != NULL; hdr = next) {
156− next = hdr->next;
157− free(hdr->name);
158− free(hdr->value);
159− free(hdr);
160− hdr = next;
161− }
162−
163− data->req.method = NULL;
164− data->req.uri = NULL;
165− data->req.headers = NULL;
166− data->req.last = NULL;
167−#endif
168−
169− /* Bludgeon http_parser into understanding that we really want to
170− * keep parsing after a request that in principle ought to close
171− * the "connection". */
172− if (!http_should_keep_alive(p)) {
173− p->http_major = 1;
174− p->http_minor = 1;
175− p->flags &= ~6;
176− }
177−
178− return 0;
179−}
180−
181−static void parse(const char *path, int fd)
182−{
183− struct data data;
184− http_parser_settings s;
185− http_parser p;
186− ssize_t nread;
187−
188− memset(&s, 0, sizeof(s));
189− s.on_message_begin = begin;
190− s.on_url = url;
191− s.on_header_field = header_field;
192− s.on_header_value = header_value;
193− s.on_message_complete = complete;
194−
195− p.data = &data;
196−
197− http_parser_init(&p, HTTP_REQUEST);
198−
199− data.count = 0;
200− data.req.method = NULL;
201− data.req.uri = NULL;
202− data.req.headers = NULL;
203− data.req.last = NULL;
204−
205− do {
206− char buf[HTTP_MAX_HEADER_SIZE];
207− size_t np;
208−
209− nread = read(fd, buf, sizeof(buf));
210−
211− np = http_parser_execute(&p, &s, buf, nread);
212− if (np != nread) {
213− fprintf(stderr, "%s: parse failed\n", path);
214− break;
215− }
216− } while (nread > 0);
217−
218− printf("%ld\n", (unsigned long) data.count);
219−}
220−
221−int main(int argc, char **argv)
222−{
223− int i;
224−
225− for (i = 1; i < argc; i++) {
226− int fd;
227−
228− fd = open(argv[i], O_RDONLY);
229− if (fd == -1) {
230− perror(argv[i]);
231− continue;
232− }
233− parse(argv[i], fd);
234− close(fd);
235− }
236−
237− return 0;
238−}
239−
240−/*
241− * Local Variables:
242− * c-file-style: "stroustrup"
243− * End:
244− */
src/Data/ParserCombinators/Attoparsec.hsnew file+65
@@ -0,0 +1,65 @@
1+-----------------------------------------------------------------------------
2+-- |
3+-- Module : Data.ParserCombinators.Attoparsec
4+-- Copyright : Daan Leijen 1999-2001, Jeremy Shaw 2006, Bryan O'Sullivan 2007-2008
5+-- License : BSD3
6+--
7+-- Maintainer : bos@serpentine.com
8+-- Stability : experimental
9+-- Portability : unknown
10+--
11+-- Simple, efficient parser combinators for lazy 'LB.ByteString'
12+-- strings, loosely based on 'Text.ParserCombinators.Parsec'.
13+--
14+-----------------------------------------------------------------------------
15+module Data.ParserCombinators.Attoparsec
16+ (
17+ -- * Parser
18+ ParseError
19+ , Parser
20+
21+ -- * Running parsers
22+ , parse
23+ , parseAt
24+ , parseTest
25+
26+ -- * Combinators
27+ , (<?>)
28+
29+ -- * Things vaguely like those in @Parsec.Combinator@ (and @Parsec.Prim@)
30+ , try
31+ , manyTill
32+ , eof
33+ , skipMany
34+ , skipMany1
35+ , count
36+ , lookAhead
37+ , peek
38+ , sepBy
39+ , sepBy1
40+
41+ -- * Things like in @Parsec.Char@
42+ , satisfy
43+ , anyWord8
44+ , word8
45+ , notWord8
46+ , string
47+ , stringTransform
48+
49+ -- * Parser converters.
50+ , eitherP
51+
52+ -- * Miscellaneous functions.
53+ , getInput
54+ , getConsumed
55+ , takeWhile
56+ , takeWhile1
57+ , takeTill
58+ , takeAll
59+ , skipWhile
60+ , notEmpty
61+ , match
62+ ) where
63+
64+import Data.ParserCombinators.Attoparsec.Internal
65+import Prelude hiding (takeWhile)
src/Data/ParserCombinators/Attoparsec/Char8.hsnew file+156
@@ -0,0 +1,156 @@
1+-----------------------------------------------------------------------------
2+-- |
3+-- Module : Data.ParserCombinators.Attoparsec.Char8
4+-- Copyright : Daan Leijen 1999-2001, Jeremy Shaw 2006, Bryan O'Sullivan 2007-2008
5+-- License : BSD3
6+--
7+-- Maintainer : bos@serpentine.com
8+-- Stability : experimental
9+-- Portability : unknown
10+--
11+-- Simple, efficient parser combinators for lazy 'LB.ByteString'
12+-- strings, loosely based on 'Text.ParserCombinators.Parsec'.
13+--
14+-----------------------------------------------------------------------------
15+module Data.ParserCombinators.Attoparsec.Char8
16+ (
17+ -- * Parser
18+ ParseError
19+ , Parser
20+
21+ -- * Running parsers
22+ , parse
23+ , parseAt
24+ , parseTest
25+
26+ -- * Combinators
27+ , (<?>)
28+
29+ -- * Things vaguely like those in @Parsec.Combinator@ (and @Parsec.Prim@)
30+ , try
31+ , manyTill
32+ , eof
33+ , skipMany
34+ , skipMany1
35+ , count
36+ , lookAhead
37+ , peek
38+ , sepBy
39+ , sepBy1
40+
41+ -- * Things like in @Parsec.Char@
42+ , satisfy
43+ , letter
44+ , digit
45+ , anyChar
46+ , space
47+ , char
48+ , notChar
49+ , string
50+ , stringCI
51+
52+ -- * Parser converters.
53+ , eitherP
54+
55+ -- * Miscellaneous functions.
56+ , getInput
57+ , getConsumed
58+ , takeWhile
59+ , takeWhile1
60+ , takeTill
61+ , takeAll
62+ , skipWhile
63+ , skipSpace
64+ , notEmpty
65+ , match
66+ , inClass
67+ , notInClass
68+ ) where
69+
70+import Control.Applicative ((<$>))
71+import qualified Data.ByteString.Char8 as SB
72+import qualified Data.ByteString.Lazy.Char8 as LB
73+import Data.ByteString.Internal (w2c)
74+import Data.Char (isDigit, isLetter, isSpace, toLower)
75+import Data.ParserCombinators.Attoparsec.FastSet
76+ (FastSet, memberChar, set)
77+import qualified Data.ParserCombinators.Attoparsec.Internal as I
78+import Data.ParserCombinators.Attoparsec.Internal
79+ (Parser, ParseError, (<?>), parse, parseAt, parseTest, try, manyTill, eof,
80+ skipMany, skipMany1, count, lookAhead, peek, sepBy, sepBy1, string,
81+ eitherP, getInput, getConsumed, takeAll, notEmpty, match)
82+import Prelude hiding (takeWhile)
83+
84+-- | Character parser.
85+satisfy :: (Char -> Bool) -> Parser Char
86+satisfy p = w2c <$> I.satisfy (p . w2c)
87+{-# INLINE satisfy #-}
88+
89+letter :: Parser Char
90+letter = satisfy isLetter <?> "letter"
91+{-# INLINE letter #-}
92+
93+digit :: Parser Char
94+digit = satisfy isDigit <?> "digit"
95+{-# INLINE digit #-}
96+
97+anyChar :: Parser Char
98+anyChar = satisfy $ const True
99+{-# INLINE anyChar #-}
100+
101+space :: Parser Char
102+space = satisfy isSpace <?> "space"
103+{-# INLINE space #-}
104+
105+-- | Satisfy a specific character.
106+char :: Char -> Parser Char
107+char c = satisfy (== c) <?> [c]
108+{-# INLINE char #-}
109+
110+-- | Satisfy a specific character.
111+notChar :: Char -> Parser Char
112+notChar c = satisfy (/= c) <?> "not " ++ [c]
113+{-# INLINE notChar #-}
114+
115+charClass :: String -> FastSet
116+charClass = set . SB.pack . go
117+ where go (a:'-':b:xs) = [a..b] ++ go xs
118+ go (x:xs) = x : go xs
119+ go _ = ""
120+
121+inClass :: String -> Char -> Bool
122+inClass s = (`memberChar` myset)
123+ where myset = charClass s
124+{-# INLINE inClass #-}
125+
126+notInClass :: String -> Char -> Bool
127+notInClass s = not . inClass s
128+{-# INLINE notInClass #-}
129+
130+-- | Satisfy a literal string, ignoring case.
131+stringCI :: LB.ByteString -> Parser LB.ByteString
132+stringCI = I.stringTransform (LB.map toLower)
133+{-# INLINE stringCI #-}
134+
135+-- | Consume characters while the predicate is true.
136+takeWhile :: (Char -> Bool) -> Parser LB.ByteString
137+takeWhile p = I.takeWhile (p . w2c)
138+{-# INLINE takeWhile #-}
139+
140+takeTill :: (Char -> Bool) -> Parser LB.ByteString
141+takeTill p = I.takeTill (p . w2c)
142+{-# INLINE takeTill #-}
143+
144+takeWhile1 :: (Char -> Bool) -> Parser LB.ByteString
145+takeWhile1 p = I.takeWhile1 (p . w2c)
146+{-# INLINE takeWhile1 #-}
147+
148+-- | Skip over characters while the predicate is true.
149+skipWhile :: (Char -> Bool) -> Parser ()
150+skipWhile p = I.skipWhile (p . w2c)
151+{-# INLINE skipWhile #-}
152+
153+-- | Skip over white space.
154+skipSpace :: Parser ()
155+skipSpace = takeWhile isSpace >> return ()
156+{-# INLINE skipSpace #-}
Data/Attoparsec/ByteString/FastSet.hs → src/Data/ParserCombinators/Attoparsec/FastSet.hsrenamed+39−54
@@ -1,115 +1,100 @@
1−{-# LANGUAGE BangPatterns, MagicHash #-}
1+{-# LANGUAGE BangPatterns #-}
22
33-----------------------------------------------------------------------------
44-- |
5−-- Module : Data.Attoparsec.ByteString.FastSet
6−-- Copyright : Bryan O'Sullivan 2007-2015
5+-- Module : Data.ParserCombinators.Attoparsec.FastSet
6+-- Copyright : Bryan O'Sullivan 2008
77-- License : BSD3
8−--
8+--
99-- Maintainer : bos@serpentine.com
1010-- Stability : experimental
1111-- Portability : unknown
1212--
1313-- Fast set membership tests for 'Word8' and 8-bit 'Char' values. The
14−-- set representation is unboxed for efficiency. For small sets, we
15−-- test for membership using a binary search. For larger sets, we use
16−-- a lookup table.
17−--
14+-- set representation is unboxed for efficiency. For sets of fewer
15+-- than 32 elements, we test for membership using a binary search.
16+-- For larger sets, we use a lookup table.
17+--
1818-----------------------------------------------------------------------------
19−module Data.Attoparsec.ByteString.FastSet
19+module Data.ParserCombinators.Attoparsec.FastSet
2020 (
2121 -- * Data type
2222 FastSet
2323 -- * Construction
24− , fromList
2524 , set
2625 -- * Lookup
2726 , memberChar
2827 , memberWord8
2928 -- * Debugging
3029 , fromSet
31− -- * Handy interface
32− , charClass
3330 ) where
3431
35−import Data.Bits ((.&.), (.|.))
36−import Foreign.Storable (peekByteOff, pokeByteOff)
37−import GHC.Base (Int(I#), iShiftRA#, narrow8Word#, shiftL#)
38−import GHC.Word (Word8(W8#))
3932import qualified Data.ByteString as B
40−import qualified Data.ByteString.Char8 as B8
33+-- import Data.ByteString.Char8 (pack)
4134import qualified Data.ByteString.Internal as I
4235import qualified Data.ByteString.Unsafe as U
36+import Data.Word (Word8)
37+import Foreign.Storable (peekByteOff, pokeByteOff)
4338
44−data FastSet = Sorted { fromSet :: !B.ByteString }
45− | Table { fromSet :: !B.ByteString }
39+data FastSet = Sorted { fromSet :: {-# UNPACK #-} !B.ByteString }
40+ | Table { fromSet :: {-# UNPACK #-} !B.ByteString }
4641 deriving (Eq, Ord)
4742
4843instance Show FastSet where
49− show (Sorted s) = "FastSet Sorted " ++ show (B8.unpack s)
50− show (Table _) = "FastSet Table"
44+ show (Sorted s) = "FastSet " ++ show s
45+ show (Table t) = "FastSet " ++ fromTable t
5146
5247-- | The lower bound on the size of a lookup table. We choose this to
5348-- balance table density against performance.
5449tableCutoff :: Int
55−tableCutoff = 8
50+tableCutoff = 32
5651
5752-- | Create a set.
5853set :: B.ByteString -> FastSet
5954set s | B.length s < tableCutoff = Sorted . B.sort $ s
6055 | otherwise = Table . mkTable $ s
6156
62−fromList :: [Word8] -> FastSet
63−fromList = set . B.pack
64−
65−data I = I {-# UNPACK #-} !Int {-# UNPACK #-} !Word8
66−
67−shiftR :: Int -> Int -> Int
68−shiftR (I# x#) (I# i#) = I# (x# `iShiftRA#` i#)
69−
70−shiftL :: Word8 -> Int -> Word8
71−shiftL (W8# x#) (I# i#) = W8# (narrow8Word# (x# `shiftL#` i#))
72−
73−index :: Int -> I
74−index i = I (i `shiftR` 3) (1 `shiftL` (i .&. 7))
75−{-# INLINE index #-}
76−
7757-- | Check the set for membership.
7858memberWord8 :: Word8 -> FastSet -> Bool
79−memberWord8 w (Table t) =
80− let I byte bit = index (fromIntegral w)
81− in U.unsafeIndex t byte .&. bit /= 0
59+memberWord8 w (Table t) = U.unsafeIndex t (fromIntegral w) == entry
8260memberWord8 w (Sorted s) = search 0 (B.length s - 1)
8361 where search lo hi
8462 | hi < lo = False
8563 | otherwise =
86− let mid = (lo + hi) `quot` 2
64+ let mid = (lo + hi) `div` 2
8765 in case compare w (U.unsafeIndex s mid) of
88− GT -> search (mid + 1) hi
89− LT -> search lo (mid - 1)
66+ GT -> search lo (mid - 1)
67+ LT -> search (mid + 1) hi
9068 _ -> True
9169
9270-- | Check the set for membership. Only works with 8-bit characters:
9371-- characters above code point 255 will give wrong answers.
9472memberChar :: Char -> FastSet -> Bool
9573memberChar c = memberWord8 (I.c2w c)
96−{-# INLINE memberChar #-}
74+
75+-- | The value in a table that indicates that a character is not
76+-- present. We avoid NUL to make the table representation printable.
77+noEntry :: Word8
78+noEntry = 0x5f
79+
80+-- | The value in a table that indicates that a character is present.
81+-- We use a printable character for readability.
82+entry :: Word8
83+entry = 0x21
9784
9885mkTable :: B.ByteString -> B.ByteString
99−mkTable s = I.unsafeCreate 32 $ \t -> do
100− _ <- I.memset t 0 32
86+mkTable s = I.unsafeCreate 256 $ \t -> do
87+ I.memset t noEntry 256
10188 U.unsafeUseAsCStringLen s $ \(p, l) ->
10289 let loop n | n == l = return ()
10390 | otherwise = do
10491 c <- peekByteOff p n :: IO Word8
105− let I byte bit = index (fromIntegral c)
106− prev <- peekByteOff t byte :: IO Word8
107− pokeByteOff t byte (prev .|. bit)
92+ pokeByteOff t (fromIntegral c) entry
10893 loop (n + 1)
10994 in loop 0
11095
111−charClass :: String -> FastSet
112−charClass = set . B8.pack . go
113− where go (a:'-':b:xs) = [a..b] ++ go xs
114− go (x:xs) = x : go xs
115− go _ = ""
96+-- | Turn the table representation into a string, for debugging.
97+fromTable :: B.ByteString -> String
98+fromTable = snd . B.foldr go (0xff, [])
99+ where go c (n, cs) | c == noEntry = flip (,) cs $! n - 1
100+ | otherwise = flip (,) (I.w2c n:cs) $! n - 1
src/Data/ParserCombinators/Attoparsec/Internal.hsnew file+355
@@ -0,0 +1,355 @@
1+-----------------------------------------------------------------------------
2+-- |
3+-- Module : Data.ParserCombinators.Attoparsec.Internal
4+-- Copyright : Daan Leijen 1999-2001, Jeremy Shaw 2006, Bryan O'Sullivan 2007-2008
5+-- License : BSD3
6+--
7+-- Maintainer : bos@serpentine.com
8+-- Stability : experimental
9+-- Portability : unknown
10+--
11+-- Simple, efficient parser combinators for lazy 'LB.ByteString'
12+-- strings, loosely based on 'Text.ParserCombinators.Parsec'.
13+--
14+-----------------------------------------------------------------------------
15+module Data.ParserCombinators.Attoparsec.Internal
16+ (
17+ -- * Parser
18+ ParseError
19+ , Parser
20+
21+ -- * Running parsers
22+ , parse
23+ , parseAt
24+ , parseTest
25+
26+ -- * Combinators
27+ , (<?>)
28+
29+ -- * Things vaguely like those in @Parsec.Combinator@ (and @Parsec.Prim@)
30+ , try
31+ , manyTill
32+ , eof
33+ , skipMany
34+ , skipMany1
35+ , count
36+ , lookAhead
37+ , peek
38+ , sepBy
39+ , sepBy1
40+
41+ -- * Things like in @Parsec.Char@
42+ , satisfy
43+ , anyWord8
44+ , word8
45+ , notWord8
46+ , string
47+ , stringTransform
48+
49+ -- * Parser converters.
50+ , eitherP
51+
52+ -- * Miscellaneous functions.
53+ , getInput
54+ , getConsumed
55+ , takeWhile
56+ , takeWhile1
57+ , takeTill
58+ , takeAll
59+ , skipWhile
60+ , notEmpty
61+ , match
62+ ) where
63+
64+import Control.Applicative
65+ (Alternative(..), Applicative(..), (<$>), (<*), (*>))
66+import Control.Monad (MonadPlus(..), ap, liftM2)
67+import Control.Monad.Fix (MonadFix(..))
68+import qualified Data.ByteString as SB
69+import qualified Data.ByteString.Lazy as LB
70+import qualified Data.ByteString.Lazy.Internal as LB
71+import Data.Int (Int64)
72+import Data.Word (Word8)
73+import Prelude hiding (takeWhile)
74+
75+type ParseError = String
76+
77+data S = S {-# UNPACK #-} !SB.ByteString
78+ LB.ByteString
79+ {-# UNPACK #-} !Int64
80+
81+newtype Parser a = Parser {
82+ unParser :: S -> Either (LB.ByteString, [String]) (a, S)
83+ }
84+
85+instance Functor Parser where
86+ fmap f p =
87+ Parser $ \s ->
88+ case unParser p s of
89+ Right (a, s') -> Right (f a, s')
90+ Left err -> Left err
91+
92+instance Monad Parser where
93+ return a = Parser $ \s -> Right (a, s)
94+ m >>= f = Parser $ \s ->
95+ case unParser m s of
96+ Right (a, s') -> unParser (f a) s'
97+ Left (s', msgs) -> Left (s', msgs)
98+ fail err = Parser $ \(S sb lb _) -> Left (sb +: lb, [err])
99+
100+instance MonadFix Parser where
101+ mfix f = Parser $ \s ->
102+ let r = case r of
103+ Right (a, _) -> unParser (f a) s
104+ err -> err
105+ in r
106+
107+zero :: Parser a
108+zero = Parser $ \(S sb lb _) -> Left (sb +: lb, [])
109+{-# INLINE zero #-}
110+
111+plus :: Parser a -> Parser a -> Parser a
112+plus p1 p2 =
113+ Parser $ \s@(S sb lb _) ->
114+ case unParser p1 s of
115+ Left (_, msgs1) ->
116+ case unParser p2 s of
117+ Left (_, msgs2) -> Left (sb +: lb, (msgs1 ++ msgs2))
118+ ok -> ok
119+ ok -> ok
120+{-# INLINE plus #-}
121+
122+instance MonadPlus Parser where
123+ mzero = zero
124+ mplus = plus
125+
126+instance Applicative Parser where
127+ pure = return
128+ (<*>) = ap
129+
130+instance Alternative Parser where
131+ empty = zero
132+ (<|>) = plus
133+
134+mkState :: LB.ByteString -> Int64 -> S
135+mkState s = case s of
136+ LB.Empty -> S SB.empty s
137+ LB.Chunk x xs -> S x xs
138+
139+-- | Turn our chunked representation back into a normal lazy
140+-- ByteString.
141+(+:) :: SB.ByteString -> LB.ByteString -> LB.ByteString
142+sb +: lb | SB.null sb = lb
143+ | otherwise = LB.Chunk sb lb
144+{-# INLINE (+:) #-}
145+
146+infix 0 <?>
147+
148+-- | Name the parser.
149+(<?>) :: Parser a -> String -> Parser a
150+p <?> msg =
151+ Parser $ \s@(S sb lb _) ->
152+ case unParser p s of
153+ (Left _) -> Left (sb +: lb, [msg])
154+ ok -> ok
155+{-# INLINE (<?>) #-}
156+
157+nextChunk :: Parser ()
158+nextChunk = Parser $ \(S _ lb n) ->
159+ case lb of
160+ LB.Chunk sb' lb' -> Right ((), S sb' lb' n)
161+ LB.Empty -> Left (lb, [])
162+
163+-- | Get remaining input.
164+getInput :: Parser LB.ByteString
165+getInput = Parser $ \s@(S sb lb _) -> Right (sb +: lb, s)
166+
167+-- | Get number of bytes consumed so far.
168+getConsumed :: Parser Int64
169+getConsumed = Parser $ \s@(S _ _ n) -> Right (n, s)
170+
171+-- | Character parser.
172+satisfy :: (Word8 -> Bool) -> Parser Word8
173+satisfy p =
174+ Parser $ \s@(S sb lb n) ->
175+ case SB.uncons sb of
176+ Just (c, sb') | p c -> Right (c, S sb' lb (n + 1))
177+ | otherwise -> Left (sb +: lb, [])
178+ Nothing -> unParser (nextChunk >> satisfy p) s
179+{-# INLINE satisfy #-}
180+
181+anyWord8 :: Parser Word8
182+anyWord8 = satisfy $ const True
183+{-# INLINE anyWord8 #-}
184+
185+-- | Satisfy a specific character.
186+word8 :: Word8 -> Parser Word8
187+word8 c = satisfy (== c) <?> show c
188+{-# INLINE word8 #-}
189+
190+-- | Satisfy a specific character.
191+notWord8 :: Word8 -> Parser Word8
192+notWord8 c = satisfy (/= c) <?> "not " ++ show c
193+{-# INLINE notWord8 #-}
194+
195+sepBy :: Parser a -> Parser s -> Parser [a]
196+sepBy p s = liftM2 (:) p ((s >> sepBy1 p s) <|> return []) <|> return []
197+
198+sepBy1 :: Parser a -> Parser s -> Parser [a]
199+sepBy1 p s = liftM2 (:) p ((s >> sepBy1 p s) <|> return [])
200+
201+-- | Satisfy a literal string.
202+string :: LB.ByteString -> Parser LB.ByteString
203+string s = Parser $ \(S sb lb n) ->
204+ let bs = sb +: lb
205+ l = LB.length s
206+ (h, t) = LB.splitAt l bs
207+ in if s == h
208+ then Right (s, mkState t (n + l))
209+ else Left (bs, [])
210+{-# INLINE string #-}
211+
212+-- | Satisfy a literal string, after applying a transformation to both
213+-- it and the matching text.
214+stringTransform :: (LB.ByteString -> LB.ByteString) -> LB.ByteString
215+ -> Parser LB.ByteString
216+stringTransform f s = Parser $ \(S sb lb n) ->
217+ let bs = sb +: lb
218+ l = LB.length s
219+ (h, t) = LB.splitAt l bs
220+ in if fs == f h
221+ then Right (s, mkState t (n + l))
222+ else Left (bs, [])
223+ where fs = f s
224+{-# INLINE stringTransform #-}
225+
226+-- | Apply the given parser repeatedly, returning every parse result.
227+count :: Int -> Parser a -> Parser [a]
228+count n p = sequence (replicate n p)
229+{-# INLINE count #-}
230+
231+try :: Parser a -> Parser a
232+try p = Parser $ \s@(S sb lb _) ->
233+ case unParser p s of
234+ Left (_, msgs) -> Left (sb +: lb, msgs)
235+ ok -> ok
236+
237+-- | Detect 'end of file'.
238+eof :: Parser ()
239+eof = Parser $ \s@(S sb lb _) -> if SB.null sb && LB.null lb
240+ then Right ((), s)
241+ else Left (sb +: lb, ["EOF"])
242+
243+takeAll :: Parser LB.ByteString
244+takeAll = Parser $ \(S sb lb n) ->
245+ let bs = sb +: lb
246+ in Right (bs, mkState LB.empty (n + LB.length bs))
247+
248+oneChunk :: SB.ByteString -> LB.ByteString
249+oneChunk s = LB.Chunk s LB.Empty
250+
251+length64 :: SB.ByteString -> Int64
252+length64 = fromIntegral . SB.length
253+
254+-- | Consume characters while the predicate is true.
255+takeWhile :: (Word8 -> Bool) -> Parser LB.ByteString
256+takeWhile p = Parser $ \s@(S sb lb n) ->
257+ let (h, t) = SB.span p sb
258+ in if SB.null t
259+ then unParser ((h +:) <$> (nextChunk *> takeWhile p)) s
260+ else Right (oneChunk h, S t lb (n + length64 h))
261+{-# INLINE takeWhile #-}
262+
263+takeTill :: (Word8 -> Bool) -> Parser LB.ByteString
264+takeTill p = takeWhile (not . p) <* satisfy p
265+{-# INLINE takeTill #-}
266+
267+takeWhile1 :: (Word8 -> Bool) -> Parser LB.ByteString
268+takeWhile1 p = Parser $ \s@(S sb lb n) ->
269+ let (h, t) = SB.span p sb
270+ in if SB.null t
271+ then case unParser (nextChunk *> takeWhile p) s of
272+ Left err -> Left err
273+ Right (xs, s') ->
274+ let bs = h +: xs
275+ in if LB.null bs
276+ then Left (sb +: lb, [])
277+ else Right (bs, s')
278+ else Right (oneChunk h, S t lb (n + length64 h))
279+{-# INLINE takeWhile1 #-}
280+
281+-- | Skip over characters while the predicate is true.
282+skipWhile :: (Word8 -> Bool) -> Parser ()
283+skipWhile p = takeWhile p >> return ()
284+{-# INLINE skipWhile #-}
285+
286+manyTill :: Parser a -> Parser b -> Parser [a]
287+manyTill p end = scan
288+ where scan = (end >> return []) <|> liftM2 (:) p scan
289+
290+-- |'skipMany' - skip zero or many instances of the parser
291+skipMany :: Parser a -> Parser ()
292+skipMany p = scan
293+ where scan = (p >> scan) <|> return ()
294+
295+-- |'skipMany1' - skip one or many instances of the parser
296+skipMany1 :: Parser a -> Parser ()
297+skipMany1 p = p >> skipMany p
298+
299+-- | Test that a parser returned a non-null ByteString.
300+notEmpty :: Parser LB.ByteString -> Parser LB.ByteString
301+notEmpty p = Parser $ \s ->
302+ case unParser p s of
303+ o@(Right (a, _)) ->
304+ if LB.null a
305+ then Left (a, ["notEmpty"])
306+ else o
307+ x -> x
308+
309+-- | Parse some input with the given parser and return that input
310+-- without copying it.
311+match :: Parser a -> Parser LB.ByteString
312+match p = do bs <- getInput
313+ start <- getConsumed
314+ p
315+ end <- getConsumed
316+ return (LB.take (end - start) bs)
317+
318+eitherP :: Parser a -> Parser b -> Parser (Either a b)
319+eitherP a b = (Left <$> a) <|> (Right <$> b)
320+{-# INLINE eitherP #-}
321+
322+peek :: Parser a -> Parser (Maybe a)
323+peek p = Parser $ \s ->
324+ case unParser p s of
325+ Right (m, _) -> Right (Just m, s)
326+ _ -> Right (Nothing, s)
327+
328+lookAhead :: Parser a -> Parser a
329+lookAhead p = Parser $ \s ->
330+ case unParser p s of
331+ Right (m, _) -> Right (m, s)
332+ Left (e, bs) -> Left (e, bs)
333+
334+parseAt :: Parser a -> LB.ByteString -> Int64
335+ -> (LB.ByteString, Either ParseError (a, Int64))
336+parseAt p bs n =
337+ case unParser p (mkState bs n) of
338+ Left (bs', msg) -> (bs', Left $ showError msg)
339+ Right (a, S sb lb n') -> (sb +: lb, Right (a, n'))
340+ where
341+ showError [msg] = "Parser error, expected:\n" ++ msg ++ "\n"
342+ showError msgs = "Parser error, expected one of:\n" ++ unlines msgs
343+
344+-- | Run a parser.
345+parse :: Parser a -> LB.ByteString
346+ -> (LB.ByteString, Either ParseError a)
347+parse p bs = case parseAt p bs 0 of
348+ (bs', Right (a, _)) -> (bs', Right a)
349+ (bs', Left err) -> (bs', Left err)
350+
351+parseTest :: (Show a) => Parser a -> LB.ByteString -> IO ()
352+parseTest p s =
353+ case parse p s of
354+ (st, Left msg) -> putStrLn $ msg ++ "\nGot:\n" ++ show st
355+ (_, Right r) -> print r
src/Data/ParserCombinators/ByteStringParser/Char8.hsnew file+156
@@ -0,0 +1,156 @@
1+-----------------------------------------------------------------------------
2+-- |
3+-- Module : Data.ParserCombinators.ByteStringParser.Char8
4+-- Copyright : Daan Leijen 1999-2001, Jeremy Shaw 2006, Bryan O'Sullivan 2007-2008
5+-- License : BSD3
6+--
7+-- Maintainer : bos@serpentine.com
8+-- Stability : experimental
9+-- Portability : unknown
10+--
11+-- Simple, efficient parser combinators for lazy 'LB.ByteString'
12+-- strings, loosely based on 'Text.ParserCombinators.Parsec'.
13+--
14+-----------------------------------------------------------------------------
15+module Data.ParserCombinators.ByteStringParser.Char8
16+ (
17+ -- * Parser
18+ ParseError
19+ , Parser
20+
21+ -- * Running parsers
22+ , parse
23+ , parseAt
24+ , parseTest
25+
26+ -- * Combinators
27+ , (<?>)
28+
29+ -- * Things vaguely like those in @Parsec.Combinator@ (and @Parsec.Prim@)
30+ , try
31+ , manyTill
32+ , eof
33+ , skipMany
34+ , skipMany1
35+ , count
36+ , lookAhead
37+ , peek
38+ , sepBy
39+ , sepBy1
40+
41+ -- * Things like in @Parsec.Char@
42+ , satisfy
43+ , letter
44+ , digit
45+ , anyChar
46+ , space
47+ , char
48+ , notChar
49+ , string
50+ , stringCI
51+
52+ -- * Parser converters.
53+ , eitherP
54+
55+ -- * Miscellaneous functions.
56+ , getInput
57+ , getConsumed
58+ , takeWhile
59+ , takeWhile1
60+ , takeTill
61+ , takeAll
62+ , skipWhile
63+ , skipSpace
64+ , notEmpty
65+ , match
66+ , inClass
67+ , notInClass
68+ ) where
69+
70+import Control.Applicative ((<$>))
71+import qualified Data.ByteString.Char8 as SB
72+import qualified Data.ByteString.Lazy.Char8 as LB
73+import Data.ByteString.Internal (w2c)
74+import Data.Char (isDigit, isLetter, isSpace, toLower)
75+import Data.ParserCombinators.ByteStringParser.FastSet
76+ (FastSet, memberChar, set)
77+import qualified Data.ParserCombinators.ByteStringParser.Internal as I
78+import Data.ParserCombinators.ByteStringParser.Internal
79+ (Parser, ParseError, (<?>), parse, parseAt, parseTest, try, manyTill, eof,
80+ skipMany, skipMany1, count, lookAhead, peek, sepBy, sepBy1, string,
81+ eitherP, getInput, getConsumed, takeAll, notEmpty, match)
82+import Prelude hiding (takeWhile)
83+
84+-- | Character parser.
85+satisfy :: (Char -> Bool) -> Parser Char
86+satisfy p = w2c <$> I.satisfy (p . w2c)
87+{-# INLINE satisfy #-}
88+
89+letter :: Parser Char
90+letter = satisfy isLetter <?> "letter"
91+{-# INLINE letter #-}
92+
93+digit :: Parser Char
94+digit = satisfy isDigit <?> "digit"
95+{-# INLINE digit #-}
96+
97+anyChar :: Parser Char
98+anyChar = satisfy $ const True
99+{-# INLINE anyChar #-}
100+
101+space :: Parser Char
102+space = satisfy isSpace <?> "space"
103+{-# INLINE space #-}
104+
105+-- | Satisfy a specific character.
106+char :: Char -> Parser Char
107+char c = satisfy (== c) <?> [c]
108+{-# INLINE char #-}
109+
110+-- | Satisfy a specific character.
111+notChar :: Char -> Parser Char
112+notChar c = satisfy (/= c) <?> "not " ++ [c]
113+{-# INLINE notChar #-}
114+
115+charClass :: String -> FastSet
116+charClass = set . SB.pack . go
117+ where go (a:'-':b:xs) = [a..b] ++ go xs
118+ go (x:xs) = x : go xs
119+ go _ = ""
120+
121+inClass :: String -> Char -> Bool
122+inClass s = (`memberChar` myset)
123+ where myset = charClass s
124+{-# INLINE inClass #-}
125+
126+notInClass :: String -> Char -> Bool
127+notInClass s = not . inClass s
128+{-# INLINE notInClass #-}
129+
130+-- | Satisfy a literal string, ignoring case.
131+stringCI :: LB.ByteString -> Parser LB.ByteString
132+stringCI = I.stringTransform (LB.map toLower)
133+{-# INLINE stringCI #-}
134+
135+-- | Consume characters while the predicate is true.
136+takeWhile :: (Char -> Bool) -> Parser LB.ByteString
137+takeWhile p = I.takeWhile (p . w2c)
138+{-# INLINE takeWhile #-}
139+
140+takeTill :: (Char -> Bool) -> Parser LB.ByteString
141+takeTill p = I.takeTill (p . w2c)
142+{-# INLINE takeTill #-}
143+
144+takeWhile1 :: (Char -> Bool) -> Parser LB.ByteString
145+takeWhile1 p = I.takeWhile1 (p . w2c)
146+{-# INLINE takeWhile1 #-}
147+
148+-- | Skip over characters while the predicate is true.
149+skipWhile :: (Char -> Bool) -> Parser ()
150+skipWhile p = I.skipWhile (p . w2c)
151+{-# INLINE skipWhile #-}
152+
153+-- | Skip over white space.
154+skipSpace :: Parser ()
155+skipSpace = takeWhile isSpace >> return ()
156+{-# INLINE skipSpace #-}
src/Data/ParserCombinators/ByteStringParser/FastSet.hsnew file+96
@@ -0,0 +1,96 @@
1+{-# LANGUAGE BangPatterns #-}
2+
3+-----------------------------------------------------------------------------
4+-- |
5+-- Module : Data.ParserCombinators.ByteStringParser.FastSet
6+-- Copyright : Bryan O'Sullivan 2008
7+-- License : BSD3
8+--
9+-- Maintainer : bos@serpentine.com
10+-- Stability : experimental
11+-- Portability : unknown
12+--
13+-- Fast 8-bit character set membership.
14+--
15+-----------------------------------------------------------------------------
16+module Data.ParserCombinators.ByteStringParser.FastSet
17+ (
18+ -- * Data type
19+ FastSet
20+ -- * Construction
21+ , set
22+ -- * Lookup
23+ , memberChar
24+ , memberWord8
25+ -- * Debugging
26+ , fromSet
27+ ) where
28+
29+import qualified Data.ByteString as B
30+-- import Data.ByteString.Char8 (pack)
31+import qualified Data.ByteString.Internal as I
32+import qualified Data.ByteString.Unsafe as U
33+import Data.Word (Word8)
34+import Foreign.Storable (peekByteOff, pokeByteOff)
35+
36+data FastSet = Sorted { fromSet :: {-# UNPACK #-} !B.ByteString }
37+ | Table { fromSet :: {-# UNPACK #-} !B.ByteString }
38+ deriving (Eq, Ord)
39+
40+instance Show FastSet where
41+ show (Sorted s) = "FastSet " ++ show s
42+ show (Table t) = "FastSet " ++ fromTable t
43+
44+-- | The lower bound on the size of a lookup table. We choose this to
45+-- balance table density against performance.
46+tableCutoff :: Int
47+tableCutoff = 32
48+
49+-- | Create a character set.
50+set :: B.ByteString -> FastSet
51+set s | B.length s < tableCutoff = Sorted . B.sort $ s
52+ | otherwise = Table . mkTable $ s
53+
54+-- | Check the table for membership.
55+memberChar :: Char -> FastSet -> Bool
56+memberChar c = memberWord8 (I.c2w c)
57+
58+-- | Check the table for membership.
59+memberWord8 :: Word8 -> FastSet -> Bool
60+memberWord8 w (Table t) = U.unsafeIndex t (fromIntegral w) == entry
61+memberWord8 w (Sorted s) = search 0 (B.length s - 1)
62+ where search !lo !hi
63+ | hi < lo = False
64+ | otherwise =
65+ let mid = (lo + hi) `div` 2
66+ in case compare w (U.unsafeIndex s mid) of
67+ GT -> search lo (mid - 1)
68+ LT -> search (mid + 1) hi
69+ _ -> True
70+
71+-- | The value in a table that indicates that a character is not
72+-- present. We avoid NUL to make the table representation printable.
73+noEntry :: Word8
74+noEntry = 0x5f
75+
76+-- | The value in a table that indicates that a character is present.
77+-- We use a printable character for readability.
78+entry :: Word8
79+entry = 0x21
80+
81+mkTable :: B.ByteString -> B.ByteString
82+mkTable s = I.unsafeCreate 256 $ \t -> do
83+ I.memset t noEntry 256
84+ U.unsafeUseAsCStringLen s $ \(p, l) ->
85+ let loop n | n == l = return ()
86+ | otherwise = do
87+ c <- peekByteOff p n :: IO Word8
88+ pokeByteOff t (fromIntegral c) entry
89+ loop (n + 1)
90+ in loop 0
91+
92+-- | Turn the table representation into a string, for debugging.
93+fromTable :: B.ByteString -> String
94+fromTable = snd . B.foldr go (0xff, [])
95+ where go c (!n, cs) | c == noEntry = (n - 1, cs)
96+ | otherwise = (n - 1, I.w2c n:cs)
src/Data/ParserCombinators/ByteStringParser/Internal.hsnew file+355
@@ -0,0 +1,355 @@
1+-----------------------------------------------------------------------------
2+-- |
3+-- Module : Data.ParserCombinators.ByteStringParser.Internal
4+-- Copyright : Daan Leijen 1999-2001, Jeremy Shaw 2006, Bryan O'Sullivan 2007-2008
5+-- License : BSD3
6+--
7+-- Maintainer : bos@serpentine.com
8+-- Stability : experimental
9+-- Portability : unknown
10+--
11+-- Simple, efficient parser combinators for lazy 'LB.ByteString'
12+-- strings, loosely based on 'Text.ParserCombinators.Parsec'.
13+--
14+-----------------------------------------------------------------------------
15+module Data.ParserCombinators.ByteStringParser.Internal
16+ (
17+ -- * Parser
18+ ParseError
19+ , Parser
20+
21+ -- * Running parsers
22+ , parse
23+ , parseAt
24+ , parseTest
25+
26+ -- * Combinators
27+ , (<?>)
28+
29+ -- * Things vaguely like those in @Parsec.Combinator@ (and @Parsec.Prim@)
30+ , try
31+ , manyTill
32+ , eof
33+ , skipMany
34+ , skipMany1
35+ , count
36+ , lookAhead
37+ , peek
38+ , sepBy
39+ , sepBy1
40+
41+ -- * Things like in @Parsec.Char@
42+ , satisfy
43+ , anyWord8
44+ , word8
45+ , notWord8
46+ , string
47+ , stringTransform
48+
49+ -- * Parser converters.
50+ , eitherP
51+
52+ -- * Miscellaneous functions.
53+ , getInput
54+ , getConsumed
55+ , takeWhile
56+ , takeWhile1
57+ , takeTill
58+ , takeAll
59+ , skipWhile
60+ , notEmpty
61+ , match
62+ ) where
63+
64+import Control.Applicative
65+ (Alternative(..), Applicative(..), (<$>), (<*), (*>))
66+import Control.Monad (MonadPlus(..), ap, liftM2)
67+import Control.Monad.Fix (MonadFix(..))
68+import qualified Data.ByteString as SB
69+import qualified Data.ByteString.Lazy as LB
70+import qualified Data.ByteString.Lazy.Internal as LB
71+import Data.Int (Int64)
72+import Data.Word (Word8)
73+import Prelude hiding (takeWhile)
74+
75+type ParseError = String
76+
77+data S = S {-# UNPACK #-} !SB.ByteString
78+ LB.ByteString
79+ {-# UNPACK #-} !Int64
80+
81+newtype Parser a = Parser {
82+ unParser :: S -> Either (LB.ByteString, [String]) (a, S)
83+ }
84+
85+instance Functor Parser where
86+ fmap f p =
87+ Parser $ \s ->
88+ case unParser p s of
89+ Right (a, s') -> Right (f a, s')
90+ Left err -> Left err
91+
92+instance Monad Parser where
93+ return a = Parser $ \s -> Right (a, s)
94+ m >>= f = Parser $ \s ->
95+ case unParser m s of
96+ Right (a, s') -> unParser (f a) s'
97+ Left (s', msgs) -> Left (s', msgs)
98+ fail err = Parser $ \(S sb lb _) -> Left (sb +: lb, [err])
99+
100+instance MonadFix Parser where
101+ mfix f = Parser $ \s ->
102+ let r = case r of
103+ Right (a, _) -> unParser (f a) s
104+ err -> err
105+ in r
106+
107+zero :: Parser a
108+zero = Parser $ \(S sb lb _) -> Left (sb +: lb, [])
109+{-# INLINE zero #-}
110+
111+plus :: Parser a -> Parser a -> Parser a
112+plus p1 p2 =
113+ Parser $ \s@(S sb lb _) ->
114+ case unParser p1 s of
115+ Left (_, msgs1) ->
116+ case unParser p2 s of
117+ Left (_, msgs2) -> Left (sb +: lb, (msgs1 ++ msgs2))
118+ ok -> ok
119+ ok -> ok
120+{-# INLINE plus #-}
121+
122+instance MonadPlus Parser where
123+ mzero = zero
124+ mplus = plus
125+
126+instance Applicative Parser where
127+ pure = return
128+ (<*>) = ap
129+
130+instance Alternative Parser where
131+ empty = zero
132+ (<|>) = plus
133+
134+mkState :: LB.ByteString -> Int64 -> S
135+mkState s = case s of
136+ LB.Empty -> S SB.empty s
137+ LB.Chunk x xs -> S x xs
138+
139+-- | Turn our chunked representation back into a normal lazy
140+-- ByteString.
141+(+:) :: SB.ByteString -> LB.ByteString -> LB.ByteString
142+sb +: lb | SB.null sb = lb
143+ | otherwise = LB.Chunk sb lb
144+{-# INLINE (+:) #-}
145+
146+infix 0 <?>
147+
148+-- | Name the parser.
149+(<?>) :: Parser a -> String -> Parser a
150+p <?> msg =
151+ Parser $ \s@(S sb lb _) ->
152+ case unParser p s of
153+ (Left _) -> Left (sb +: lb, [msg])
154+ ok -> ok
155+{-# INLINE (<?>) #-}
156+
157+nextChunk :: Parser ()
158+nextChunk = Parser $ \(S _ lb n) ->
159+ case lb of
160+ LB.Chunk sb' lb' -> Right ((), S sb' lb' n)
161+ LB.Empty -> Left (lb, [])
162+
163+-- | Get remaining input.
164+getInput :: Parser LB.ByteString
165+getInput = Parser $ \s@(S sb lb _) -> Right (sb +: lb, s)
166+
167+-- | Get number of bytes consumed so far.
168+getConsumed :: Parser Int64
169+getConsumed = Parser $ \s@(S _ _ n) -> Right (n, s)
170+
171+-- | Character parser.
172+satisfy :: (Word8 -> Bool) -> Parser Word8
173+satisfy p =
174+ Parser $ \s@(S sb lb n) ->
175+ case SB.uncons sb of
176+ Just (c, sb') | p c -> Right (c, S sb' lb (n + 1))
177+ | otherwise -> Left (sb +: lb, [])
178+ Nothing -> unParser (nextChunk >> satisfy p) s
179+{-# INLINE satisfy #-}
180+
181+anyWord8 :: Parser Word8
182+anyWord8 = satisfy $ const True
183+{-# INLINE anyWord8 #-}
184+
185+-- | Satisfy a specific character.
186+word8 :: Word8 -> Parser Word8
187+word8 c = satisfy (== c) <?> show c
188+{-# INLINE word8 #-}
189+
190+-- | Satisfy a specific character.
191+notWord8 :: Word8 -> Parser Word8
192+notWord8 c = satisfy (/= c) <?> "not " ++ show c
193+{-# INLINE notWord8 #-}
194+
195+sepBy :: Parser a -> Parser s -> Parser [a]
196+sepBy p s = liftM2 (:) p ((s >> sepBy1 p s) <|> return []) <|> return []
197+
198+sepBy1 :: Parser a -> Parser s -> Parser [a]
199+sepBy1 p s = liftM2 (:) p ((s >> sepBy1 p s) <|> return [])
200+
201+-- | Satisfy a literal string.
202+string :: LB.ByteString -> Parser LB.ByteString
203+string s = Parser $ \(S sb lb n) ->
204+ let bs = sb +: lb
205+ l = LB.length s
206+ (h, t) = LB.splitAt l bs
207+ in if s == h
208+ then Right (s, mkState t (n + l))
209+ else Left (bs, [])
210+{-# INLINE string #-}
211+
212+-- | Satisfy a literal string, after applying a transformation to both
213+-- it and the matching text.
214+stringTransform :: (LB.ByteString -> LB.ByteString) -> LB.ByteString
215+ -> Parser LB.ByteString
216+stringTransform f s = Parser $ \(S sb lb n) ->
217+ let bs = sb +: lb
218+ l = LB.length s
219+ (h, t) = LB.splitAt l bs
220+ in if fs == f h
221+ then Right (s, mkState t (n + l))
222+ else Left (bs, [])
223+ where fs = f s
224+{-# INLINE stringTransform #-}
225+
226+-- | Apply the given parser repeatedly, returning every parse result.
227+count :: Int -> Parser a -> Parser [a]
228+count n p = sequence (replicate n p)
229+{-# INLINE count #-}
230+
231+try :: Parser a -> Parser a
232+try p = Parser $ \s@(S sb lb _) ->
233+ case unParser p s of
234+ Left (_, msgs) -> Left (sb +: lb, msgs)
235+ ok -> ok
236+
237+-- | Detect 'end of file'.
238+eof :: Parser ()
239+eof = Parser $ \s@(S sb lb _) -> if SB.null sb && LB.null lb
240+ then Right ((), s)
241+ else Left (sb +: lb, ["EOF"])
242+
243+takeAll :: Parser LB.ByteString
244+takeAll = Parser $ \(S sb lb n) ->
245+ let bs = sb +: lb
246+ in Right (bs, mkState LB.empty (n + LB.length bs))
247+
248+oneChunk :: SB.ByteString -> LB.ByteString
249+oneChunk s = LB.Chunk s LB.Empty
250+
251+length64 :: SB.ByteString -> Int64
252+length64 = fromIntegral . SB.length
253+
254+-- | Consume characters while the predicate is true.
255+takeWhile :: (Word8 -> Bool) -> Parser LB.ByteString
256+takeWhile p = Parser $ \s@(S sb lb n) ->
257+ let (h, t) = SB.span p sb
258+ in if SB.null t
259+ then unParser ((h +:) <$> (nextChunk *> takeWhile p)) s
260+ else Right (oneChunk h, S t lb (n + length64 h))
261+{-# INLINE takeWhile #-}
262+
263+takeTill :: (Word8 -> Bool) -> Parser LB.ByteString
264+takeTill p = takeWhile (not . p) <* satisfy p
265+{-# INLINE takeTill #-}
266+
267+takeWhile1 :: (Word8 -> Bool) -> Parser LB.ByteString
268+takeWhile1 p = Parser $ \s@(S sb lb n) ->
269+ let (h, t) = SB.span p sb
270+ in if SB.null t
271+ then case unParser (nextChunk *> takeWhile p) s of
272+ Left err -> Left err
273+ Right (xs, s') ->
274+ let bs = h +: xs
275+ in if LB.null bs
276+ then Left (sb +: lb, [])
277+ else Right (bs, s')
278+ else Right (oneChunk h, S t lb (n + length64 h))
279+{-# INLINE takeWhile1 #-}
280+
281+-- | Skip over characters while the predicate is true.
282+skipWhile :: (Word8 -> Bool) -> Parser ()
283+skipWhile p = takeWhile p >> return ()
284+{-# INLINE skipWhile #-}
285+
286+manyTill :: Parser a -> Parser b -> Parser [a]
287+manyTill p end = scan
288+ where scan = (end >> return []) <|> liftM2 (:) p scan
289+
290+-- |'skipMany' - skip zero or many instances of the parser
291+skipMany :: Parser a -> Parser ()
292+skipMany p = scan
293+ where scan = (p >> scan) <|> return ()
294+
295+-- |'skipMany1' - skip one or many instances of the parser
296+skipMany1 :: Parser a -> Parser ()
297+skipMany1 p = p >> skipMany p
298+
299+-- | Test that a parser returned a non-null ByteString.
300+notEmpty :: Parser LB.ByteString -> Parser LB.ByteString
301+notEmpty p = Parser $ \s ->
302+ case unParser p s of
303+ o@(Right (a, _)) ->
304+ if LB.null a
305+ then Left (a, ["notEmpty"])
306+ else o
307+ x -> x
308+
309+-- | Parse some input with the given parser and return that input
310+-- without copying it.
311+match :: Parser a -> Parser LB.ByteString
312+match p = do bs <- getInput
313+ start <- getConsumed
314+ p
315+ end <- getConsumed
316+ return (LB.take (end - start) bs)
317+
318+eitherP :: Parser a -> Parser b -> Parser (Either a b)
319+eitherP a b = (Left <$> a) <|> (Right <$> b)
320+{-# INLINE eitherP #-}
321+
322+peek :: Parser a -> Parser (Maybe a)
323+peek p = Parser $ \s ->
324+ case unParser p s of
325+ Right (m, _) -> Right (Just m, s)
326+ _ -> Right (Nothing, s)
327+
328+lookAhead :: Parser a -> Parser a
329+lookAhead p = Parser $ \s ->
330+ case unParser p s of
331+ Right (m, _) -> Right (m, s)
332+ Left (e, bs) -> Left (e, bs)
333+
334+parseAt :: Parser a -> LB.ByteString -> Int64
335+ -> (LB.ByteString, Either ParseError (a, Int64))
336+parseAt p bs n =
337+ case unParser p (mkState bs n) of
338+ Left (bs', msg) -> (bs', Left $ showError msg)
339+ Right (a, S sb lb n') -> (sb +: lb, Right (a, n'))
340+ where
341+ showError [msg] = "Parser error, expected:\n" ++ msg ++ "\n"
342+ showError msgs = "Parser error, expected one of:\n" ++ unlines msgs
343+
344+-- | Run a parser.
345+parse :: Parser a -> LB.ByteString
346+ -> (LB.ByteString, Either ParseError a)
347+parse p bs = case parseAt p bs 0 of
348+ (bs', Right (a, _)) -> (bs', Right a)
349+ (bs', Left err) -> (bs', Left err)
350+
351+parseTest :: (Show a) => Parser a -> LB.ByteString -> IO ()
352+parseTest p s =
353+ case parse p s of
354+ (st, Left msg) -> putStrLn $ msg ++ "\nGot:\n" ++ show st
355+ (_, Right r) -> print r
src/Text/ParserCombinators/ByteStringParser.hsnew file+391
@@ -0,0 +1,391 @@
1+-----------------------------------------------------------------------------
2+-- |
3+-- Module : Text.ParserCombinators.ByteStringParser
4+-- Copyright : Daan Leijen 1999-2001, Jeremy Shaw 2006, Bryan O'Sullivan 2007-2008
5+-- License : BSD3
6+--
7+-- Maintainer : bos@serpentine.com
8+-- Stability : experimental
9+-- Portability : unknown
10+--
11+-- Simple, efficient parser combinators for lazy 'LB.ByteString'
12+-- strings, loosely based on 'Text.ParserCombinators.Parsec'.
13+--
14+-----------------------------------------------------------------------------
15+module Text.ParserCombinators.ByteStringParser
16+ (
17+ -- * Parser
18+ ParseError
19+ , Parser
20+
21+ -- * Running parsers
22+ , parse
23+ , parseAt
24+ , parseTest
25+
26+ -- * Combinators
27+ , (<?>)
28+
29+ -- * Things vaguely like those in @Parsec.Combinator@ (and @Parsec.Prim@)
30+ , try
31+ , manyTill
32+ , eof
33+ , skipMany
34+ , skipMany1
35+ , count
36+ , lookAhead
37+ , peek
38+ , sepBy
39+ , sepBy1
40+
41+ -- * Things like in @Parsec.Char@
42+ , satisfy
43+ , letter
44+ , digit
45+ , anyChar
46+ , space
47+ , char
48+ , notChar
49+ , string
50+ , stringCI
51+
52+ -- * Parser converters.
53+ , eitherP
54+
55+ -- * Miscellaneous functions.
56+ , getInput
57+ , getConsumed
58+ , takeWhile
59+ , takeWhile1
60+ , takeTill
61+ , takeAll
62+ , skipWhile
63+ , skipSpace
64+ , notEmpty
65+ , match
66+ , inClass
67+ , notInClass
68+ ) where
69+
70+import Control.Applicative (Alternative(..), Applicative(..), (<$>), (<*), (*>))
71+import Control.Monad (MonadPlus(..), ap, liftM2)
72+import Control.Monad.Fix (MonadFix(..))
73+import qualified Data.ByteString.Char8 as SB
74+import qualified Data.ByteString.Lazy.Char8 as LB
75+import qualified Data.ByteString.Lazy.Internal as LB
76+import Data.Char (isDigit, isLetter, isSpace, toLower)
77+import Data.Int (Int64)
78+import Text.ParserCombinators.ByteStringParser.FastSet (FastSet, member, set)
79+import Prelude hiding (takeWhile)
80+
81+type ParseError = String
82+
83+data S = S {-# UNPACK #-} !SB.ByteString
84+ LB.ByteString
85+ {-# UNPACK #-} !Int64
86+
87+newtype Parser a = Parser {
88+ unParser :: S -> Either (LB.ByteString, [String]) (a, S)
89+ }
90+
91+instance Functor Parser where
92+ fmap f p =
93+ Parser $ \s ->
94+ case unParser p s of
95+ Right (a, s') -> Right (f a, s')
96+ Left err -> Left err
97+
98+instance Monad Parser where
99+ return a = Parser $ \s -> Right (a, s)
100+ m >>= f = Parser $ \s ->
101+ case unParser m s of
102+ Right (a, s') -> unParser (f a) s'
103+ Left (s', msgs) -> Left (s', msgs)
104+ fail err = Parser $ \(S sb lb _) -> Left (sb +: lb, [err])
105+
106+instance MonadFix Parser where
107+ mfix f = Parser $ \s ->
108+ let r = case r of
109+ Right (a, _) -> unParser (f a) s
110+ err -> err
111+ in r
112+
113+zero :: Parser a
114+zero = Parser $ \(S sb lb _) -> Left (sb +: lb, [])
115+{-# INLINE zero #-}
116+
117+plus :: Parser a -> Parser a -> Parser a
118+plus p1 p2 =
119+ Parser $ \s@(S sb lb _) ->
120+ case unParser p1 s of
121+ Left (_, msgs1) ->
122+ case unParser p2 s of
123+ Left (_, msgs2) -> Left (sb +: lb, (msgs1 ++ msgs2))
124+ ok -> ok
125+ ok -> ok
126+{-# INLINE plus #-}
127+
128+instance MonadPlus Parser where
129+ mzero = zero
130+ mplus = plus
131+
132+instance Applicative Parser where
133+ pure = return
134+ (<*>) = ap
135+
136+instance Alternative Parser where
137+ empty = zero
138+ (<|>) = plus
139+
140+mkState :: LB.ByteString -> Int64 -> S
141+mkState s = case s of
142+ LB.Empty -> S SB.empty s
143+ LB.Chunk x xs -> S x xs
144+
145+-- | Turn our chunked representation back into a normal lazy
146+-- ByteString.
147+(+:) :: SB.ByteString -> LB.ByteString -> LB.ByteString
148+sb +: lb | SB.null sb = lb
149+ | otherwise = LB.Chunk sb lb
150+{-# INLINE (+:) #-}
151+
152+infix 0 <?>
153+
154+-- | Name the parser.
155+(<?>) :: Parser a -> String -> Parser a
156+p <?> msg =
157+ Parser $ \s@(S sb lb _) ->
158+ case unParser p s of
159+ (Left _) -> Left (sb +: lb, [msg])
160+ ok -> ok
161+{-# INLINE (<?>) #-}
162+
163+nextChunk :: Parser ()
164+nextChunk = Parser $ \(S _ lb n) ->
165+ case lb of
166+ LB.Chunk sb' lb' -> Right ((), S sb' lb' n)
167+ LB.Empty -> Left (lb, [])
168+
169+-- | Get remaining input.
170+getInput :: Parser LB.ByteString
171+getInput = Parser $ \s@(S sb lb _) -> Right (sb +: lb, s)
172+
173+-- | Get number of bytes consumed so far.
174+getConsumed :: Parser Int64
175+getConsumed = Parser $ \s@(S _ _ n) -> Right (n, s)
176+
177+-- | Character parser.
178+satisfy :: (Char -> Bool) -> Parser Char
179+satisfy p =
180+ Parser $ \s@(S sb lb n) ->
181+ case SB.uncons sb of
182+ Just (c, sb') | p c -> Right (c, S sb' lb (n + 1))
183+ | otherwise -> Left (sb +: lb, [])
184+ Nothing -> unParser (nextChunk >> satisfy p) s
185+{-# INLINE satisfy #-}
186+
187+letter :: Parser Char
188+letter = satisfy isLetter <?> "letter"
189+{-# INLINE letter #-}
190+
191+digit :: Parser Char
192+digit = satisfy isDigit <?> "digit"
193+{-# INLINE digit #-}
194+
195+anyChar :: Parser Char
196+anyChar = satisfy $ const True
197+{-# INLINE anyChar #-}
198+
199+space :: Parser Char
200+space = satisfy isSpace <?> "space"
201+{-# INLINE space #-}
202+
203+-- | Satisfy a specific character.
204+char :: Char -> Parser Char
205+char c = satisfy (== c) <?> [c]
206+{-# INLINE char #-}
207+
208+-- | Satisfy a specific character.
209+notChar :: Char -> Parser Char
210+notChar c = satisfy (/= c) <?> "not " ++ [c]
211+{-# INLINE notChar #-}
212+
213+charClass :: String -> FastSet
214+charClass = set . SB.pack . go
215+ where go (a:'-':b:xs) = [a..b] ++ go xs
216+ go (x:xs) = x : go xs
217+ go _ = ""
218+
219+inClass :: String -> Char -> Bool
220+inClass s = (`member` myset)
221+ where myset = charClass s
222+{-# INLINE inClass #-}
223+
224+notInClass :: String -> Char -> Bool
225+notInClass s = not . inClass s
226+{-# INLINE notInClass #-}
227+
228+sepBy :: Parser a -> Parser s -> Parser [a]
229+sepBy p s = liftM2 (:) p ((s >> sepBy1 p s) <|> return []) <|> return []
230+
231+sepBy1 :: Parser a -> Parser s -> Parser [a]
232+sepBy1 p s = liftM2 (:) p ((s >> sepBy1 p s) <|> return [])
233+
234+-- | Satisfy a literal string.
235+string :: LB.ByteString -> Parser LB.ByteString
236+string s = Parser $ \(S sb lb n) ->
237+ let bs = sb +: lb
238+ l = LB.length s
239+ (h, t) = LB.splitAt l bs
240+ in if s == h
241+ then Right (s, mkState t (n + l))
242+ else Left (bs, [])
243+{-# INLINE string #-}
244+
245+-- | Satisfy a literal string, ignoring case.
246+stringCI :: LB.ByteString -> Parser LB.ByteString
247+stringCI s = Parser $ \(S sb lb n) ->
248+ let bs = sb +: lb
249+ l = LB.length s
250+ (h, t) = LB.splitAt l bs
251+ in if ls == LB.map toLower h
252+ then Right (s, mkState t (n + l))
253+ else Left (bs, [])
254+ where ls = LB.map toLower s
255+{-# INLINE stringCI #-}
256+
257+-- | Apply the given parser repeatedly, returning every parse result.
258+count :: Int -> Parser a -> Parser [a]
259+count n p = sequence (replicate n p)
260+{-# INLINE count #-}
261+
262+try :: Parser a -> Parser a
263+try p = Parser $ \s@(S sb lb _) ->
264+ case unParser p s of
265+ Left (_, msgs) -> Left (sb +: lb, msgs)
266+ ok -> ok
267+
268+-- | Detect 'end of file'.
269+eof :: Parser ()
270+eof = Parser $ \s@(S sb lb _) -> if SB.null sb && LB.null lb
271+ then Right ((), s)
272+ else Left (sb +: lb, ["EOF"])
273+
274+takeAll :: Parser LB.ByteString
275+takeAll = Parser $ \(S sb lb n) ->
276+ let bs = sb +: lb
277+ in Right (bs, mkState LB.empty (n + LB.length bs))
278+
279+oneChunk :: SB.ByteString -> LB.ByteString
280+oneChunk s = LB.Chunk s LB.Empty
281+
282+length64 :: SB.ByteString -> Int64
283+length64 = fromIntegral . SB.length
284+
285+-- | Consume characters while the predicate is true.
286+takeWhile :: (Char -> Bool) -> Parser LB.ByteString
287+takeWhile p = Parser $ \s@(S sb lb n) ->
288+ let (h, t) = SB.span p sb
289+ in if SB.null t
290+ then unParser ((h +:) <$> (nextChunk *> takeWhile p)) s
291+ else Right (oneChunk h, S t lb (n + length64 h))
292+{-# INLINE takeWhile #-}
293+
294+takeTill :: (Char -> Bool) -> Parser LB.ByteString
295+takeTill p = takeWhile (not . p) <* satisfy p
296+{-# INLINE takeTill #-}
297+
298+takeWhile1 :: (Char -> Bool) -> Parser LB.ByteString
299+takeWhile1 p = Parser $ \s@(S sb lb n) ->
300+ let (h, t) = SB.span p sb
301+ in if SB.null t
302+ then case unParser (nextChunk *> takeWhile p) s of
303+ Left err -> Left err
304+ Right (xs, s') ->
305+ let bs = h +: xs
306+ in if LB.null bs
307+ then Left (sb +: lb, [])
308+ else Right (bs, s')
309+ else Right (oneChunk h, S t lb (n + length64 h))
310+{-# INLINE takeWhile1 #-}
311+
312+-- | Skip over characters while the predicate is true.
313+skipWhile :: (Char -> Bool) -> Parser ()
314+skipWhile p = takeWhile p >> return ()
315+{-# INLINE skipWhile #-}
316+
317+-- | Skip over white space.
318+skipSpace :: Parser ()
319+skipSpace = takeWhile isSpace >> return ()
320+{-# INLINE skipSpace #-}
321+
322+manyTill :: Parser a -> Parser b -> Parser [a]
323+manyTill p end = scan
324+ where scan = (end >> return []) <|> liftM2 (:) p scan
325+
326+-- |'skipMany' - skip zero or many instances of the parser
327+skipMany :: Parser a -> Parser ()
328+skipMany p = scan
329+ where scan = (p >> scan) <|> return ()
330+
331+-- |'skipMany1' - skip one or many instances of the parser
332+skipMany1 :: Parser a -> Parser ()
333+skipMany1 p = p >> skipMany p
334+
335+-- | Test that a parser returned a non-null ByteString.
336+notEmpty :: Parser LB.ByteString -> Parser LB.ByteString
337+notEmpty p = Parser $ \s ->
338+ case unParser p s of
339+ o@(Right (a, _)) ->
340+ if LB.null a
341+ then Left (a, ["notEmpty"])
342+ else o
343+ x -> x
344+
345+-- | Parse some input with the given parser and return that input
346+-- without copying it.
347+match :: Parser a -> Parser LB.ByteString
348+match p = do bs <- getInput
349+ start <- getConsumed
350+ p
351+ end <- getConsumed
352+ return (LB.take (end - start) bs)
353+
354+eitherP :: Parser a -> Parser b -> Parser (Either a b)
355+eitherP a b = (Left <$> a) <|> (Right <$> b)
356+{-# INLINE eitherP #-}
357+
358+peek :: Parser a -> Parser (Maybe a)
359+peek p = Parser $ \s ->
360+ case unParser p s of
361+ Right (m, _) -> Right (Just m, s)
362+ _ -> Right (Nothing, s)
363+
364+lookAhead :: Parser a -> Parser a
365+lookAhead p = Parser $ \s ->
366+ case unParser p s of
367+ Right (m, _) -> Right (m, s)
368+ Left (e, bs) -> Left (e, bs)
369+
370+parseAt :: Parser a -> LB.ByteString -> Int64
371+ -> (LB.ByteString, Either ParseError (a, Int64))
372+parseAt p bs n =
373+ case unParser p (mkState bs n) of
374+ Left (bs', msg) -> (bs', Left $ showError msg)
375+ Right (a, S sb lb n') -> (sb +: lb, Right (a, n'))
376+ where
377+ showError [msg] = "Parser error, expected:\n" ++ msg ++ "\n"
378+ showError msgs = "Parser error, expected one of:\n" ++ unlines msgs
379+
380+-- | Run a parser.
381+parse :: Parser a -> LB.ByteString
382+ -> (LB.ByteString, Either ParseError a)
383+parse p bs = case parseAt p bs 0 of
384+ (bs', Right (a, _)) -> (bs', Right a)
385+ (bs', Left err) -> (bs', Left err)
386+
387+parseTest :: (Show a) => Parser a -> LB.ByteString -> IO ()
388+parseTest p s =
389+ case parse p s of
390+ (st, Left msg) -> putStrLn $ msg ++ "\nGot:\n" ++ show st
391+ (_, Right r) -> print r
src/Text/ParserCombinators/ByteStringParser/FastSet.hsnew file+96
@@ -0,0 +1,96 @@
1+{-# LANGUAGE BangPatterns #-}
2+
3+-----------------------------------------------------------------------------
4+-- |
5+-- Module : Text.ParserCombinators.ByteStringParser.FastSet
6+-- Copyright : Bryan O'Sullivan 2008
7+-- License : BSD3
8+--
9+-- Maintainer : bos@serpentine.com
10+-- Stability : experimental
11+-- Portability : unknown
12+--
13+-- Fast 8-bit character set membership.
14+--
15+-----------------------------------------------------------------------------
16+module Text.ParserCombinators.ByteStringParser.FastSet
17+ (
18+ -- * Data type
19+ FastSet
20+ -- * Construction
21+ , set
22+ -- * Lookup
23+ , member
24+ , member8
25+ -- * Debugging
26+ , fromSet
27+ ) where
28+
29+import qualified Data.ByteString as B
30+-- import Data.ByteString.Char8 (pack)
31+import qualified Data.ByteString.Internal as I
32+import qualified Data.ByteString.Unsafe as U
33+import Data.Word (Word8)
34+import Foreign.Storable (peekByteOff, pokeByteOff)
35+
36+data FastSet = Sorted { fromSet :: {-# UNPACK #-} !B.ByteString }
37+ | Table { fromSet :: {-# UNPACK #-} !B.ByteString }
38+ deriving (Eq, Ord)
39+
40+instance Show FastSet where
41+ show (Sorted s) = "FastSet " ++ show s
42+ show (Table t) = "FastSet " ++ fromTable t
43+
44+-- | The lower bound on the size of a lookup table. We choose this to
45+-- balance table density against performance.
46+tableCutoff :: Int
47+tableCutoff = 32
48+
49+-- | Create a character set.
50+set :: B.ByteString -> FastSet
51+set s | B.length s < tableCutoff = Sorted . B.sort $ s
52+ | otherwise = Table . mkTable $ s
53+
54+-- | Check the table for membership.
55+member :: Char -> FastSet -> Bool
56+member c = member8 (I.c2w c)
57+
58+-- | Check the table for membership.
59+member8 :: Word8 -> FastSet -> Bool
60+member8 w (Table t) = U.unsafeIndex t (fromIntegral w) == entry
61+member8 w (Sorted s) = search 0 (B.length s - 1)
62+ where search !lo !hi
63+ | hi < lo = False
64+ | otherwise =
65+ let mid = (lo + hi) `div` 2
66+ in case compare w (U.unsafeIndex s mid) of
67+ GT -> search lo (mid - 1)
68+ LT -> search (mid + 1) hi
69+ _ -> True
70+
71+-- | The value in a table that indicates that a character is not
72+-- present. We avoid NUL to make the table representation printable.
73+noEntry :: Word8
74+noEntry = 0x5f
75+
76+-- | The value in a table that indicates that a character is present.
77+-- We use a printable character for readability.
78+entry :: Word8
79+entry = 0x21
80+
81+mkTable :: B.ByteString -> B.ByteString
82+mkTable s = I.unsafeCreate 256 $ \t -> do
83+ I.memset t noEntry 256
84+ U.unsafeUseAsCStringLen s $ \(p, l) ->
85+ let loop n | n == l = return ()
86+ | otherwise = do
87+ c <- peekByteOff p n :: IO Word8
88+ pokeByteOff t (fromIntegral c) entry
89+ loop (n + 1)
90+ in loop 0
91+
92+-- | Turn the table representation into a string, for debugging.
93+fromTable :: B.ByteString -> String
94+fromTable = snd . B.foldr go (0xff, [])
95+ where go c (!n, cs) | c == noEntry = (n - 1, cs)
96+ | otherwise = (n - 1, I.w2c n:cs)
tests/QC.hsdeleted−19
@@ -1,19 +0,0 @@
1−{-# OPTIONS_GHC -fno-warn-missing-signatures #-}
2−module Main (main) where
3−
4−import qualified QC.Buffer as Buffer
5−import qualified QC.ByteString as ByteString
6−import qualified QC.Combinator as Combinator
7−import qualified QC.Simple as Simple
8−import qualified QC.Text as Text
9−import Test.Tasty (defaultMain, testGroup)
10−
11−main = defaultMain tests
12−
13−tests = testGroup "tests" [
14− testGroup "bs" ByteString.tests
15− , testGroup "buf" Buffer.tests
16− , testGroup "combinator" Combinator.tests
17− , testGroup "simple" Simple.tests
18− , testGroup "text" Text.tests
19− ]
tests/QC/Buffer.hsdeleted−96
@@ -1,96 +0,0 @@
1−{-# LANGUAGE BangPatterns, CPP, FlexibleInstances, OverloadedStrings,
2− TypeSynonymInstances #-}
3−
4−module QC.Buffer (tests) where
5−
6−#if !MIN_VERSION_base(4,8,0)
7−import Control.Applicative ((<$>))
8−import Data.Monoid (Monoid(mconcat))
9−#endif
10−import QC.Common ()
11−import Test.Tasty (TestTree)
12−import Test.Tasty.QuickCheck (testProperty)
13−import Test.QuickCheck
14−import qualified Data.Attoparsec.ByteString.Buffer as BB
15−import qualified Data.Attoparsec.Text.Buffer as BT
16−import qualified Data.ByteString as B
17−import qualified Data.ByteString.Unsafe as B
18−import qualified Data.Text as T
19−import qualified Data.Text.Unsafe as T
20−
21−data BP t b = BP [t] !t !b
22− deriving (Eq, Show)
23−
24−type BPB = BP B.ByteString BB.Buffer
25−type BPT = BP T.Text BT.Buffer
26−
27−instance Arbitrary BPB where
28− arbitrary = do
29− bss <- arbitrary
30− return $! toBP BB.buffer bss
31−
32− shrink (BP bss _ _) = toBP BB.buffer <$> shrink bss
33−
34−instance Arbitrary BPT where
35− arbitrary = do
36− bss <- arbitrary
37− return $! toBP BT.buffer bss
38−
39− shrink (BP bss _ _) = toBP BT.buffer <$> shrink bss
40−
41−toBP :: (Monoid a, Monoid b) => (a -> b) -> [a] -> BP a b
42−toBP buf bss = BP bss (mconcat bss) (mconcat (map buf bss))
43−
44−b_unbuffer :: BPB -> Property
45−b_unbuffer (BP _ts t buf) = t === BB.unbuffer buf
46−
47−t_unbuffer :: BPT -> Property
48−t_unbuffer (BP _ts t buf) = t === BT.unbuffer buf
49−
50−b_length :: BPB -> Property
51−b_length (BP _ts t buf) = B.length t === BB.length buf
52−
53−t_length :: BPT -> Property
54−t_length (BP _ts t buf) = T.lengthWord16 t === BT.length buf
55−
56−b_unsafeIndex :: BPB -> Gen Property
57−b_unsafeIndex (BP _ts t buf) = do
58− let l = B.length t
59− i <- choose (0,l-1)
60− return $ l === 0 .||. B.unsafeIndex t i === BB.unsafeIndex buf i
61−
62−t_iter :: BPT -> Gen Property
63−t_iter (BP _ts t buf) = do
64− let l = T.lengthWord16 t
65− i <- choose (0,l-1)
66− let it (T.Iter c q) = (c,q)
67− return $ l === 0 .||. it (T.iter t i) === it (BT.iter buf i)
68−
69−t_iter_ :: BPT -> Gen Property
70−t_iter_ (BP _ts t buf) = do
71− let l = T.lengthWord16 t
72− i <- choose (0,l-1)
73− return $ l === 0 .||. T.iter_ t i === BT.iter_ buf i
74−
75−b_unsafeDrop :: BPB -> Gen Property
76−b_unsafeDrop (BP _ts t buf) = do
77− i <- choose (0, B.length t)
78− return $ B.unsafeDrop i t === BB.unsafeDrop i buf
79−
80−t_dropWord16 :: BPT -> Gen Property
81−t_dropWord16 (BP _ts t buf) = do
82− i <- choose (0, T.lengthWord16 t)
83− return $ T.dropWord16 i t === BT.dropWord16 i buf
84−
85−tests :: [TestTree]
86−tests = [
87− testProperty "b_unbuffer" b_unbuffer
88− , testProperty "t_unbuffer" t_unbuffer
89− , testProperty "b_length" b_length
90− , testProperty "t_length" t_length
91− , testProperty "b_unsafeIndex" b_unsafeIndex
92− , testProperty "t_iter" t_iter
93− , testProperty "t_iter_" t_iter_
94− , testProperty "b_unsafeDrop" b_unsafeDrop
95− , testProperty "t_dropWord16" t_dropWord16
96− ]
tests/QC/ByteString.hsdeleted−187
@@ -1,187 +0,0 @@
1−{-# LANGUAGE BangPatterns, CPP, OverloadedStrings #-}
2−module QC.ByteString (tests) where
3−
4−#if !MIN_VERSION_base(4,8,0)
5−import Control.Applicative ((<*>), (<$>))
6−#endif
7−import Data.Char (chr, ord, toUpper)
8−import Data.Int (Int64)
9−import Data.Word (Word8)
10−import Prelude hiding (take, takeWhile)
11−import QC.Common (ASCII(..), liftOp, parseBS, toStrictBS)
12−import Test.Tasty (TestTree)
13−import Test.Tasty.QuickCheck (testProperty)
14−import Test.QuickCheck
15−import qualified Data.Attoparsec.ByteString as P
16−import qualified Data.Attoparsec.ByteString.Char8 as P8
17−import qualified Data.Attoparsec.ByteString.FastSet as S
18−import qualified Data.Attoparsec.ByteString.Lazy as PL
19−import qualified Data.ByteString as B
20−import qualified Data.ByteString.Char8 as B8
21−import qualified Data.ByteString.Lazy as L
22−import qualified Data.ByteString.Lazy.Char8 as L8
23−
24−-- Basic byte-level combinators.
25−
26−satisfy :: Word8 -> L.ByteString -> Property
27−satisfy w s = parseBS (P.satisfy (<=w)) (L.cons w s) === Just w
28−
29−satisfyWith :: Word8 -> L.ByteString -> Property
30−satisfyWith w s = parseBS (P.satisfyWith (chr . fromIntegral) (<=c))
31− (L.cons (fromIntegral (ord c)) s) === Just c
32− where
33− c = chr (fromIntegral w)
34−
35−word8 :: Word8 -> L.ByteString -> Property
36−word8 w s = parseBS (P.word8 w) (L.cons w s) === Just w
37−
38−skip :: Word8 -> L.ByteString -> Property
39−skip w s =
40− case (parseBS (P.skip (<w)) s, L.uncons s) of
41− (Nothing, mcs) -> maybe (property True) (expectFailure . it) mcs
42− (Just _, mcs) -> maybe (property False) it mcs
43− where it cs = liftOp "<" (<) (fst cs) w
44−
45−anyWord8 :: L.ByteString -> Property
46−anyWord8 s
47− | L.null s = p === Nothing
48− | otherwise = p === Just (L.head s)
49− where p = parseBS P.anyWord8 s
50−
51−notWord8 :: Word8 -> NonEmptyList Word8 -> Property
52−notWord8 w (NonEmpty s) = parseBS (P.notWord8 w) bs === if v == w
53− then Nothing
54− else Just v
55− where v = L.head bs
56− bs = L.pack s
57−
58−peekWord8 :: L.ByteString -> Property
59−peekWord8 s
60− | L.null s = p === Just (Nothing, s)
61− | otherwise = p === Just (Just (L.head s), s)
62− where p = parseBS ((,) <$> P.peekWord8 <*> P.takeLazyByteString) s
63−
64−peekWord8' :: L.ByteString -> Property
65−peekWord8' s = parseBS P.peekWord8' s === (fst <$> L.uncons s)
66−
67−string :: L.ByteString -> L.ByteString -> Property
68−string s t = parseBS (P.string s') (s `L.append` t) === Just s'
69− where s' = toStrictBS s
70−
71−stringCI :: ASCII L.ByteString -> ASCII L.ByteString -> Property
72−stringCI (ASCII s) (ASCII t) =
73− parseBS (P8.stringCI up) (s `L.append` t) === Just s'
74− where s' = toStrictBS s
75− up = B8.map toUpper s'
76−
77−strings :: L.ByteString -> L.ByteString -> L.ByteString -> Property
78−strings s t u =
79− parseBS (P.string (toStrictBS s) >> P.string t') (L.concat [s,t,u])
80− === Just t'
81− where t' = toStrictBS t
82−
83−skipWhile :: Word8 -> L.ByteString -> Property
84−skipWhile w s =
85− let t = L.dropWhile (<=w) s
86− in case PL.parse (P.skipWhile (<=w)) s of
87− PL.Done t' () -> t === t'
88− _ -> property False
89−
90−takeCount :: Positive Int -> L.ByteString -> Property
91−takeCount (Positive k) s =
92− case parseBS (P.take k) s of
93− Nothing -> liftOp ">" (>) (fromIntegral k) (L.length s)
94− Just _s -> liftOp "<=" (<=) (fromIntegral k) (L.length s)
95−
96−takeWhile :: Word8 -> L.ByteString -> Property
97−takeWhile w s =
98− let (h,t) = L.span (==w) s
99− in case PL.parse (P.takeWhile (==w)) s of
100− PL.Done t' h' -> t === t' .&&. toStrictBS h === h'
101− _ -> property False
102−
103−take :: Int -> L.ByteString -> Property
104−take n s = maybe (property $ L.length s < fromIntegral n)
105− (=== B.take n (toStrictBS s)) $
106− parseBS (P.take n) s
107−
108−takeByteString :: L.ByteString -> Property
109−takeByteString s = maybe (property False) (=== toStrictBS s) .
110− parseBS P.takeByteString $ s
111−
112−takeLazyByteString :: L.ByteString -> Property
113−takeLazyByteString s = maybe (property False) (=== s) .
114− parseBS P.takeLazyByteString $ s
115−
116−takeWhile1 :: Word8 -> L.ByteString -> Property
117−takeWhile1 w s =
118− let s' = L.cons w s
119− (h,t) = L.span (<=w) s'
120− in case PL.parse (P.takeWhile1 (<=w)) s' of
121− PL.Done t' h' -> t === t' .&&. toStrictBS h === h'
122− _ -> property False
123−
124−takeTill :: Word8 -> L.ByteString -> Property
125−takeTill w s =
126− let (h,t) = L.break (==w) s
127− in case PL.parse (P.takeTill (==w)) s of
128− PL.Done t' h' -> t === t' .&&. toStrictBS h === h'
129− _ -> property False
130−
131−takeWhile1_empty :: Property
132−takeWhile1_empty = parseBS (P.takeWhile1 undefined) L.empty === Nothing
133−
134−endOfInput :: L.ByteString -> Property
135−endOfInput s = parseBS P.endOfInput s === if L.null s
136− then Just ()
137− else Nothing
138−
139−endOfLine :: L.ByteString -> Property
140−endOfLine s =
141− case (parseBS P8.endOfLine s, L8.uncons s) of
142− (Nothing, mcs) -> maybe (property True) (expectFailure . eol) mcs
143− (Just _, mcs) -> maybe (property False) eol mcs
144− where eol (c,s') = c === '\n' .||.
145− (c, fst <$> L8.uncons s') === ('\r', Just '\n')
146−
147−scan :: L.ByteString -> Positive Int64 -> Property
148−scan s (Positive k) = parseBS p s === Just (toStrictBS $ L.take k s)
149− where p = P.scan k $ \ n _ ->
150− if n > 0 then let !n' = n - 1 in Just n' else Nothing
151−
152−members :: [Word8] -> Property
153−members s = property $ all (`S.memberWord8` set) s
154− where set = S.fromList s
155−
156−nonmembers :: [Word8] -> [Word8] -> Property
157−nonmembers s s' = property . not . any (`S.memberWord8` set) $ filter (not . (`elem` s)) s'
158− where set = S.fromList s
159−
160−tests :: [TestTree]
161−tests = [
162− testProperty "anyWord8" anyWord8
163− , testProperty "endOfInput" endOfInput
164− , testProperty "endOfLine" endOfLine
165− , testProperty "notWord8" notWord8
166− , testProperty "peekWord8" peekWord8
167− , testProperty "peekWord8'" peekWord8'
168− , testProperty "satisfy" satisfy
169− , testProperty "satisfyWith" satisfyWith
170− , testProperty "scan" scan
171− , testProperty "skip" skip
172− , testProperty "skipWhile" skipWhile
173− , testProperty "string" string
174− , testProperty "stringCI" stringCI
175− , testProperty "strings" strings
176− , testProperty "take" take
177− , testProperty "takeByteString" takeByteString
178− , testProperty "takeCount" takeCount
179− , testProperty "takeLazyByteString" takeLazyByteString
180− , testProperty "takeTill" takeTill
181− , testProperty "takeWhile" takeWhile
182− , testProperty "takeWhile1" takeWhile1
183− , testProperty "takeWhile1_empty" takeWhile1_empty
184− , testProperty "word8" word8
185− , testProperty "members" members
186− , testProperty "nonmembers" nonmembers
187− ]
tests/QC/Combinator.hsdeleted−52
@@ -1,52 +0,0 @@
1−{-# LANGUAGE CPP, OverloadedStrings #-}
2−
3−module QC.Combinator where
4−
5−#if !MIN_VERSION_base(4,8,0)
6−import Control.Applicative ((<*>), (<$>), (<*), (*>))
7−#endif
8−import Data.Maybe (fromJust, isJust)
9−import Data.Word (Word8)
10−import QC.Common (Repack, parseBS, repackBS, toLazyBS)
11−import Test.Tasty (TestTree)
12−import Test.Tasty.QuickCheck (testProperty)
13−import Test.QuickCheck
14−import qualified Data.Attoparsec.ByteString.Char8 as P
15−import qualified Data.Attoparsec.Combinator as C
16−import qualified Data.ByteString as B
17−import qualified Data.ByteString.Char8 as B8
18−
19−choice :: NonEmptyList (NonEmptyList Word8) -> Gen Property
20−choice (NonEmpty xs) = do
21− let ys = map (B.pack . getNonEmpty) xs
22− return . forAll (repackBS <$> arbitrary <*> elements ys) $
23− maybe False (`elem` ys) . parseBS (C.choice (map P.string ys))
24−
25−count :: Positive (Small Int) -> Repack -> B.ByteString -> Bool
26−count (Positive (Small n)) rs s =
27− (length <$> parseBS (C.count n (P.string s)) input) == Just n
28− where input = repackBS rs (B.concat (replicate (n+1) s))
29−
30−lookAhead :: NonEmptyList Word8 -> Bool
31−lookAhead (NonEmpty xs) =
32− let ys = B.pack xs
33− withLookAheadThenConsume = (\x y -> (x, y)) <$> C.lookAhead (P.string ys) <*> P.string ys
34− mr = parseBS withLookAheadThenConsume $ toLazyBS ys
35− in isJust mr && fst (fromJust mr) == snd (fromJust mr)
36−
37−match :: Int -> NonNegative Int -> NonNegative Int -> Repack -> Bool
38−match n (NonNegative x) (NonNegative y) rs =
39− parseBS (P.match parser) (repackBS rs input) == Just (input, n)
40− where parser = P.skipWhile (=='x') *> P.signed P.decimal <*
41− P.skipWhile (=='y')
42− input = B.concat [
43− B8.replicate x 'x', B8.pack (show n), B8.replicate y 'y'
44− ]
45−
46−tests :: [TestTree]
47−tests = [
48− testProperty "choice" choice
49− , testProperty "count" count
50− , testProperty "lookAhead" lookAhead
51− , testProperty "match" match
52− ]
tests/QC/Common.hsdeleted−113
@@ -1,113 +0,0 @@
1−{-# LANGUAGE CPP, FlexibleInstances #-}
2−{-# OPTIONS_GHC -fno-warn-orphans #-}
3−module QC.Common
4− (
5− ASCII(..)
6− , parseBS
7− , parseT
8− , toLazyBS
9− , toStrictBS
10− , Repack
11− , repackBS
12− , repackBS_
13− , repackT
14− , repackT_
15− , liftOp
16− ) where
17−
18−#if !MIN_VERSION_base(4,8,0)
19−import Control.Applicative ((<*>), (<$>))
20−#endif
21−import Data.Char (isAlpha)
22−import Test.QuickCheck
23−import Test.QuickCheck.Unicode (shrinkChar, string)
24−import qualified Data.ByteString as B
25−import qualified Data.ByteString.Lazy as BL
26−import qualified Data.Text as T
27−import qualified Data.Text.Lazy as TL
28−import qualified Data.Attoparsec.ByteString.Lazy as BL
29−import qualified Data.Attoparsec.Text.Lazy as TL
30−
31−#if !MIN_VERSION_base(4,4,0)
32−-- This should really be a dependency on the random package :-(
33−instance Random Word8 where
34− randomR = integralRandomR
35− random = randomR (minBound,maxBound)
36−
37−instance Arbitrary Word8 where
38− arbitrary = choose (minBound, maxBound)
39−#endif
40−
41−parseBS :: BL.Parser r -> BL.ByteString -> Maybe r
42−parseBS p = BL.maybeResult . BL.parse p
43−
44−parseT :: TL.Parser r -> TL.Text -> Maybe r
45−parseT p = TL.maybeResult . TL.parse p
46−
47−toStrictBS :: BL.ByteString -> B.ByteString
48−toStrictBS = B.concat . BL.toChunks
49−
50−toLazyBS :: B.ByteString -> BL.ByteString
51−toLazyBS = BL.fromChunks . (:[])
52−
53−instance Arbitrary B.ByteString where
54− arbitrary = B.pack <$> arbitrary
55− shrink = map B.pack . shrink . B.unpack
56−
57−instance Arbitrary BL.ByteString where
58− arbitrary = repackBS <$> arbitrary <*> arbitrary
59− shrink = map BL.pack . shrink . BL.unpack
60−
61−newtype ASCII a = ASCII { fromASCII :: a }
62− deriving (Eq, Ord, Show)
63−
64−instance Arbitrary (ASCII B.ByteString) where
65− arbitrary = (ASCII . B.pack) <$> listOf (choose (0,127))
66− shrink = map (ASCII . B.pack) . shrink . B.unpack . fromASCII
67−
68−instance Arbitrary (ASCII BL.ByteString) where
69− arbitrary = ASCII <$> (repackBS <$> arbitrary <*> (fromASCII <$> arbitrary))
70− shrink = map (ASCII . BL.pack) . shrink . BL.unpack . fromASCII
71−
72−type Repack = NonEmptyList (Positive (Small Int))
73−
74−repackBS :: Repack -> B.ByteString -> BL.ByteString
75−repackBS (NonEmpty bs) =
76− BL.fromChunks . repackBS_ (map (getSmall . getPositive) bs)
77−
78−repackBS_ :: [Int] -> B.ByteString -> [B.ByteString]
79−repackBS_ = go . cycle
80− where go (b:bs) s
81− | B.null s = []
82− | otherwise = let (h,t) = B.splitAt b s
83− in h : go bs t
84− go _ _ = error "unpossible"
85−
86−instance Arbitrary T.Text where
87− arbitrary = T.pack <$> string
88− shrink = map T.pack . shrinkList shrinkChar . T.unpack
89−
90−instance Arbitrary TL.Text where
91− arbitrary = TL.pack <$> string
92− shrink = map TL.pack . shrinkList shrinkChar . TL.unpack
93−
94−repackT :: Repack -> T.Text -> TL.Text
95−repackT (NonEmpty bs) =
96− TL.fromChunks . repackT_ (map (getSmall . getPositive) bs)
97−
98−repackT_ :: [Int] -> T.Text -> [T.Text]
99−repackT_ = go . cycle
100− where go (b:bs) s
101− | T.null s = []
102− | otherwise = let (h,t) = T.splitAt b s
103− in h : go bs t
104− go _ _ = error "unpossible"
105−
106−liftOp :: (Show a, Testable prop) =>
107− String -> (a -> a -> prop) -> a -> a -> Property
108−liftOp name f x y = counterexample desc (f x y)
109− where op = case name of
110− (c:_) | isAlpha c -> " `" ++ name ++ "` "
111− | otherwise -> " " ++ name ++ " "
112− _ -> " ??? "
113− desc = "not (" ++ show x ++ op ++ show y ++ ")"
tests/QC/IPv6/Internal.hsdeleted−316
@@ -1,316 +0,0 @@
1−-- -----------------------------------------------------------------------------
2−
3−-- |
4−-- Module : Text.IPv6Addr
5−-- Copyright : Copyright © Michel Boucey 2011-2015
6−-- License : BSD-Style
7−-- Maintainer : michel.boucey@gmail.com
8−--
9−-- Dealing with IPv6 address text representations, canonization and manipulations.
10−--
11−
12−-- -----------------------------------------------------------------------------
13−
14−{-# LANGUAGE OverloadedStrings #-}
15−
16−module QC.IPv6.Internal where {-
17− ( expandTokens
18− , macAddr
19− , maybeIPv6AddrTokens
20− , ipv4AddrToIPv6AddrTokens
21− , ipv6TokensToText
22− , ipv6TokensToIPv6Addr
23− , isIPv6Addr
24− , maybeTokIPv6Addr
25− , maybeTokPureIPv6Addr
26− , fromDoubleColon
27− , fromIPv6Addr
28− , toDoubleColon
29− ) where -}
30−
31−import Debug.Trace
32−import Control.Monad (replicateM)
33−import Data.Attoparsec.Text
34−import Data.Char (isDigit,isHexDigit,toLower)
35−import Data.Monoid ((<>))
36−import Control.Applicative ((<|>),(<*))
37−import Data.List (group,isSuffixOf,elemIndex,elemIndices,intersperse)
38−import Data.Word (Word32)
39−import Numeric (showHex)
40−import qualified Data.Text as T
41−import qualified Data.Text.Read as R (decimal)
42−import Data.Maybe (fromJust)
43−
44−import QC.IPv6.Types
45−
46−tok0 = "0"
47−
48−-- | Returns the 'T.Text' of an IPv6 address.
49−fromIPv6Addr :: IPv6Addr -> T.Text
50−fromIPv6Addr (IPv6Addr t) = t
51−
52−-- | Given an arbitrary list of 'IPv6AddrToken', returns the corresponding 'T.Text'.
53−ipv6TokensToText :: [IPv6AddrToken] -> T.Text
54−ipv6TokensToText l = T.concat $ map ipv6TokenToText l
55−
56−-- | Returns the corresponding 'T.Text' of an IPv6 address token.
57−ipv6TokenToText :: IPv6AddrToken -> T.Text
58−ipv6TokenToText (SixteenBit s) = s
59−ipv6TokenToText Colon = ":"
60−ipv6TokenToText DoubleColon = "::"
61−ipv6TokenToText AllZeros = tok0 -- "A single 16-bit 0000 field MUST be represented as 0" (RFC 5952, 4.1)
62−ipv6TokenToText (IPv4Addr a) = a
63−
64−-- | Returns 'True' if a list of 'IPv6AddrToken' constitutes a valid IPv6 Address.
65−isIPv6Addr :: [IPv6AddrToken] -> Bool
66−isIPv6Addr [] = False
67−isIPv6Addr [DoubleColon] = True
68−isIPv6Addr [DoubleColon,SixteenBit tok1] = True
69−isIPv6Addr tks =
70− diffNext tks && (do
71− let cdctks = countDoubleColon tks
72− let lentks = length tks
73− let lasttk = last tks
74− let lenconst = (lentks == 15 && cdctks == 0) || (lentks < 15 && cdctks == 1)
75− firstValidToken tks &&
76− (case countIPv4Addr tks of
77− 0 -> case lasttk of
78− SixteenBit _ -> lenconst
79− DoubleColon -> lenconst
80− AllZeros -> lenconst
81− _ -> False
82− 1 -> case lasttk of
83− IPv4Addr _ -> (lentks == 13 && cdctks == 0) || (lentks < 12 && cdctks == 1)
84− _ -> False
85− otherwise -> False))
86− where diffNext [] = False
87− diffNext [_] = True
88− diffNext (t:ts) = do
89− let h = head ts
90− case t of
91− SixteenBit _ -> case h of
92− SixteenBit _ -> False
93− AllZeros -> False
94− _ -> diffNext ts
95− AllZeros -> case h of
96− SixteenBit _ -> False
97− AllZeros -> False
98− _ -> diffNext ts
99− _ -> diffNext ts
100− firstValidToken l =
101− case head l of
102− SixteenBit _ -> True
103− DoubleColon -> True
104− AllZeros -> True
105− _ -> False
106− countDoubleColon l = length $ elemIndices DoubleColon l
107− tok1 = "1"
108−
109−countIPv4Addr = foldr oneMoreIPv4Addr 0
110− where
111− oneMoreIPv4Addr t c = case t of
112− IPv4Addr _ -> c + 1
113− otherwise -> c
114−
115−-- | This is the main function which returns 'Just' the list of a tokenized IPv6
116−-- address text representation validated against RFC 4291 and canonized
117−-- in conformation with RFC 5952, or 'Nothing'.
118−maybeTokIPv6Addr :: T.Text -> Maybe [IPv6AddrToken]
119−maybeTokIPv6Addr t =
120− case maybeIPv6AddrTokens t of
121− Just ltks -> if isIPv6Addr ltks
122− then Just $ (ipv4AddrReplacement . toDoubleColon . fromDoubleColon) ltks
123− else Nothing
124− Nothing -> Nothing
125− where
126− ipv4AddrReplacement ltks =
127− if ipv4AddrRewrite ltks
128− then init ltks ++ ipv4AddrToIPv6AddrTokens (last ltks)
129− else ltks
130−
131−-- | Returns 'Just' the list of tokenized pure IPv6 address, always rewriting an
132−-- embedded IPv4 address if present.
133−maybeTokPureIPv6Addr :: T.Text -> Maybe [IPv6AddrToken]
134−maybeTokPureIPv6Addr t = do
135− ltks <- maybeIPv6AddrTokens t
136− if isIPv6Addr ltks
137− then Just $ (toDoubleColon . ipv4AddrReplacement . fromDoubleColon) ltks
138− else Nothing
139− where
140− ipv4AddrReplacement ltks' = init ltks' ++ ipv4AddrToIPv6AddrTokens (last ltks')
141−
142−-- | Tokenize a 'T.Text' into 'Just' a list of 'IPv6AddrToken', or 'Nothing'.
143−maybeIPv6AddrTokens :: T.Text -> Maybe [IPv6AddrToken]
144−maybeIPv6AddrTokens s =
145− case readText s of
146− Done r l -> traceShow (r,l) $ if r==T.empty then Just l else Nothing
147− Fail {} -> Nothing
148− where
149− readText s = feed (parse (many1 $ ipv4Addr <|> sixteenBit <|> doubleColon <|> colon) s) T.empty
150−
151−-- | An embedded IPv4 address have to be rewritten to output a pure IPv6 Address
152−-- text representation in hexadecimal digits. But some well-known prefixed IPv6
153−-- addresses have to keep visible in their text representation the fact that
154−-- they deals with IPv4 to IPv6 transition process (RFC 5952 Section 5):
155−--
156−-- IPv4-compatible IPv6 address like "::1.2.3.4"
157−--
158−-- IPv4-mapped IPv6 address like "::ffff:1.2.3.4"
159−--
160−-- IPv4-translated address like "::ffff:0:1.2.3.4"
161−--
162−-- IPv4-translatable address like "64:ff9b::1.2.3.4"
163−--
164−-- ISATAP address like "fe80::5efe:1.2.3.4"
165−--
166−ipv4AddrRewrite :: [IPv6AddrToken] -> Bool
167−ipv4AddrRewrite tks =
168− case last tks of
169− IPv4Addr _ -> do
170− let itks = init tks
171− not (itks == [DoubleColon]
172− || itks == [DoubleColon,SixteenBit tokffff,Colon]
173− || itks == [DoubleColon,SixteenBit tokffff,Colon,AllZeros,Colon]
174− || itks == [SixteenBit "64",Colon,SixteenBit "ff9b",DoubleColon]
175− || [SixteenBit "200",Colon,SixteenBit tok5efe,Colon] `isSuffixOf` itks
176− || [AllZeros,Colon,SixteenBit tok5efe,Colon] `isSuffixOf` itks
177− || [DoubleColon,SixteenBit tok5efe,Colon] `isSuffixOf` itks)
178− _ -> False
179− where
180− tokffff = "ffff"
181− tok5efe = "5efe"
182−
183−-- | Rewrites an embedded 'IPv4Addr' into the corresponding list of pure 'IPv6Addr' tokens.
184−--
185−-- > ipv4AddrToIPv6AddrTokens (IPv4Addr "127.0.0.1") == [SixteenBits "7f0",Colon,SixteenBits "1"]
186−--
187−ipv4AddrToIPv6AddrTokens :: IPv6AddrToken -> [IPv6AddrToken]
188−ipv4AddrToIPv6AddrTokens t =
189− case t of
190− IPv4Addr a -> do
191− let m = toHex a
192− [ SixteenBit ((!!) m 0 <> addZero ((!!) m 1))
193− , Colon
194− , SixteenBit ((!!) m 2 <> addZero ((!!) m 3)) ]
195− _ -> [t]
196− where
197− toHex a = map (\x -> T.pack $ showHex (read (T.unpack x)::Int) "") $ T.split (=='.') a
198− addZero d = if T.length d == 1 then tok0 <> d else d
199−
200−expandTokens :: [IPv6AddrToken] -> [IPv6AddrToken]
201−expandTokens = map expandToken
202− where expandToken (SixteenBit s) = SixteenBit $ T.justifyRight 4 '0' s
203− expandToken AllZeros = SixteenBit "0000"
204− expandToken t = t
205−
206−fromDoubleColon :: [IPv6AddrToken] -> [IPv6AddrToken]
207−fromDoubleColon tks =
208− if DoubleColon `notElem` tks
209− then tks
210− else do let s = splitAt (fromJust $ elemIndex DoubleColon tks) tks
211− let fsts = fst s
212− let snds = if not (null (snd s)) then tail(snd s) else []
213− let fste = if null fsts then [] else fsts ++ [Colon]
214− let snde = if null snds then [] else Colon : snds
215− fste ++ allZerosTokensReplacement(quantityOfAllZerosTokenToReplace tks) ++ snde
216− where
217− allZerosTokensReplacement x = intersperse Colon (replicate x AllZeros)
218− quantityOfAllZerosTokenToReplace x =
219− ntks tks - foldl (\c x -> if (x /= DoubleColon) && (x /= Colon) then c+1 else c) 0 x
220− where
221− ntks tks = if countIPv4Addr tks == 1 then 7 else 8
222−
223−toDoubleColon :: [IPv6AddrToken] -> [IPv6AddrToken]
224−toDoubleColon tks =
225− zerosToDoubleColon tks (zerosRunToReplace $ zerosRunsList tks)
226− where
227− zerosToDoubleColon :: [IPv6AddrToken] -> (Int,Int) -> [IPv6AddrToken]
228− -- No all zeros token, so no double colon replacement...
229− zerosToDoubleColon ls (_,0) = ls
230− -- "The symbol '::' MUST NOT be used to shorten just one 16-bit 0 field" (RFC 5952 4.2.2)
231− zerosToDoubleColon ls (_,1) = ls
232− zerosToDoubleColon ls (i,l) =
233− let ls' = filter (/= Colon) ls
234− in intersperse Colon (Prelude.take i ls') ++ [DoubleColon] ++ intersperse Colon (drop (i+l) ls')
235− zerosRunToReplace t =
236− let l = longestLengthZerosRun t
237− in (firstLongestZerosRunIndex t l,l)
238− where
239− firstLongestZerosRunIndex x y = sum . snd . unzip $ Prelude.takeWhile (/=(True,y)) x
240− longestLengthZerosRun x =
241− maximum $ map longest x
242− where longest t = case t of
243− (True,i) -> i
244− _ -> 0
245− zerosRunsList x = map helper $ groupZerosRuns x
246− where
247− helper h = (head h == AllZeros, lh) where lh = length h
248− groupZerosRuns = group . filter (/= Colon)
249−
250−ipv6TokensToIPv6Addr :: [IPv6AddrToken] -> Maybe IPv6Addr
251−ipv6TokensToIPv6Addr l = Just $ IPv6Addr $ ipv6TokensToText l
252−
253−fullSixteenBit :: T.Text -> Maybe IPv6AddrToken
254−fullSixteenBit t =
255− case parse ipv6AddrFullChunk t of
256− Done a b -> if a==T.empty then Just $ SixteenBit $ T.pack b else Nothing
257− _ -> Nothing
258−
259−macAddr :: Parser (Maybe [IPv6AddrToken])
260−macAddr = do
261− n1 <- count 2 hexaChar <* ":"
262− n2 <- count 2 hexaChar <* ":"
263− n3 <- count 2 hexaChar <* ":"
264− n4 <- count 2 hexaChar <* ":"
265− n5 <- count 2 hexaChar <* ":"
266− n6 <- count 2 hexaChar
267− return $ maybeIPv6AddrTokens $ T.pack $ concat [n1,n2,n3,n4,n5,n6]
268−
269−sixteenBit :: Parser IPv6AddrToken
270−sixteenBit = do
271− r <- ipv6AddrFullChunk <|> count 3 hexaChar <|> count 2 hexaChar <|> count 1 hexaChar
272− -- "Leading zeros MUST be suppressed" (RFC 5952, 4.1)
273− let r' = T.dropWhile (=='0') $ T.pack r
274− return $ if T.null r'
275− then AllZeros
276− -- Hexadecimal digits MUST be in lowercase (RFC 5952 4.3)
277− else SixteenBit $ T.toLower r'
278−
279−ipv4Addr :: Parser IPv6AddrToken
280−ipv4Addr = do
281− n1 <- manyDigits <* "."
282− if n1 /= T.empty
283− then do n2 <- manyDigits <* "."
284− if n2 /= T.empty
285− then do n3 <- manyDigits <* "."
286− if n3 /= T.empty
287− then do n4 <- manyDigits
288− if n4 /= T.empty
289− then return $ IPv4Addr $ T.intercalate "." [n1,n2,n3,n4]
290− else parserFailure
291− else parserFailure
292− else parserFailure
293− else parserFailure
294− where
295− parserFailure = fail "ipv4Addr parsing failure"
296− manyDigits = do
297− ds <- takeWhile1 isDigit
298− case R.decimal ds of
299− Right (n,_) -> return (if n < 256 then T.pack $ show n else T.empty)
300− Left _ -> return T.empty
301−
302−doubleColon :: Parser IPv6AddrToken
303−doubleColon = do
304− string "::"
305− return DoubleColon
306−
307−colon :: Parser IPv6AddrToken
308−colon = do
309− string ":"
310− return Colon
311−
312−ipv6AddrFullChunk :: Parser String
313−ipv6AddrFullChunk = count 4 hexaChar
314−
315−hexaChar :: Parser Char
316−hexaChar = satisfy (inClass "0-9a-fA-F")
tests/QC/IPv6/Types.hsdeleted−29
@@ -1,29 +0,0 @@
1−-- -----------------------------------------------------------------------------
2−
3−-- |
4−-- Module : Text.IPv6Addr
5−-- Copyright : Copyright © Michel Boucey 2011-2015
6−-- License : BSD-Style
7−-- Maintainer : michel.boucey@gmail.com
8−--
9−-- Dealing with IPv6 address text representations, canonization and manipulations.
10−--
11−
12−-- -----------------------------------------------------------------------------
13−
14−module QC.IPv6.Types where
15−
16−import qualified Data.Text as T
17−
18−data IPv6Addr = IPv6Addr T.Text
19−
20−instance Show IPv6Addr where
21− show (IPv6Addr addr) = T.unpack addr
22−
23−data IPv6AddrToken
24− = SixteenBit T.Text -- ^ A four hexadecimal digits group representing a 16-Bit chunk
25− | AllZeros -- ^ An all zeros 16-Bit chunk
26− | Colon -- ^ A separator between 16-Bit chunks
27− | DoubleColon -- ^ A double-colon stands for a unique compression of many consecutive 16-Bit chunks
28− | IPv4Addr T.Text -- ^ An embedded IPv4 address as representation of the last 32-Bit
29− deriving (Eq,Show)
tests/QC/Rechunked.hsdeleted−56
@@ -1,56 +0,0 @@
1−{-# LANGUAGE BangPatterns #-}
2−
3−module QC.Rechunked (
4− rechunkBS
5− , rechunkT
6− ) where
7−
8−import Control.Monad (forM, forM_)
9−import Control.Monad.ST (ST, runST)
10−import Data.List (unfoldr)
11−import Test.QuickCheck (Gen, choose)
12−import qualified Data.ByteString as B
13−import qualified Data.Text as T
14−import qualified Data.Vector as V
15−import qualified Data.Vector.Generic as G
16−import qualified Data.Vector.Generic.Mutable as M
17−
18−rechunkBS :: B.ByteString -> Gen [B.ByteString]
19−rechunkBS = fmap (map B.copy) . rechunk_ B.splitAt B.length
20−
21−rechunkT :: T.Text -> Gen [T.Text]
22−rechunkT = fmap (map T.copy) . rechunk_ T.splitAt T.length
23−
24−rechunk_ :: (Int -> a -> (a,a)) -> (a -> Int) -> a -> Gen [a]
25−rechunk_ split len xs = (unfoldr go . (,) xs) `fmap` rechunkSizes (len xs)
26− where go (b,r:rs) = Just (h, (t,rs))
27− where (h,t) = split r b
28− go (_,_) = Nothing
29−
30−rechunkSizes :: Int -> Gen [Int]
31−rechunkSizes n0 = shuffle =<< loop [] (0:repeat 1) n0
32− where loop _ [] _ = error "it's 2015, where's my Stream type?"
33− loop acc (lb:lbs) n
34− | n <= 0 = shuffle (reverse acc)
35− | otherwise = do
36− !i <- choose (lb,n)
37− loop (i:acc) lbs (n-i)
38−
39−shuffle :: [Int] -> Gen [Int]
40−shuffle (0:xs) = (0:) `fmap` shuffle xs
41−shuffle xs = fisherYates xs
42−
43−fisherYates :: [a] -> Gen [a]
44−fisherYates xs = (V.toList . V.backpermute v) `fmap` swapIndices (G.length v)
45− where
46− v = V.fromList xs
47− swapIndices n0 = do
48− swaps <- forM [0..n] $ \i -> ((,) i) `fmap` choose (i,n)
49− return (runST (swapAll swaps))
50− where
51− n = n0 - 1
52− swapAll :: [(Int,Int)] -> ST s (V.Vector Int)
53− swapAll ijs = do
54− mv <- G.unsafeThaw (G.enumFromTo 0 n :: V.Vector Int)
55− forM_ ijs $ uncurry (M.swap mv)
56− G.unsafeFreeze mv
tests/QC/Simple.hsdeleted−37
@@ -1,37 +0,0 @@
1−{-# LANGUAGE OverloadedStrings #-}
2−{-# OPTIONS_GHC -fno-warn-missing-signatures #-}
3−
4−module QC.Simple (
5− tests
6− ) where
7−
8−import Control.Applicative ((<|>))
9−import Data.ByteString (ByteString)
10−import Data.List (foldl')
11−import Data.Maybe (fromMaybe)
12−import QC.Rechunked (rechunkBS)
13−import Test.Tasty (TestTree)
14−import Test.Tasty.QuickCheck (testProperty)
15−import Test.QuickCheck (Property, counterexample, forAll)
16−import qualified Data.Attoparsec.ByteString.Char8 as A
17−
18−t_issue75 = expect issue75 "ab" (A.Done "" "b")
19−
20−issue75 :: A.Parser ByteString
21−issue75 = "a" >> ("b" <|> "")
22−
23−expect :: (Show r, Eq r) => A.Parser r -> ByteString -> A.Result r -> Property
24−expect p input wanted =
25− forAll (rechunkBS input) $ \in' ->
26− let result = parse p in'
27− in counterexample (show result ++ " /= " ++ show wanted) $
28− fromMaybe False (A.compareResults result wanted)
29−
30−parse :: A.Parser r -> [ByteString] -> A.Result r
31−parse p (x:xs) = foldl' A.feed (A.parse p x) xs
32−parse p [] = A.parse p ""
33−
34−tests :: [TestTree]
35−tests = [
36− testProperty "issue75" t_issue75
37− ]
tests/QC/Text.hsdeleted−203
@@ -1,203 +0,0 @@
1−{-# LANGUAGE BangPatterns, CPP, OverloadedStrings #-}
2−{-# OPTIONS_GHC -fno-warn-warnings-deprecations #-}
3−module QC.Text (tests) where
4−
5−#if !MIN_VERSION_base(4,8,0)
6−import Control.Applicative ((<*>), (<$>))
7−#endif
8−import Data.Int (Int64)
9−import Data.Word (Word8)
10−import Prelude hiding (take, takeWhile)
11−import QC.Common (liftOp, parseT)
12−import qualified QC.Text.FastSet as FastSet
13−import qualified QC.Text.Regressions as Regressions
14−import Test.Tasty (TestTree, testGroup)
15−import Test.Tasty.QuickCheck (testProperty)
16−import Test.QuickCheck
17−import qualified Data.Attoparsec.Text as P
18−import qualified Data.Attoparsec.Text.Lazy as PL
19−import qualified Data.Attoparsec.Text.FastSet as S
20−import qualified Data.ByteString as BS
21−import qualified Data.Char as Char
22−import qualified Data.Text as T
23−import qualified Data.Text.Encoding as TE
24−import qualified Data.Text.Lazy as L
25−
26−-- Basic byte-level combinators.
27−
28−satisfy :: Char -> L.Text -> Property
29−satisfy w s = parseT (P.satisfy (<=w)) (L.cons w s) === Just w
30−
31−satisfyWith :: Char -> L.Text -> Property
32−satisfyWith c s = parseT (P.satisfyWith id (<=c)) (L.cons c s) === Just c
33−
34−char :: Char -> L.Text -> Property
35−char w s = parseT (P.char w) (L.cons w s) === Just w
36−
37−skip :: Char -> L.Text -> Property
38−skip w s =
39− case (parseT (P.skip (<w)) s, L.uncons s) of
40− (Nothing, mcs) -> maybe (property True) (expectFailure . it) mcs
41− (Just _, mcs) -> maybe (property False) it mcs
42− where it cs = liftOp "<" (<) (fst cs) w
43−
44−anyChar :: L.Text -> Property
45−anyChar s
46− | L.null s = p === Nothing
47− | otherwise = p === Just (L.head s)
48− where p = parseT P.anyChar s
49−
50−notChar :: Char -> NonEmptyList Char -> Property
51−notChar w (NonEmpty s) = parseT (P.notChar w) bs === if v == w
52− then Nothing
53− else Just v
54− where v = L.head bs
55− bs = L.pack s
56−
57−peekChar :: L.Text -> Property
58−peekChar s
59− | L.null s = p === Just (Nothing, s)
60− | otherwise = p === Just (Just (L.head s), s)
61− where p = parseT ((,) <$> P.peekChar <*> P.takeLazyText) s
62−
63−peekChar' :: L.Text -> Property
64−peekChar' s = parseT P.peekChar' s === (fst <$> L.uncons s)
65−
66−string :: L.Text -> L.Text -> Property
67−string s t = parseT (P.string s') (s `L.append` t) === Just s'
68− where s' = toStrict s
69−
70−strings :: L.Text -> L.Text -> L.Text -> Property
71−strings s t u =
72− parseT (P.string (toStrict s) >> P.string t') (L.concat [s,t,u])
73− === Just t'
74− where t' = toStrict t
75−
76−-- | Note: "simple, and efficient" works for well formed input...
77−-- i.e. e.g. Latin1 texts
78−stringCI :: [Word8] -> Property
79−stringCI ws = P.parseOnly (P.stringCI fs) s === Right s
80− where fs = T.toCaseFold s
81− s = TE.decodeLatin1 (BS.pack ws)
82−
83−asciiCI :: T.Text -> Gen Bool
84−asciiCI x =
85− (\s i -> P.parseOnly (P.asciiCI s) i == Right i)
86− <$> maybeModifyCase x
87− <*> maybeModifyCase x
88− where
89− maybeModifyCase s = elements [s, toLower s, toUpper s]
90− toLower = T.map (\c -> if c < Char.chr 127 then Char.toLower c else c)
91− toUpper = T.map (\c -> if c < Char.chr 127 then Char.toUpper c else c)
92−
93−toStrict :: L.Text -> T.Text
94−toStrict = T.concat . L.toChunks
95−
96−skipWhile :: Char -> L.Text -> Property
97−skipWhile w s =
98− let t = L.dropWhile (<=w) s
99− in case PL.parse (P.skipWhile (<=w)) s of
100− PL.Done t' () -> t === t'
101− _ -> property False
102−
103−take :: Int -> L.Text -> Property
104−take n s = maybe (liftOp "<" (<) (L.length s) (fromIntegral n))
105− (=== T.take n (toStrict s)) $
106− parseT (P.take n) s
107−
108−takeText :: L.Text -> Property
109−takeText s = maybe (property False) (=== toStrict s) . parseT P.takeText $ s
110−
111−takeLazyText :: L.Text -> Property
112−takeLazyText s = maybe (property False) (=== s) . parseT P.takeLazyText $ s
113−
114−takeCount :: Positive Int -> L.Text -> Property
115−takeCount (Positive k) s =
116− case parseT (P.take k) s of
117− Nothing -> liftOp ">" (>) (fromIntegral k) (L.length s)
118− Just _s -> liftOp "<=" (<=) (fromIntegral k) (L.length s)
119−
120−takeWhile :: Char -> L.Text -> Property
121−takeWhile w s =
122− let (h,t) = L.span (==w) s
123− in case PL.parse (P.takeWhile (==w)) s of
124− PL.Done t' h' -> t === t' .&&. toStrict h === h'
125− _ -> property False
126−
127−takeWhile1 :: Char -> L.Text -> Property
128−takeWhile1 w s =
129− let s' = L.cons w s
130− (h,t) = L.span (<=w) s'
131− in case PL.parse (P.takeWhile1 (<=w)) s' of
132− PL.Done t' h' -> t === t' .&&. toStrict h === h'
133− _ -> property False
134−
135−takeTill :: Char -> L.Text -> Property
136−takeTill w s =
137− let (h,t) = L.break (==w) s
138− in case PL.parse (P.takeTill (==w)) s of
139− PL.Done t' h' -> t === t' .&&. toStrict h === h'
140− _ -> property False
141−
142−takeWhile1_empty :: Property
143−takeWhile1_empty = parseT (P.takeWhile1 undefined) L.empty === Nothing
144−
145−endOfInput :: L.Text -> Property
146−endOfInput s = parseT P.endOfInput s === if L.null s
147− then Just ()
148− else Nothing
149−
150−endOfLine :: L.Text -> Property
151−endOfLine s =
152− case (parseT P.endOfLine s, L.uncons s) of
153− (Nothing, mcs) -> maybe (property True) (expectFailure . eol) mcs
154− (Just _, mcs) -> maybe (property False) eol mcs
155− where eol (c,s') = c === '\n' .||.
156− (c, fst <$> L.uncons s') === ('\r', Just '\n')
157−
158−scan :: L.Text -> Positive Int64 -> Property
159−-- for some reason, if counterexample is removed, this test fails?
160−scan s (Positive k) = counterexample (show s)
161− $ parseT p s === Just (toStrict $ L.take k s)
162− where p = P.scan k $ \ n _ ->
163− if n > 0 then let !n' = n - 1 in Just n' else Nothing
164−
165−members :: String -> Property
166−members s = property $ all (`S.member` set) s
167− where set = S.fromList s
168−
169−nonmembers :: String -> String -> Property
170−nonmembers s s' = property . not . any (`S.member` set) $ filter (not . (`elem` s)) s'
171− where set = S.fromList s
172−
173−tests :: [TestTree]
174−tests = [
175− testProperty "anyChar" anyChar
176− , testProperty "asciiCI" asciiCI
177− , testProperty "char" char
178− , testProperty "endOfInput" endOfInput
179− , testProperty "endOfLine" endOfLine
180− , testProperty "notChar" notChar
181− , testProperty "peekChar" peekChar
182− , testProperty "peekChar'" peekChar'
183− , testProperty "satisfy" satisfy
184− , testProperty "satisfyWith" satisfyWith
185− , testProperty "scan" scan
186− , testProperty "skip" skip
187− , testProperty "skipWhile" skipWhile
188− , testProperty "string" string
189− , testProperty "strings" strings
190− , testProperty "stringCI" stringCI
191− , testProperty "take" take
192− , testProperty "takeText" takeText
193− , testProperty "takeCount" takeCount
194− , testProperty "takeLazyText" takeLazyText
195− , testProperty "takeTill" takeTill
196− , testProperty "takeWhile" takeWhile
197− , testProperty "takeWhile1" takeWhile1
198− , testProperty "takeWhile1_empty" takeWhile1_empty
199− , testProperty "members" members
200− , testProperty "nonmembers" nonmembers
201− , testGroup "FastSet" FastSet.tests
202− , testGroup "Regressions" Regressions.tests
203− ]
tests/QC/Text/FastSet.hsdeleted−15
@@ -1,15 +0,0 @@
1−module QC.Text.FastSet where
2−
3−import Test.Tasty (TestTree)
4−import Test.Tasty.QuickCheck (testProperty)
5−import Test.QuickCheck
6−import qualified Data.Attoparsec.Text.FastSet as FastSet
7−
8−membershipCorrect :: String -> String -> Property
9−membershipCorrect members others =
10− let fs = FastSet.fromList members
11− correct c = (c `FastSet.member` fs) == (c `elem` members)
12− in property $ all correct (members ++ others)
13−
14−tests :: [TestTree]
15−tests = [ testProperty "membership is correct" membershipCorrect ]
tests/QC/Text/Regressions.hsdeleted−54
@@ -1,54 +0,0 @@
1−{-# LANGUAGE OverloadedStrings #-}
2−
3−module QC.Text.Regressions (
4− tests
5− ) where
6−
7−import Data.Text (Text)
8−import qualified Data.Text as T
9−import Data.List (foldl')
10−import Data.Maybe (fromMaybe)
11−import Data.Char (isLower)
12−import Data.Monoid ((<>))
13−import QC.Rechunked (rechunkT)
14−import Test.Tasty (TestTree)
15−import Test.Tasty.QuickCheck (testProperty)
16−import Test.QuickCheck (Property, counterexample, forAll)
17−import qualified Data.Attoparsec.Text as A
18−
19−
20−--------------------------------------------------------------------------------
21−-- 105 was about runScanner not always returning the final state. The result
22−-- did depend on how the data was fed to the parser.
23−
24−t_issue105 :: Property
25−t_issue105 = expect issue105 "lowER" (A.Done "ER" "low")
26−
27−issue105 :: A.Parser Text
28−issue105 = do
29− (_, firstFourLowercaseLetters) <- A.runScanner "" f
30− return $ firstFourLowercaseLetters
31−
32− where
33− f :: Text -> Char -> Maybe Text
34− f acc c = if T.length acc < 4 && isLower c
35− then Just $ acc <> T.singleton c
36− else Nothing
37−
38−
39−expect :: (Show r, Eq r) => A.Parser r -> Text -> A.Result r -> Property
40−expect p input wanted =
41− forAll (rechunkT input) $ \in' ->
42− let result = parse p in'
43− in counterexample (show result ++ " /= " ++ show wanted) $
44− fromMaybe False (A.compareResults result wanted)
45−
46−parse :: A.Parser r -> [Text] -> A.Result r
47−parse p (x:xs) = foldl' A.feed (A.parse p x) xs
48−parse p [] = A.parse p ""
49−
50−
51−tests :: [TestTree]
52−tests = [
53− testProperty "issue105" t_issue105
54− ]